WO2021202440A1 - Aptamers against sars-cov-2, compositions comprising aptamers against sars-cov-2 and methods of using the same - Google Patents

Aptamers against sars-cov-2, compositions comprising aptamers against sars-cov-2 and methods of using the same Download PDF

Info

Publication number
WO2021202440A1
WO2021202440A1 PCT/US2021/024766 US2021024766W WO2021202440A1 WO 2021202440 A1 WO2021202440 A1 WO 2021202440A1 US 2021024766 W US2021024766 W US 2021024766W WO 2021202440 A1 WO2021202440 A1 WO 2021202440A1
Authority
WO
WIPO (PCT)
Prior art keywords
aptamer
cov
sars
protein
aptamers
Prior art date
Application number
PCT/US2021/024766
Other languages
French (fr)
Inventor
Ronald J. Shannon
Gregory PENNER
Original Assignee
Biovector, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biovector, Inc. filed Critical Biovector, Inc.
Publication of WO2021202440A1 publication Critical patent/WO2021202440A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3517—Marker; Tag
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • Embodiments of the present disclosure relate to aptamers that specifically bind to spike proteins on the surface of the SARS-CoV-2 pathogen, and methods of using the same. Embodiments of the disclosure relate to methods of detecting the presence of SARS-CoV-2 pathogen on a surface.
  • BACKGROUND [0004] SARS-CoV-2 is a member of the coronavirus family of pathogens.
  • Coronaviruses are the largest group of viruses belonging to the Nidovirales order. These viruses cause a variety of diseases in animals, including intestinal and respiratory infections. Coronaviruses can also infect across species barriers causing such respiratory illness in human. These infections were thought to cause only mild respiratory symptoms in humans until the SARS (Severe Acute Respiratory Syndrome)-CoV outbreak of 2002-2003, which led to severe respiratory disease in many infected individuals. More recently, SARS-CoV-2 has emerged as the pathogen responsible for the COVID-19 pandemic of 2020-21, which has led to 1.47 million deaths worldwide (as of Nov. 30, 2020). While it is understood that the principal method of transmission of SARS-CoV-2 viral particles is through direct human to human transmission e.g.
  • an aptamer having a specific binding affinity for a surface protein of a SARS-CoV-2 virus particle or fragment thereof.
  • the aptamer has a specific binding affinity for a spike protein or fragment thereof, wherein the spike protein is on a surface of SARS-CoV-2. In some embodiments, the aptamer has a specific binding affinity for the S1 domain of the spike protein or fragment thereof. In some embodiments, the aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. In some embodiments, the aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. In some embodiments, the aptamer comprises a single- stranded DNA aptamer.
  • the aptamer comprises a detectable label.
  • the detectable label comprises a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non- metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, a liposome, or combination thereof.
  • the aptamer has a specific binding affinity for insert region 1 (VSGTNGT, SEQ ID NO: 16), insert region 2 (KSWM, SEQ ID NO: 17), insert region 3 (RSYLTP, SEQ ID NO: 18), or insert region 4 (SPRR SEQ ID NO: 19) of the S1 domain of spike protein.
  • a composition comprising at least one aptamer having a specific binding affinity for a surface protein of a SARS-CoV-2 virus particle or fragment thereof.
  • the at least one aptamer has a specific binding affinity for a spike protein or fragment thereof, wherein the spike protein is on a surface of SARS-CoV-2.
  • the at least one aptamer has a specific binding affinity for the S1 domain of the spike protein or fragment thereof.
  • the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • the at least one aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • the at least one aptamer comprises a single-stranded DNA aptamer.
  • the at least one aptamer comprises a detectable label.
  • the composition further comprises graphene oxide (GO).
  • the detectable label comprises a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non- metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, a liposome, or combination thereof.
  • the aptamer has a specific binding affinity for insert region 1 (VSGTNGT , SEQ ID NO: 16), insert region 2 (KSWM, SEQ ID NO: 17), insert region 3 (RSYLTP SEQ ID NO: 18), or insert region 4 (SPRR SEQ ID NO: 19) of the S1 domain of spike protein.
  • VSGTNGT insert region 1
  • KSWM insert region 2
  • RYLTP SEQ ID NO: 18 insert region 3
  • SPRR SEQ ID NO: 19 insert region 4
  • a composition comprising two or more aptamers having a specific binding affinity for two or more different epitopes of a S1 subunit of the spike protein of SARS-CoV-2, wherein the two or more aptamers have a different nucleotide sequence.
  • a method of visualizing a SARS-CoV-2 virus particle on a surface comprising: contacting a surface with at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein, wherein the SARS-CoV- 2 protein comprises an S1 domain of the spike protein on a surface of SARS-CoV-2 or fragment thereof; and visualizing the presence or absence of the SARS-CoV-2 virus particle on the surface.
  • the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • the aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • the aptamer is conjugated to a detectable moiety thereby forming an aptamer conjugate.
  • the detectable moiety is a fluorophore.
  • the fluorophore emits at a wavelength of between about 500 nm and 510 nm.
  • the method further comprises illuminating the surface with a light source.
  • the light source has a predetermined wavelength, and the predetermined wavelength corresponds to a wavelength of light emitted by the detectable moiety of the aptamer conjugate. In some embodiments, the light source is configured to produce light at a wavelength of between about 485 nm and 515 nm. [0015] In some embodiments, the method further comprises filtering the light produced by the light source. In some embodiments, the method further comprises passing the light produced from the light source through a bandpass filter. In some embodiments, the method further comprises photographing a location on the surface and detecting the presence or absence of the conjugated aptamer bound to SARS- CoV-2.
  • a method of visualizing a SARS-CoV-2 virus particle on a surface comprising: contacting a surface with a composition comprising at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein, wherein the SARS-CoV-2 protein comprises an S1 domain of the spike protein on a surface of SARS-CoV-2 or fragment thereof; and visualizing the presence or absence of the SARS-CoV-2 virus particle on the surface.
  • the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • the composition comprises two or more different aptamers.
  • the at least one aptamer comprises a detectable label.
  • the detectable label is a fluorescent label.
  • the fluorescent label is quenchable by a quencher.
  • the composition further comprising an antisense nucleic acid comprising a quencher, wherein the an antisense nucleic acid is complementary to a sequence of the at least one aptamer, wherein the antisense nucleic acid is bound to the at least one aptamer when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof and wherein the antisense nucleic acid is not bound to the at least one aptamer when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof.
  • the at least one aptamer comprises the quencher, wherein the quencher is proximal to the fluorescent label such that fluorescence is quenched when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof, and wherein the quencher is distal to the fluorescent label such that fluorescence is not quenched when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof.
  • the at least one aptamer is not bound to the SARS- CoV-2 protein or fragment thereof, the fluorescent label is quenched, and wherein, when the aptamer the SARS-CoV-2 protein or fragment thereof, the fluorescent label is not quenched.
  • the method further comprises measuring a FRET signal between the quencher molecule and the fluorescent label.
  • the composition further comprises graphene oxide.
  • the surface is an organic or inorganic surface.
  • a method of detecting the presence or absence of SARS-CoV-2 comprising: providing one or more aptamers conjugated to a detectable moiety, wherein the one or more aptamers have a specific binding affinity for a SARS-CoV-2 protein or fragment thereof, combining the one or more aptamers with graphene oxide, contacting the aptamer-graphene oxide combination with a sample to be tested; and visualizing the detectable moiety of the aptamer conjugate bound to a SARS-CoV-2 protein.
  • the detectable moiety is a fluorescent label.
  • the one or more aptamers comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • the graphene oxide is in the form of nanoparticles.
  • the fluorescence of the fluorescent label is quenched by the association with the graphene oxide nanoparticle surface.
  • FIG.1A shows a schematic aptamer of the na ⁇ ve aptamer library
  • FIG.1B shows a selection process for developing a single stranded aptamer
  • FIG.2A shows the functional subunits of the SARS-CoV S protein
  • FIG.2B shows the SARS-CoV S protein highlighting epitope differences in the receptor binding motif (illustrated in the darkened portion on the top) between SARS-CoV-2 and SARS-CoV
  • FIG. 2C shows a top view of the SARS-CoV S protein of FIG.
  • FIG.3 shows a model aptamer selection process
  • FIG. 4A shows a protein model of a 3-dimensional structure of the S1 domain of SARS-CoV-2 spike protein highlighting regions of primary epitope difference between SARS-CoV-2 and SARS-CoV S1 protein
  • FIG.4B shows a magnified perspective of the physical relationship between two amino acid motifs present in the S1 domain of SARS-CoV-2 spike protein and absent in the S1 domain of SARS-CoV spike protein
  • FIG. 5 shows a graphical representation plotting the effect of different concentrations of antisense strand in the presence and in the absence of target protein
  • FIG. 4A shows a protein model of a 3-dimensional structure of the S1 domain of SARS-CoV-2 spike protein highlighting regions of primary epitope difference between SARS-CoV-2 and SARS-CoV S1 protein
  • FIG.4B shows a magnified perspective of the physical relationship between two amino acid motifs present in the S1 domain of SARS-CoV-2 spike protein and absent in the S
  • FIG.6 shows the proportional difference in fluorescence between the presence and absence of target as a function of antisense strand concentration
  • FIG.7A shows an aptamer selection process for selection rounds 1-6
  • FIG.7B shows an aptamer selection process for selection rounds 6-8
  • FIG.8 provides an overview of the enrichment trajectories of the top twenty sequences analysed in selection round 8 for SARS-CoV-2 S1 protein displayed as frequency of sequence (selection round 6; selection round 7);
  • FIG.9 provides a comparison of the enrichment rates between the selection for SARS-CoV-2 S1 and SARS-CoV S1 proteins in selection round 8 displayed as frequency of sequence;
  • FIG.10 shows the predicted aptamer shapes for Cov19-1 (SEQ ID NO: 3); [0042] FIG.
  • FIG. 11 shows the predicted aptamer shapes for Cov19-1 (SEQ ID NO: 3) and Cov19-1.2 (SEQ ID NO: 12); [0043] FIG. 12 shows the predicted aptamer shapes for Cov19-5 (SEQ ID NO: 7) and Cov19-5.1 (SEQ ID NO: 13); [0044] FIG.13 shows the predicted aptamer shapes for Cov19-6 (SEQ ID NO: 8); [0045] FIG.14 shows the predicted aptamer shape for Cov19-6.1 (SEQ ID NO: 14); [0046] FIG.
  • FIG. 15 shows the predicted aptamer shapes for Cov19-13 (SEQ ID NO: 9) and Cov19-13.1 (SEQ ID NO: 15);
  • FIG.16 is a bar graph showing the apparent percent of aptamer bound for different concentration titrates of live virus binding to aptamer Cov19-5.1;
  • FIG. 17 illustrates the positioning of the camera and special flashlight relative to the spots on the surface;
  • FIG. 18 is a photograph showing the virus spots on the stainless-steel surface as visualized with the camera and flashlight apparatus immediately prior to the application of the Aptamer + graphene oxide (GO) formulation;
  • FIG. 19 is a photograph showing the virus spots on the stainless-steel surface as visualized with the camera and flashlight apparatus immediately after the application of the Aptamer + GO formulation; and [0051] FIG. 20 is a photograph showing the virus spots on the stainless-steel surface as visualized with the camera and flashlight apparatus 24 minutes after the application of the Aptamer + GO formulation.
  • DETAILED DESCRIPTION Certain terminology is used in the following description for convenience only and is not limiting. The phrase “at least one” followed by a list of two or more items such as A, B, or C, means any individual one of A, B, or C as well as any combination thereof.
  • SARS-CoV-2 is a member of the coronavirus family of pathogens.
  • Coronaviruses are the largest group of viruses belonging to the Nidovirales order. These viruses cause a variety of diseases in animals, including intestinal and respiratory infections. Coronaviruses can also infect across species barriers causing such respiratory illness in human. However, these infections were thought to cause only mild respiratory symptoms in humans until the SARS (Severe Acute Respiratory Syndrome)-CoV outbreak of 2002-2003, which led to severe respiratory disease in many of infected individuals.
  • coronavirus family At least 6 members have been shown to transmit within humans: HCoV-OC43, HCoV-HKU1, HCoV-NL63, HCoV-229E, SARS-CoV, and MERS (Middle East Respiratory Syndrome)-CoV, responsible for the epidemic that emerged in the Middle East in 2012. The former four of this family are responsible for causing an estimated 15% to 30% of respiratory tract infections each year, while the latter two of this family demonstrated more severe respiratory disease. SARS-CoV-2 is a pathogen responsible for severe respiratory disease outbreaks.
  • Coronaviruses comprise a non-segmented, positive-sense RNA genome of approximately 30 kb.
  • SARS-CoV-2 like other coronaviruses is a single-positive-stranded RNA virus whose genome contains 29891 nucleotides, corresponding to 9860 amino acids.
  • SARS-CoV-2 may have evolved from a strain of coronavirus found in bats.
  • Evidence to support this includes the fact that SARS ⁇ CoV ⁇ 2 shares 88% sequence identity to two coronaviruses found in bats, bat ⁇ SL-CoVZC45 and bat ⁇ SL ⁇ CoVZXC21. [0059] Further, evidence demonstrates that both SARS-CoV and MERS-CoV originated from bats as well.
  • SARS-CoV-2 also shares 79% sequence identity with SARS-CoV and 50% sequence identity with MERS-CoV. [0060] Regarding the individual domains of SARS-CoV-2, the nucleocapsid (N) protein portion has nearly 90% amino acid sequence identity with SARS-CoV.
  • the spike (S) protein of coronaviruses is a large type 1 transmembrane protein, which is highly glycosylated, containing 21 to 35 N-glycosylation sites.
  • S protein of SARS-CoV-2 has a higher sequence identity with the S protein of SARS-CoV compared with the S protein of MERS CoV, the amino acid sequence of SARS-CoV-2 differs from other coronaviruses specifically in the regions of 1ab polyprotein and the surface glycoprotein or S-protein.
  • All coronavirus S proteins share the same organization in two domains.
  • S1 An N-terminal domain called S1 which is responsible for receptor binding
  • C- terminal S2 domain which is responsible for membrane fusion of the virus with a target cell.
  • Diversity among coronaviruses is often reflected in the variable S proteins, which have evolved into forms that differ in their ability to interact with receptors on target cells and in their response to various environmental stimuli of virus-target cell membrane fusion.
  • S2 domain is most conserved among coronaviruses.
  • the S1 domain diverges in sequence even among species of a single coronavirus.
  • Within the S1 domain are an N-terminal domain and a C-terminal domain, both which function as receptor binding domains.
  • FIG.2A shows the functional subunits of the SARS-CoV S protein
  • FIG. 2B shows the SARS-CoV S protein highlighting epitope differences in the receptor binding motif (illustrated in the darkened portion on the top) between SARS- CoV-2 and SARS-CoV
  • FIG. 2C shows a top view of the SARS-CoV S protein of FIG.2B with the receptor binding motif illustrated in the darkened portion.
  • the S1 domain of coronaviruses may recognize different receptors on target cells.
  • SARS-CoV recognizes and interacts with angiotensin converting enzyme (ACE2), which is expressed in human airway epithelia, as well as lung parenchyma.
  • ACE2 angiotensin converting enzyme
  • MERS-CoV recognizes and interacts with dipeptidyl peptidase 4 (DPP4) on target cells, while other coronaviruses interact with aminopeptidase (APN).
  • DPP4 dipeptidyl peptidase 4
  • APN aminopeptidase
  • SARS-CoV-2 interacts with and uses the ACE2 receptor for entry, and the cellular serine protease TMPRSS2 for S protein priming.
  • furin may also play a role in precleavage at the S1/S2 site infected cells.
  • SARS-CoV-2 spike glycoproteins allow the virus to stick more strongly to the surface of target cells than previous coronaviruses, including the ones responsible for SARS-CoV and MERS-CoV. This may aid, at least in part, the transmission of SARS-CoV-2; less virus may be needed to infect a person if the bond between viral protein and target cells is tighter.
  • SARS-CoV-2 like other members of the coronavirus family, has a crown- like appearance under an electron microscope due to the presence of spike (S) proteins, which assemble into trimers on the virus’ surface. These trimers form a distinctive crown-like, or “corona”-like appearance.
  • SARS-CoV-2 has a round or elliptical form and has a diameter of approximately 60 nM – 140 nM.
  • Another feature of the spikes of coronaviruses is that each spike is formed by the connected S1 and S2 domains described above, and the spike activates and allows for the virus to enter a target cell only once these domains are cleaved. The separation of these domains from one another in SARS-CoV was more difficult compared with those of SARS-CoV-2.
  • the SARS-CoV-2 spike proteins may have a furin-like cleavage site, similar to MERS-CoV, making SARS-CoV-2 spike proteins readily cut by the enzyme furin, which is expressed in human organs such as liver, small intestines, and lungs, meaning that the virus can potentially attack several organs at once.
  • viral transmission may be via direct person-to- person contact or via contact with a surface on which viral particles are located.
  • the principal method of transmission of SARS- CoV-2 viral particles is through direct human to human transmission, e.g.
  • SARS-CoV-2 in order to minimize the spread of SARS-CoV-2 via fomite transmission, it is important to know if a surface is contaminated with SARS-CoV-2 and, if so, disinfect the surface to kill the viral particles. Particularly, although not exclusively, it may be advantageous to determine viral load in a total environmental surface area rather than small sampled surfaces as this would facilitate proper use of cleaning and disinfection targeted to hot spot areas.
  • Being able to identify/visualize SARS-CoV-2 on surfaces may help reduce spread of the virus. Detected virus may be avoided or targeted for destruction.
  • SARS-CoV-2’s ability to survive on surfaces varies; however, it is not thought to last for extended periods of time.
  • SARS-CoV-2 may rest intact for approximately one day on cardboard and about two-three days on steel and plastic surfaces.
  • each SARS-CoV-2 particle is enclosed by a sphere of lipid molecules, they can be disrupted by common disinfectants and detergents. Washing these surfaces, including skin, is effective at disrupting the lipid coat of SARS-CoV- 2, and killing it.
  • SARS-CoV-2 Current measures for curbing transmission of SARS-CoV-2 include: identifying patients with severe acute respiratory infections at first point of contact to minimise exposure to others; use of personal protection equipment (PPE) to avoid direct contact with patient’s secretions or bodily fluids; good hand hygiene, including cleaning hands with soap and water or an alcohol-based hand rub to prevent SARS- CoV-2 from being passed from one person to another; carefully cleaning hospital rooms and medical equipment that have been used for patients with SARS-CoV-2; using contact precautions to prevent SARS-CoV-2 from spreading to others; maintaining acceptable distances from potential carriers or those infected with the virus; and contact tracing to control the spread of the virus.
  • PPE personal protection equipment
  • SARS-CoV-2 remains a significant healthcare issue. Therefore, there is a need for rapid identification of the presence of SARS-CoV-2.
  • a method of selecting aptamers capable of specifically binding SARS-CoV- 2 is provided. The method of selecting aptamers is also a method of making aptamers.
  • Embodiments include one or more aptamers made by the method described herein, and compositions comprising one or more aptamers made by the method described herein. Embodiments include employing the aptamer(s) or composition(s).
  • the method of employing may include surface detection of SARS-CoV-2.
  • the surface may be inanimate.
  • the surface can be a non-living surface.
  • the surface may be a tissue.
  • the method of employing may include inactivating SARS-CoV-2.
  • the inactivating may be preventing binding of the SARS- CoV-2 to a cell.
  • the method of employing may be targeted delivery of an inactivating moiety to SARS-CoV-2.
  • the method of employing may comprise detection of SARS-CoV-2 infection in one or more of biological tissues and fluids.
  • the method may include assays directed to detection of SARS-CoV-2 on biological tissues.
  • the method may include assays directed to detection of SARS-CoV-2 in biological fluids, when the fluids are present on a surface, for example.
  • the method may include assays directed to detection of SARS-CoV-2 in respiratory tract fluid on a surface.
  • the assays may be conducted at a time before SARS-CoV-2 infection is known or suspected, during SARS-CoV-2 infection, or after infection.
  • the method of employing may comprise detection of SARS-CoV-2 on non- living surfaces.
  • the method of employing may comprise detection of SARS-CoV-2 in human and animal food production.
  • the method of employing may comprise using one or more aptamer(s) herein as a carrier(s) to deliver disinfection agents to selectively kill SARS-CoV-2 virus.
  • the delivery may be to virus on a non-living surface.
  • Aptamers have shown, in studies, the ability to inhibit viral enzymes, interfere with viral coats, and disrupt steps of a viral life cycle (including reverse transcription, chromosomal integration, proteolytic processing, viral expression, packing, and entry).
  • the method of selecting for aptamers capable of specifically binding SARS- CoV-2 comprises performing a first selection round, which is a first positive round of selection.
  • the first positive round of selection comprises immobilizing a SARS-CoV-2 protein and combining sequences of a na ⁇ ve DNA aptamer library with the immobilized SARS-CoV-2 protein to form a combination.
  • the immobilized SARS-CoV-2 protein may comprise a full-length protein, or a fragment of a SARS-CoV-2 protein.
  • the protein may be a spike protein of SARS- CoV-2.
  • the protein may be the S1 (S) domain of the spike protein or a fragment thereof.
  • the protein may be the S2 domain of the spike protein or a fragment thereof.
  • the fragment of the S1 domain may comprise, consist essentially of, or consist of amino acids 1 to 681, or amino acids located in portions within the S1 domain that are not present in the S1 domain of other coronavirus proteins.
  • the immobilized protein may comprise, consist essentially of, or consist of amino acids belonging to insert region 1 (amino acids 70 to 77; VSGTNGT, SEQ ID NO: 16), insert region 2 (amino acids 150 to 153; KSWM, SEQ ID NO: 17), insert region 3 (amino acids 247 to 252; RSYLTP, SEQ ID NO: 18), or insert region 4 (amino acids 680 to 683; SPRR, SEQ ID NO: 19) of the S1 spike protein of SARS-CoV-2.
  • the SARS-CoV-2 protein may be a recombinant protein.
  • the recombinant protein comprises a tag.
  • the tag may be an affinity tag.
  • Non-limiting examples of the tag include but are not limited to a poly-histidine (HIS), chitin binding protein (CBP), maltose binding protein (MBP), streptavidin, or glutathione-S-transferase (GST).
  • the tag may be any known in the art for use in binding to a target protein.
  • the target protein can be immobilized through the tag onto a support.
  • the SARS-CoV-2 protein is immobilized on a support.
  • the support may comprise a moiety that binds a tag as described herein.
  • the tag is a HIS tag and the support comprises a nickel containing moiety.
  • the method of selecting for aptamers capable of binding SARS-CoV-2 may comprise washing the combination.
  • the washing may be performed with a reagent or buffer that allows for the bound aptamers to remain bound to the immobilized SARS- CoV-2 protein and for the unbound aptamers to be washed away.
  • buffers may be chosen that decrease the affinity of aptamers having less specificity to the immobilized recombinant protein.
  • These buffers may include detergents, salts, surfactant, and other components generally known to be included in wash buffers.
  • the concentration of each of the buffer components, as well as the pH, may vary depending on the required stringency of the washing step.
  • the method of selecting for aptamers capable of binding SARS-CoV-2 further comprises eluting aptamers remaining bound. Elution may be performed by varying the pH or ionic strength. Elution may be performed by denaturing conditions (or means thereof), exposure to organic solvents, or exposure to specific competitors. A composition comprising 6 M urea may be used to elute bound aptamers from the immobilized recombinant proteins. [0088] The method of selecting for aptamers capable of binding SARS-CoV-2 further comprises amplifying the eluted aptamers to form double-stranded amplicons of the eluted aptamers.
  • Amplifying comprises a polymerase chain reaction (PCR) with a forward primer that binds to a 5’ forward primer recognition region and a reverse primer that binds to a 3’ reverse primer recognition region included on each aptamer of the na ⁇ ve DNA aptamer library, as illustrated in FIG. 1A.
  • Amplification of the eluted aptamers to form double-stranded amplicons may also introduce a promoter.
  • the promoter may be a T7 promoter, which may be used to drive transcription of an antisense RNA strand.
  • the method of selecting for aptamers capable of binding SARS-CoV-2 further comprises transcribing the double-stranded amplicons to form antisense RNA strands and reverse transcribing the antisense RNA strands into cDNA as illustrated in FIG. 1B.
  • the method further comprises treating the sample comprising the antisense RNA strands with DNase.
  • the method further comprises treating the sample comprising the cDNA strands with RNase. Generation of the cDNA corresponding to the eluted aptamers results in generation of a first round aptamer library.
  • the method of selecting for aptamers capable of specifically binding SARS- CoV-2 further comprises performing a second selection round, comprising a first negative round of selection and a second positive round selection.
  • the first negative round of selection comprises selecting for aptamers from the first round aptamer library that do not bind a non-SARS-CoV-2 protein, which may be a recombinant protein.
  • the method comprises combining the first round aptamer library to a first non-SARS-CoV-2 recombinant protein.
  • the first non-SARS-CoV-2 recombinant protein may be a coronavirus protein.
  • the first non-SARS-CoV-2 recombinant protein may be a coronavirus protein spike protein.
  • Non-limiting examples of the second non- SARS-CoV-2 recombinant protein include but are not limited to a SARS-CoV recombinant protein, a SARS-CoV recombinant spike protein, a SARS-CoV recombinant S1 spike protein, or portions of the foregoing.
  • the receptor binding motif of SARS-CoV comprises a greater number of non- identical residues (R1) to the equivalent portion of SARS-CoV-2 than identical residues (R2), and as shown in Tables 1 and 3.
  • the immobilized SARS-CoV may comprise a full-length SARS-CoV protein.
  • the immobilized SARS-CoV protein may comprise a fragment of the full-length protein.
  • the fragment of the full length protein may be the spike protein portion.
  • the spike protein portion may be the S1 (S) domain of the spike protein or the S2 domain of the spike protein.
  • the immobilized SARS-CoV may comprise the entire S1 domain of the spike protein, or a fragment thereof.
  • the fragment of the S1 domain may comprise, consist essentially of, or consist of amino acids 1 to 667 of the S1 domain (SEQ ID NO: 22).
  • a non-limiting example of the fragment of the S1 domain comprises, consists essentially of, or consists of amino acids 14 to 667 of the S1 protein of SARS- CoV, and amino acids 1 to 13 encode for a signal peptide (SEQ ID NO: 22).
  • a non-SARS-CoV-2 protein in any round of selection where it is utilized, may comprises a tag.
  • the tag may be an affinity tag.
  • the tag may be a poly-histidine (HIS) tag, chitin binding protein (CBP), maltose binding protein (MBP), streptavidin, or glutathione-S-transferase (GST).
  • the tag may be one known in the art for use in binding to a target protein. Also as with SARS-CoV-2, a non-SARS-CoV-2 protein, in any round of selection where it is utilized, may be immobilized on a support.
  • the support may be one that binds the tag.
  • the tag may be a HIS tag and the support may comprise a nickel containing moiety.
  • the first negative round of selection further comprises collecting the unbound first round aptamers from the first negative selection round and amplifying them by PCR to form a second round double-stranded form (as with prior amplification steps, a promoter may be included or introduced during amplification), which can then be transcribed to RNA to form second round antisense RNA strands, which can by reverse transcribed, using reverse transcriptase, into second round cDNA, as illustrated in FIG. 1B, to form a second round aptamer library of the negative selection.
  • the second round double-stranded form may be degraded with DNase.
  • the second positive round selection comprises selecting for aptamers from the second round aptamer library of the negative selection that bind a SARS-CoV-2 recombinant protein as described in the foregoing. Aptamers that have the capacity to bind SARS-CoV-2 protein are retained, and aptamers that do not are discarded (unbound). The retained aptamers are eluted, collected and PCR amplified as described above. In some embodiments, a T7 promoter is created on the 3’ end of the amplicon.
  • This T7 promoter may be used to drive the creation of an antisense RNA with the use of a T7 DNA directed RNA polymerase enzyme.
  • the remaining double stranded DNA template may be removed with DNase treatment.
  • the antisense RNA is then reverse transcribed back into a sense strand using a reverse transcriptase enzyme.
  • Additional rounds of selection may occur, as described above for the second selection round comprising both negative and positive rounds of selection as illustrated in block arrows 2 to 6 of FIG. 3.
  • Recovered aptamer library from each second selection round may be exposed to immobilized S1 protein from SARS-CoV in a negative selection step, wherein sequences that do not exhibit binding to the SARS- CoV S1 protein, for example, are preferably kept and are exposed to the SARS-CoV- 2 S1 protein for a positive selection as described for the second positive selection round.
  • the amplification and recovery of sense single strands are repeated in the same way.
  • the process described for the second selection round is repeated for as many selection rounds as necessary in order to ensure that the selection process has matured to the extent that enriched sequences will have a copy number greater than one when a subsample of the hbrary is analysed, for example, through next generation sequencing.
  • the point of aptamer library maturation is estimated by evaluating the amount of aptamer library recovered after a selection round (the number of PCR cycles required to amphfy the library) as a proportion of the amount of library used to initiate said selection round. When this proportion increases relative to the previous selection round, this means that the proportion of sequences within the library that bind in the desired way to the target are dominating the selected library.
  • the number of positive and negative selection steps performed in any given selection round may vary. In some embodiments, 1 to 15 rounds of second round selection, or any integer in between can be performed.
  • the non-SARS-CoV-2 protein may be a non-SARS- CoV-2 protein other than SARS-CoV.
  • the non-SARS-CoV-2 protein may be a CoV-Ni protein, a CoV-Ni spike protein, or the CoV-Ni S1 domain of the spike protein, or fragments thereof. Any of these proteins may be recombinant, may include a tag, and may be immobilized, as described above for the first non- SARS-CoV-2 protein.
  • the fragment of the S1 domain may comprise, consist essentially of, or consist of amino acids 1 to 748 of the S1 domain of CoV-Ni. Table 1 below illustrates amino acid sequence comparison between full-length spike protein for each of SARS-CoV-2 (SEQ ID NO: 21), SARS-CoV (SEQ ID NO: 22), and CoV-Ni (SEQ ID NO: 23).
  • the mature selected library is divided into at least two aliquots as shown in FIG. 3 (for example, 7 A to 9A and 7B to 9B).
  • One of the aliquots is carried forward in a positive selection against the SARS-CoV-2 S1 protein (See A series), either with or without negative selection against SARS-CoV S1 protein.
  • the other of the aliquots is carried forward in a positive selection against the SARS-CoV S1 protein (See B, C, or D series). This process is carried out for two to three selection rounds, with the selected library from each aliquot being reapplied only within its respective selection channel.
  • the mature library used for the aliquots as well as each of the selected libraries from the two or three parallel selection rounds are analysed, for example, by next generation sequencing (NGS) or Sanger sequencing.
  • NGS next generation sequencing
  • those sequences that preferentially enrich in the SARS-CoV-2 S1 protein selection relative to the same sequence in the SARS-CoV S1 protein selection are identified.
  • Libraries at any stage may be analyzed for statistical significance in terms of motif frequencies and copy number of entire sequences. Copy number may be evaluated in terms of abundance (number of copies of a given sequence) and enrichment (increase in copy number over selection rounds).
  • Binding analysis may be conducted on libraries at any stage, pools of two or more aptamers, or single aptamers.
  • the binding analysis may be performed by immobilizing the aptamers on a surface followed by combining with SARS-CoV-2, portions of SARS-CoV-2, various S1 proteins of SARS-CoV-2, SARS-CoV, CoV-N 1 , or other coronaviruses or portions thereof used during negative selection.
  • the surface may be a gold surface and the aptamers may be immobilized through a thiol conjugation.
  • each aptamer is applied to the surface in triplicate.
  • human serum albumin may be used as a test for potential binding in plasma. K on and K off values for each aptamer for each target protein may be evaluated.
  • aptamers are artificial ligands comprising DNA, RNA, or modifications thereof, capable of specifically binding to a target as defined herein with high affinity and specificity.
  • aptamer “nucleic acid molecule,” or “oligonucleotide” are used interchangeably to refer to a non-naturally occurring nucleic acid molecule that has a desirable action on a target as defined herein.
  • the DNA or RNA may include natural components. In some embodiments, the DNA or RNA may include solely natural components, solely modified components, or a combination of natural and modified components.
  • the aptamers may be DNA aptamers.
  • the aptamers may be single-stranded DNA (ssDNA).
  • the aptamers may be RNA aptamers.
  • the aptamers may be single-stranded RNA (ssRNA).
  • the aptamers may comprise natural, modified, or non-natural nucleotides and/or base derivatives (or combinations thereof).
  • the aptamers comprise one or more modifications such that they comprise a chemical structure other than deoxyribose, ribose, phosphate, adenine (A), guanine (G), cytosine (C), thymine (T), or uracil (U).
  • the aptamers may be modified at the nucleobase, at the sugar or at the phosphate backbone.
  • the aptamers comprise one or more modified nucleotides. Exemplary modifications include for example nucleotides comprising an alkylation, arylation or acetylation, alkoxylation, halogenation, amino group, or another functional group.
  • modified nucleotides include, but are not limited to, 2’-fluoro ribonucleotides, 2’-NH 2 -, 2’-OCH 3 - and 2’-O-methoxyethyl ribonucleotides, which are used for RNA aptamers.
  • the aptamers may be wholly or partly phosphorothioate or DNA, phosphorodithioate or DNA, phosphoroselenoate or DNA, phosphorodiselenoate or DNA, locked nucleic acid (LNA), peptide nucleic acid (PNA), N3’-P5’ phosphoramidate RNA/DNA, cyclohexene nucleic acid (CeNA), tricyclo DNA (tcDNA) or aptamer, or the phosphoramidate morpholine (PMO) components or any other modification known to those skilled in the art (see also Chan et al., Clinical and Experimental Pharmacology and Physiology (2006) 33, 533-540).
  • LNA locked nucleic acid
  • PNA peptide nucleic acid
  • CeNA cyclohexene nucleic acid
  • tcDNA tricyclo DNA
  • spiegelmer or the phosphoramidate morpholine (PMO) components or any other modification known to those skilled in the art (see
  • Some of the modifications may allow the aptamers to be stabilized against nucleic acid-cleaving enzymes.
  • a distinction can generally be made between the subsequent modification of the aptamers and the selection with already modified RNA/DNA.
  • the stabilization may be such that it either does not affect the affinity of the modified RNA/DNA aptamers or any effect on said affinity is such that the utility of the aptamers remains.
  • the stabilization may prevent the rapid decomposition of the aptamers in an organism, biological solutions, or solutions, by RNases/DNases.
  • An aptamer is referred to as stabilized if the half- life of the aptamer in the sample (e.g., biological medium, organism, solution) is greater than one minute, greater than one hour, or greater than one day.
  • the aptamers may be modified with reporter molecules, which may enable detection of the labelled aptamers. Reporter molecules may also contribute to increased stability of the aptamers.
  • Aptamers form a three-dimensional structure that depends on their nucleic acid sequence. The three-dimensional structure of an aptamer may arise due to Watson and Crick intramolecular base pairing, Hoogsteen base pairing (quadruplex), wobble-pair formation, or other non-canonical base interactions.
  • a nucleic acid sequence of an aptamer may, under defined conditions, have a three-dimensional structure that is specific to a defined target structure.
  • an aptamer comprising a nucleic acid sequence selected from a nucleic acid sequence as set forth in Table 2. Table 2 – Aptamer Sequences
  • the disclosure comprises aptamer(s) capable of binding specifically to SARS-CoV-2.
  • the binding may be to a surface structure of SARS-CoV-2.
  • the binding may be to a surface protein of SARS-CoV-2.
  • the binding may be to the spike protein of SARS-CoV-2.
  • the binding may be to the S1 or S2 domain of the SARS-CoV-2 spike protein.
  • the binding may be to a region within amino acids 1 to 681 of the S1 domain, or to a region of the S1 domain comprising, consisting essentially of, or consisting of amino acids 70 to 77, 150 to 153, 247 to 252, or 680 to 683.
  • the disclosure includes an aptamer made according to the method of selecting for aptamers capable of specifically binding SARS-CoV-2.
  • the aptamer may bind a SARS-CoV-2 protein.
  • the specific binding may be to the S1 domain of the spike protein of SARS-CoV-2.
  • the specific binding may be to a portion of the S1 domain.
  • the specific binding may be to the region including amino acids 1 to 681.
  • the portion may comprise, consist essentially of, or consisting of the regions including amino acids 70 to 77, 150 to 153, 247 to 252, or 680 to 683 of the S1 spike protein of SARS-CoV-2.
  • the binding to these non-limiting examples may also include binding to regions that border the exemplified amino acid sequences.
  • an aptamer may bind “specifically” to a target as defined herein if the aptamer binds with preferential or high affinity to the target molecule but does not bind or binds with only low affinity to other structurally related molecules (e.g., SARS-CoV or other related non-SARS-CoV-2 coronaviruses).
  • the na ⁇ ve DNA aptamer library includes aptamers made according to the methods described herein and comprising a forward primer region at the 5’ end, a reverse primer region at the 3’ end, and random region located in between each nucleotide.
  • the forward primer region has a length of 20 to 25 nucleotides. In some embodiments the forward primer region has a length of 23 nucleotides. In some embodiments, the reverse primer region has a length of 15 to 20 nucleotides. In some embodiments the reverse primer region has a length of 17 nucleotides. In some embodiments, the random region has a length of 35 to 45 nucleotides. In some embodiments the random region has a length of 40 nucleotides. The solution space for a random region of 40 nucleotides is 1.2*10 24 .
  • a na ⁇ ve DNA aptamer library of 1*10 15 of these aptamer possibilities will be exposed and or combined with the immobilized recombinant target protein.
  • the aptamers are RNA aptamers and comprise a sequence in which one or some or all of the deoxyribonucleotides in any of the sequences set forth in SEQ ID NOs. 3 to 15 are substituted for their equivalent ribonucleotide residues AMP, GMP, UMP or CMP.
  • the aptamers according to some embodiments may comprise modified nucleic acids as described herein.
  • the aptamers are prepared using principles of in vitro selection known in the art, that include iterative cycles of target binding, partitioning and preferential amplification of target binding sequences. Selection may be performed using immobilized target proteins. Immobilization may include, but is not limited to, immobilization to a solid surface.
  • the solid surface may be beads.
  • the solid surface may be magnetic beads.
  • Non-limiting examples of amplification methods include polymerase chain reaction (PCR), ligation amplification (or ligase chain reaction, LCR), strand displacement amplification, nucleic acid sequence-based amplification, and amplification methods based on the use of Q-beta replicase.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • strand displacement amplification nucleic acid sequence-based amplification
  • nucleic acid sequence-based amplification amplification methods based on the use of Q-beta replicase.
  • at least one type of aptamer may be immobilized on a solid surface during amplification.
  • the aptamers are selected from a nucleic acid molecule library such as a single-stranded DNA or RNA nucleic acid molecule library.
  • the aptamers may be selected from a “universal aptamer selection library” that is designed such that any selected aptamers need little to no adaptation to convert into any of the listed assay formats. [0120] Once selected, the aptamer may be further modified before being used e.g. to remove one or both primer sequences and/or parts of the randomized sequence not required for target binding. [0121] Typically, aptamers of the embodiments comprise a first primer region (e.g. at the 5’ end), a second primer region (e.g. at the 3’ end), or both. The primer regions may serve as primer binding sites for PCR amplification of the library and selected aptamers.
  • the primer comprises or consists of a nucleic acid sequence of SEQ ID NO: 1 and/or 2.
  • aptamers may comprise SEQ ID NO: 1 and/or 2.
  • any one of one to all of the nucleotides disclosed by SEQ ID NO: 1 or 2 may be modified.
  • the primer region length may also be varied.
  • the first primer region and/or second primer region may comprise a detectable label as described herein. As used herein the terms “detectable label” and “detectable moiety” are used interchangeably.
  • the first primer region and/or second primer region may be fluorescently labelled.
  • fluorescent labels include but are not limited to fluorescein, green fluorescent protein (GFP), yellow fluorescent protein, cyan fluorescent protein, and others.
  • GFP green fluorescent protein
  • cyan fluorescent protein a fluorescein label is used.
  • other forms of detecting the primer may be used, including but not limited to phosphate (PO 4 ) labelling, isotope labelling, electrochemical sensors, colorimetric biosensors, and others.
  • the aptamers comprise or consist of a nucleic acid sequence selected from any one of SEQ ID NOs: 3 to 15.
  • the aptamers comprise or consist of a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 3 to 15.
  • sequence identity refers to the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in said sequences after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity.
  • Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, CLUSTALW or Megalign (DNASTAR) software.
  • % nucleic acid sequence identity values can be generated using sequence comparison computer programs found on the European Bioinformatics Institute website (www.ebi.ac.uk).
  • nucleic acid such as an aptamer
  • sequence of which is at least, for example, about 90% identical to a reference nucleotide sequence
  • nucleic acid sequence is identical to the reference sequence except that the nucleic acid sequence may include up to ten point mutations (e.g. substitution, deletion, insertion) per each 100 nucleotides of the reference nucleic acid sequence. These mutations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those 5' or 3' terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • aptamers comprise, consist essentially of, or consist of a minimal effective fragment of SEQ ID NOs: 3 to 15.
  • a “minimal effective fragment” is understood to mean a fragment (e.g. portion) of the full-length aptamer capable of binding to a target as defined herewith with the same or improved affinity as compared to the full-length aptamer.
  • a minimal effective fragment may compete for binding to a target as defined herein with the full-length aptamer.
  • the aptamers comprise, consist essentially of, or consist of at least 10 contiguous nucleic acid residues of any of the sequences as set forth in any one of SEQ ID NOs: 3 to 15 and show equivalent or improved binding to the target molecule. In some embodiments, the aptamers comprise, consist essentially of, or consist of at least 10 contiguous nucleic acid residues of any of the sequences as set forth in any one of SEQ ID NOs: 3 to 15 and show adequate binding to the target molecule.
  • Adequate binding includes binding to target molecule that occurs with affinity and specificity as described herein, or an affinity and/or specificity of binding less than that of the full-length aptamer sequence above but still capable of delivering a report of the presence of its respective target.
  • the aptamer comprises, consists essentially of, or consists of at least 10 contiguous nucleotides of any of the sequences as set forth in any one of SEQ ID NOs: 3 to 15.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 3.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 3, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 4.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 4, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 5.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 5, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 6.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 6, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 7.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 7, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 8.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 8, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 9.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 9, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 10.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 10, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 11.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 11, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 12.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 12, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 13.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 13, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, or 57 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 14.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 14, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length.
  • an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 15.
  • the aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 15, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0144] In some embodiments, these sequences relate to aptamer fragments with equivalent, suitable, or improved binding to a target protein as described herein as compared to full-length aptamer.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity with any of SEQ ID NOs: 3 to 15.
  • the term “about” typically means the referenced nucleotide sequence length plus or minus 10% of that referenced length.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 85% or more identity with any of SEQ ID NOs: 3 to 12. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 85% or more identity with SEQ ID NO: 13.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 85% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 85% or more identity with SEQ ID NO: 15.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 90% or more identity with any of SEQ ID NOs: 3 to 12.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 90% or more identity with SEQ ID NO: 13.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 90% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 90% or more identity with SEQ ID NO: 15.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 95% or more identity with any of SEQ ID NOs: 3 to 12.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 95% or more identity with SEQ ID NO: 13.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 95% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 95% or more identity with SEQ ID NO: 15.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 96% or more identity with any of SEQ ID NOs: 3 to 12.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 96% or more identity with SEQ ID NO: 13.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 96% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 96% or more identity with SEQ ID NO: 15.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 97% or more identity with any of SEQ ID NOs: 3 to 12.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 97% or more identity with SEQ ID NO: 13.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 97% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 97% or more identity with SEQ ID NO: 15.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 98% or more identity with any of SEQ ID NOs: 3 to 12.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 98% or more identity with SEQ ID NO: 13.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 98% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 98% or more identity with SEQ ID NO: 15.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 99% or more identity with any of SEQ ID NOs: 3 to 12.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 99% or more identity with SEQ ID NO: 13.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 99% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 99% or more identity with SEQ ID NO: 15.
  • aptamers comprise, consist essentially of, or consist of at least about 10 contiguous nucleotides of any of the sequences as set forth in any one of SEQ ID NOs: 3 to 15.
  • aptamers comprise, consist essentially of, or consist of at least about 25 contiguous nucleotides of any of the sequences as set forth in any one of SEQ ID NOs: 3 to 15.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence comprising any one of SEQ ID NOs: 3 to 11.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10 or more consecutive nucleotides of a sequence comprising SEQ ID NO: 12.
  • aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10 or more consecutive nucleotides of a sequence comprising SEQ ID NO: 13. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10 or more consecutive nucleotides of a sequence comprising SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10 or more consecutive nucleotides of a sequence comprising SEQ ID NO: 15. Support [0157] In some embodiments, the target peptide or protein is attached to a support.
  • the support may be a solid support.
  • a solid support include a membrane or a bead.
  • the support may be a two-dimensional support.
  • a non-limiting example of a two-dimensional support is a microplate.
  • the support may be a three- dimensional support.
  • a non-limiting example of a three-dimensional support is a bead.
  • the support may comprise at least one magnetic bead.
  • the protein comprises a polyhistidine tag (His tag) tag (e.g. hexa-histidine tag) at its N- or C-termini.
  • His tag polyhistidine tag
  • the protein can be a recombinant protein having Histidine residues at its C-terminus or its N-terminus.
  • the His-tagged protein can be immobilized onto a support carrying a histidine binding agent.
  • the His-tagged protein can be immobilized to a support having nickel nitrilotriacetic acid (Ni-NTA).
  • the support may comprise at least one nanoparticle.
  • a non-limiting example of a nanoparticle is a gold nanoparticle or the like.
  • the support may comprise a microtiter or other assay plate, a strip, a membrane, a film, a gel, a chip, a microparticle, a nanofiber, a nanotube, a micelle, a micropore, a nanopore, or a biosensor surface.
  • the biosensor surface may be a probe tip surface, a biosensor flow-channel, or similar.
  • the support comprises a membrane.
  • Non-limiting examples of a membrane include a nitrocellulose, a polyethylene (PE), a polytetrafluoroethylene (PTFE), a polypropylene (PP), a cellulose acetate (CA), a polyacrylonitrile (PAN), a polyimide (PI), a polysulfone (PS), a polyethersulfone (PES) membrane or an inorganic membrane comprising aluminum oxide (Al 2 O 3 ), silicon oxide (SiO 2 ), and/or zirconium oxide (ZrO 2 ).
  • PE polyethylene
  • PTFE polytetrafluoroethylene
  • PP polypropylene
  • CA cellulose acetate
  • PAN polyacrylonitrile
  • PI polyimide
  • PS polysulfone
  • PES polyethersulfone
  • inorganic membrane comprising aluminum oxide (Al 2 O 3 ), silicon oxide (SiO 2 ), and/or zirconium oxide (ZrO 2 ).
  • Non-limiting examples of materials from which a support may be made include inorganic polymers, organic polymers, glasses, organic and inorganic crystals, minerals, oxides, ceramics, metals, especially precious metals, carbon, and semiconductors.
  • the organic polymer is a polymer based on polystyrene.
  • Biopolymers including but not limited to cellulose, dextran, agar, agarose and Sephadex, which may be functionalized in particular as nitrocellulose or cyanogen bromide Sephadex, may be polymers in a support.
  • Detectable label [0161]
  • the aptamer comprises a detectable label.
  • the aptamer with a detectable label may be a single-stranded DNA (ssDNA) aptamer.
  • the aptamers of the disclosure are used to detect and/or quantify the amount of a target as defined herein in a sample.
  • the aptamers comprise a detectable label. Any label capable of facilitating detection and/or quantification of the aptamers may be used herein. Non-limiting examples of detectable labels are described below.
  • the detectable label is a fluorescent moiety, e.g. a fluorescent compound (also referred herein as fluorophore).
  • the aptamer comprises a fluorescent and a quencher compound.
  • the detectable label is FAM.
  • the FAM-label is conjugated to the 5’ end or the 3’ end of the aptamer to form an aptamer conjugate.
  • the label may be located at any suitable position within the aptamer.
  • the aptamer comprises a FAM fluorophore at its 5’ end.
  • the aptamer is synthesized by incorporating phosphoramidite one at a time into the nucleic acid chain and the FAM-labeled phosphoramidite is incorporated through the synthesis process.
  • the FAM fluorophore is attached at the 5’ end of the aptamer via a linker.
  • the detectable label is attached to an aptamer described herein via a moiety selected from a thiol group, an amine group, an azide, six-carbon linker, and an aminoallyl group and combinations thereof.
  • the FAM label can be incorporated into the aptamer using a forward primer with a FAM on the 5’ end.
  • the aptamer can be prepared by solid phase synthesis with the FAM label already in place, attached to the 5’ end as in the primer.
  • Moieties that result in an increase in detectable signal when in proximity of each other may also be used herein, for example, as a result of fluorescence resonance energy transfer (“FRET”); suitable pairs include but are not limited to fluorescein and tetramethylrhodamine; rhodamine 6G and malachite green, and FITC and thiosemicarbazole, to name a few.
  • the detectable label is and/or comprises a fluorescent moiety, a colorimetric moiety or any detectable moiety known in the art.
  • the detectable moiety can be, but is not limited to, a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a protein, a dendrimer, or an organic polymer.
  • the detectable moiety can be a particle.
  • the detectable moiety can be, but is not limited to, a colloidal metallic particle, a colloidal non-metallic particle, a latex particle, a nanofiber, a nanotube, or a liposome.
  • the detectable label is a fluorescent protein such as Green Fluorescent Protein (GFP) or any other fluorescent protein known to those skilled in the art.
  • the detectable label is an enzyme.
  • the enzyme may be selected from horseradish peroxidase, alkaline phosphatase, urease, ⁇ -galactosidase or any other enzyme known to those skilled in the art.
  • the nature of the detection will be dependent on the detectable label used.
  • the label may be detectable by virtue of its color, e.g. gold nanoparticles. A color can be detected quantitatively by an optical reader or camera e.g. a camera with imaging software.
  • the detectable label is a fluorescent label e.g. a quantum dot.
  • the detection means may comprise a fluorescent plate reader, strip reader or similar, which is configured to record fluorescence intensity.
  • non- limiting detection means may, for example, be colorimetric, chemiluminescence and/or electrochemical (including, but not limited to using an electrochemical detector). Electrochemical sensing may be through conjugation of a redox reporter (including, but not limited to methylene blue or ferrocene) to one end of the aptamer and a sensor surface to the other end. A change in aptamer conformation upon target binding may change the distance between the reporter and sensor to provide a readout.
  • a redox reporter including, but not limited to methylene blue or ferrocene
  • the detectable label may further comprise enzymes, including but not limited to, horseradish peroxidase (HRP), Alkaline phosphatase (APP) or similar, to catalytically turnover a substrate to give an amplified signal.
  • HRP horseradish peroxidase
  • APP Alkaline phosphatase
  • Embodiments comprise a complex (e.g. aptamer conjugate) comprising aptamers of the disclosure and a detectable molecule.
  • the aptamers are covalently or physically conjugated to a detectable molecule.
  • the detectable molecule is a visual, optical, photonic, electronic, acoustic, opto-acoustic, mass, electrochemical, electro-optical, spectrometric, enzymatic, or otherwise physically, chemically or biochemically detectable label.
  • the detectable molecule is detected by luminescence, UV/VIS spectroscopy, enzymatically, electrochemically or radioactively.
  • Luminescence refers to the emission of light. For example, photoluminescence, chemiluminescence and bioluminescence are used for detection of the label. In photoluminescence or fluorescence, excitation occurs by absorption of photons.
  • Exemplary fluorophores include, but are not limited to, bisbenzimidazole, fluorescein, acridine orange, Cy5, Cy3 or propidium iodide, which can be covalently coupled to aptamers, tetramethyl-6-carboxyrhodamine (TAMRA), Texas Red (TR), rhodamine, Alexa Fluor dyes (et al. Fluorescent dyes of different wavelengths from different companies).
  • TAMRA tetramethyl-6-carboxyrhodamine
  • TR Texas Red
  • rhodamine Alexa Fluor dyes (et al. Fluorescent dyes of different wavelengths from different companies).
  • the fluorescent label may be covalently coupled to aptamers.
  • fluorescent moieties may be incorporated into aptamers in the oligonucleotide synthesis process.
  • oligonucleotides may be synthesized from phosphoramidites.
  • fluorophores may be incorporated into the termini of aptamers through the use of a phosphoramidite that already has the fluorophore attached.
  • the fluorophore may be incorporated at a terminal position allowing for the use of phosphoramidites that do not support further elongation.
  • the detectable molecule is a colloidal metallic particle, including but not limited to a gold nanoparticle, colloidal non-metallic particle, quantum dot, organic polymer, latex particle, nanofiber (carbon nanofiber, as a non-limiting example), nanotube (carbon nanotube, as a non-limiting example), dendrimer, protein or liposome with signal-generating substances.
  • the detectable molecule is an enzyme.
  • the enzyme may convert substrates to colored products. Examples of the enzyme include but are not limited to peroxidase, luciferase, ⁇ -galactosidase or alkaline phosphatase.
  • the colorless substrate X-gal is converted by the activity of ⁇ -galactosidase to a blue product whose color is visually detected.
  • the detection molecule is a radioactive isotope.
  • the detection may also be carried out by means of radioactive isotopes with which the aptamer is labelled, including but not limited to 3 H, 14 C, 32 P, 33 P, 35 S or 125 I.
  • scintillation counting may be conducted, and thereby the radioactive radiation emitted by the radioactively labelled aptamer target complex is measured indirectly.
  • a scintillator substance is excited by the isotope’s radioactive emissions. During the transition of the scintillation material, back to the ground state, the excitation energy is released again as flashes of light, which are amplified and counted by a photomultiplier.
  • the detectable molecule is selected from digoxigenin and biotin.
  • the aptamers may also be labelled with digoxigenin or biotin, which are bound for example by antibodies or streptavidin, which may in turn carry a label, such as an enzyme conjugate.
  • the prior covalent linkage (conjugation) of an aptamer with an enzyme can be accomplished in several known ways.
  • detection of aptamer binding may also be achieved through labelling of the aptamer with a radioisotope in an RIA (radioactive immunoassay), preferably with 125 I, or by fluorescence in a FIA (fluoroimmunoassay) with fluorophores.
  • the fluorophore is fluorescein or fluorescein isothiocyanate (FITC).
  • FITC fluorescein isothiocyanate
  • Embodiments comprise methods for detecting the presence, absence or amount of a target molecule as defined herein in a sample.
  • the sample may be interacted (i.e. contacted) with an aptamer as described herein.
  • the sample and aptamers as described herein may be incubated under conditions sufficient for at least a portion of the aptamer to bind to a target as defined herein in the sample.
  • a person skilled in the art will understand the conditions required for binding to occur between the aptamers described herein and a target as defined herein.
  • the sample and aptamer may be incubated at temperatures between about 4 °C and about 40 °C. In some embodiments, the sample and aptamer may be incubated at temperatures between about 20 °C and about 37 °C. In some embodiments, the sample and aptamer may be incubated at or about 22 °C.
  • the incubation temperature may be selected from the range of 4 °C to less than 20 °C, 20 °C to less than 22 °C, 22 °C to less than 24 °C, 24 °C to less than 26 °C, 26 °C to less than 28 °C, 28 °C to less than 30 °C, 30 °C to less than 32 °C, 32 °C to less than 34 °C, 34 °C to less than 36 °C, 36 °C to 37 °C, and 37 °C to 40 °C.
  • the sample and aptamer may be diluted to different concentrations (e.g.
  • exemplary buffers include but are not limited to PBS.
  • the diluted concentrations may be selected from the range of 1% to less than 5%, 5% to less than 10%, 10% to less than 20%, 20% to less than 30%, 30% to less than 40%, 40% to less than 50%, 50% to less than 60%, 60% to less than 70%, 70% to less than 80%, or 80% to less than 90%.
  • the aptamer concentration before dilution may be from 100 nM to 50 ⁇ M.
  • the aptamer concentration before dilution may be selected from the range of 100 nM to 500 nM, 500 nM to 1 ⁇ M, 1 ⁇ M to 2 ⁇ M, 2 ⁇ M to 5 ⁇ M, 5 ⁇ M to 10 ⁇ M, 10 ⁇ M to 15 ⁇ M, 15 ⁇ M to 20 ⁇ M, 20 ⁇ M to 30 ⁇ M, 30 ⁇ M to 40 ⁇ M, 40 ⁇ M to 50 ⁇ M, 50 ⁇ M to 60 ⁇ M, 60 ⁇ M to 70 ⁇ M, 70 ⁇ M to 80 ⁇ M, 80 ⁇ M to 90 ⁇ M, 90 ⁇ M to 100 ⁇ M.
  • the aptamer concentration before dilution may be a concentration selected from the ranges described herein. The selected value may be selected from 0.1 ⁇ M increment concentrations in a range herein. In some embodiments, the aptamer concentration before dilution may be 2 ⁇ M.
  • the sample and aptamer may be incubated whilst shaking and/or mixing. In some embodiments, the sample and aptamer are incubated for at least 1 minute, at least 5 minutes, at least 15 minutes, at least 1 hour, or more.
  • binding of the aptamer and a target as defined leads to formation of an aptamer-target complex.
  • the binding or binding event may be detected, for example, visually, optically, photonically, electronically, acoustically, opto-acoustically, by mass, electrochemically, electro-optically, spectrometrically, enzymatically or otherwise chemically, biochemically or physically as described herein.
  • the binding of aptamer and the target may be detected using any suitable technique.
  • binding of the aptamer and the target may be detected using a biosensor.
  • binding of the aptamer and the target is detected using the non-limiting examples of SPR, RlfS, BLI, LFD or ELONA as described herein.
  • the aptamer can be attached to the surface of the biosensor using a biotin group.
  • the biotin group is attached at the 5’ end or the 3’ end of the aptamer.
  • the surface of the biosensor has an avidin/streptavidin attached thereto and the immobilization of the aptamer to the surface of the biosensor is via biotin-avidin interaction.
  • the surface of the biosensor is coated with avidin/streptavidin.
  • the aptamer is linked to a fluorescent moiety.
  • the aptamer is an aptamer conjugate comprising an aptamer conjugated with a fluorescent moiety.
  • the fluorophore is at the 5’ end or the 3’ end of the aptamer.
  • the aptamer is associated with an antisense oligonucleotide having a fluorophore.
  • the fluorophore is at the 5’ end or the 3’ end of the aptamer.
  • the antisense oligonucleotide is complementary to the 5’ end or 3’ end of the aptamer.
  • the fluorophore is at the 5’ end or the 3’ end of the antisense oligonucleotide.
  • the structure of the selected aptamer is not in flux with other structures (for example in different environments) but is the structure which is predominantly present.
  • the aptamers are selected using an affinity-based selection assay as described herein, further optimization may be required to achieve the desired binding affinity to the target protein.
  • the predicted conformation(s)/structure(s) of each aptamer can be obtained in silico from the primary sequence.
  • the primary structure of the aptamers can be engineered (e.g., substitution, deletion) to stabilize the secondary structures or tertiary structures.
  • the aptamers can be truncated to stabilize the secondary structures.
  • the aptamers are selected using an affinity-based selection assay, the predicted conformations are obtained in silico, the primary sequence is optimized (e.g. truncation/deletion, substitution etc.) so that the optimized aptamer exhibits the optimized conformation and is stabilized.
  • the resulting optimized aptamers have fewer structures that are in flux, or exhibit a range or difference among structures in flux that is less than the non-optimized aptamers.
  • These optimized aptamers can be retested for binding effectiveness in order to determine whether the structure that was stabilized is the desired shape that binds to the target protein.
  • the aptamer is an aptamer beacon that undergoes a conformational change when the aptamer binds to the target protein and the detection of the binding of the aptamer to the target protein relies on the conformational change of the aptamer.
  • the aptamer conjugate is an aptamer comprising a fluorescent moiety at a first end of the aptamer and a quencher moiety at a second end of the aptamer.
  • the aptamer comprises a loop, a first nucleic acid segment that is complementary to a second nucleic acid segment, wherein the first segment and the second segment forms a stem portion when the first segment and the second segment are hybridized, wherein the first segment of the aptamer comprises a fluorophore and the second segment of the aptamer comprises a quencher.
  • antisense oligonucleotides can be designed to hybridize to the first segment, the second segment or combination thereof and to disrupt the stem and loop structure of the aptamers.
  • the antisense oligonucleotides can be complementary to the 5’ end, the 3’ end, the 5’ end and the 3’ end of or any relevant sequence of the aptamer.
  • two antisense oligonucleotides are provided, wherein the first antisense oligonucleotide comprises a fluorophore and hybridizes to the first segment of the aptamer, the second antisense comprises a quencher and hybridizes to the second segment of the aptamer.
  • the quencher comprises a “dark” quencher.
  • the quencher comprises a Black Hole Quencher® (BHQ).
  • the 3 ’end of the antisense oligonucleotides can be linked to a Black Hole Quencher®.
  • the antisense oligonucleotides act competitively with the binding of the aptamer to the target protein.
  • the aptamer upon binding of the aptamer to the target protein, the aptamer undergoes a conformation change, altering the distance between the fluorophore and the quencher, resulting in the emission of a fluorescent signal.
  • two or more different aptamers are provided configured to bind to two or more different target proteins in a sample, each aptamer comprising a different fluorophore.
  • kits [0198] Embodiments also provide a kit for detecting and/or quantifying SARS- CoV-2, wherein the kit comprises one or more aptamers as described herein. Typically, the kit also comprises a detectable molecule as described herein. [0199] Embodiments provide a kit that further comprises a light source as described herein. In an embodiment, the kit may further comprise a bandpass filter as described herein. In an embodiment, the kit may comprise viewing goggles or glasses or the like as described herein. In some embodiments, the kit comprises: a) A solution comprising aptamers having a detection molecule conjugated thereto e.g.
  • a fluorophore capable of emitting at a wavelength of between about 485 – 515 nm.
  • the fluorophore is capable of emitting at a wavelength of between about 490 – 505 nm. In some embodiments the fluorophore is capable of emitting at a wavelength of about 505 nm;
  • the light source produces light having a wavelength of between about 485 – 515 nm. In some embodiments, the light source produces light having a wavelength of between about 490 – 505 nm;
  • c) A bandpass filter is a 590 nm bandpass filter; and d) Viewing goggles.
  • the viewing goggles are orange viewing goggles.
  • the kit further comprises instructions for use in accordance with any of the methods described herein.
  • the kit may comprise further components for the reaction intended by the kit or the method to be carried out, for example components for an intended detection of enrichment, separation and/or isolation procedures. Non-limiting examples include buffer solutions, substrates for a color reaction, dyes or enzymatic substrates.
  • the aptamer may be provided in a variety of forms, including but not limited to being pre-immobilized onto a support (e.g. solid support), freeze-dried, or in a liquid medium.
  • a kit herein may be used for carrying out any method described herein.
  • kits may be packaged individually in vials or in combination in containers or multi-container units.
  • manufacture of the kit follows standard procedures which are known to the person skilled in the art.
  • Embodiments comprise methods for detecting the presence, absence or amount of SARS-CoV-2 in a sample.
  • the sample may be contacted with one or more aptamers described herein.
  • the sample and aptamer(s) as described herein may be incubated under conditions sufficient for at least a portion of the aptamer(s) to bind to a target as defined herein in the sample.
  • aptamers can tolerate non-physiological conditions, high temperatures, extreme pH, and organic solvents, and consequently are highly amenable to functionalisation.
  • An aptamer may be labelled with fluorophores, as an example.
  • aptamers may be labelled with an array of different donor-acceptor molecules. Aptamers may emit signals at differing wavelengths to create a molecular aptamer beacon (MAB) capable of high specific target binding and dose-dependent signal generation.
  • MAB molecular aptamer beacon
  • two separate aptamers herein may comprise a fluorescence resonance energy transfer (FRET) pair of detectable labels.
  • FRET fluorescence resonance energy transfer
  • an aptamer may comprise a fluorophore at one position of the aptamer and quencher at another.
  • the aptamer may form a structure that brings the fluorophore and quencher pair into proximity to one another, quenching the signal of the fluorophore.
  • the aptamer may change conformation, separating the fluorophore and quencher sufficiently to allow signal from the fluorophore.
  • an aptamer may comprise a fluorophore.
  • an antisense nucleic acid capable of binding the aptamer and comprising a quencher of the fluorophore may be provided with this embodiment.
  • the aptamer may bind the oligonucleotide, bringing the fluorophore and quencher pair into proximity to one another, quenching the signal of the fluorophore.
  • the aptamer may change conformation, separating the fluorophore and quencher sufficiently to allow signal from the fluorophore.
  • an aptamer may comprise a quencher.
  • an antisense nucleic acid capable of binding the aptamer and comprising a fluorophore that may be quenched by the quencher on the aptamer may be provided with this embodiment.
  • the aptamer may bind the oligonucleotide, bringing the quencher and fluorophore pair into proximity to one another, quenching the signal of the fluorophore.
  • the aptamer may change conformation, separating the fluorophore and quencher sufficiently to allow signal from the fluorophore.
  • an antisense nucleic acid capable of binding an aptamer herein is provided.
  • the antisense nucleic acid may be coupled with a detectable label, fluorophore, or quencher, as described above.
  • the antisense nucleic acid may be provided in combination with an aptamer herein.
  • the combination may be in a composition herein, or a kit herein.
  • the antisense nucleic acid molecule may comprise or consist essentially of, or consist of a sequence complementary to a unique primer region of an aptamer herein.
  • the antisense nucleic acid molecule may comprise or consist essentially of, or consist of a sequence that is complementary to the following nucleic acid sequence: TGTCACATCTACACTGCTCGAAG (SEQ ID NO: 1) [0208]
  • the antisense nucleic acid molecule may comprise or consist essentially of, or consist of a sequence that is complementary to the following nucleic acid sequence: ATTCAGACAGCGTTCCC (SEQ ID NO: 2) [0209]
  • the antisense nucleic acid molecule may bind to one or more of the nucleic acid residues comprised in the primer regions detailed above. For example, the antisense nucleic acid molecule may bind to 1, 2, 3, 4, 5, or more residues in one of the primer regions of the aptamer.
  • the antisense nucleic acid molecule is a single stranded RNA molecule. In some embodiments, the antisense nucleic acid molecule is a single stranded DNA molecule. In some embodiments, the antisense nucleic acid molecule comprises one or more modified nucleotides. [0211] In some embodiments, the antisense nucleic acid molecule comprises one of a FRET pair, whilst the aptamer comprises a second of a FRET pair. [0212] Methods of using aptamer and antisense molecule are disclosed herein. Methods of using fluorophores and quenchers are disclosed herein.
  • An embodiment provides an aptamer capable of binding an epitope of a S1 domain of a spike protein of SARS-CoV-2.
  • the aptamer may bind an epitope of a S1 domain of a spike protein of SARS-CoV-2 comprising amino acids 1 to 664.
  • the aptamer may bind an epitope of a S1 domain of a spike protein of SARS-CoV-2 comprising an amino acid region having a unique stretch of amino acids compared with SARS-CoV.
  • Non-limiting examples of a unique stretch include continuous stretches of amino acids comprising, consisting essentially of, or consisting of 4 to 8 amino acids.
  • the continuous stretches of amino acids may comprise, consist essentially of, or consist of amino acids corresponding to insert region 1, insert region 2, insert region 3, and insert region 4 of the S1 domain of the spike protein of SARS- CoV-2.
  • There stretches of amino acids correspond to the VSGTNGT, KSWM, RSYLTP, and SPRR epitopes of SARS-CoV-2 S1 domain spike protein, respectively (SEQ ID Nos: 16-19).
  • Compositions comprising, consisting essentially of, or consisting of at least one aptamer, at least two aptamers, at least three aptamers etc.., are provided herein.
  • the aptamer may be made according to the method of selecting for aptamers capable of specifically binding SARS-CoV-2 described herein.
  • the aptamer may be capable of binding an outer surface of SARS-CoV-2.
  • the aptamer may be capable of binding a spike protein of SARS-CoV-2.
  • the aptamer may be capable of binding an S1 domain of the spike protein of SARS-CoV-2.
  • the composition comprises a first aptamer which binds to a first epitope of SARS-CoV-2, preferably the S1 domain of SARS-CoV-2 spike protein, and a second aptamer, which binds to a second epitope of SARS-CoV- 2, preferably the S1 domain of SARS-CoV-2 spike protein.
  • the first aptamer may comprise a fluorophore.
  • the second aptamer may comprise a quencher of the fluorophore.
  • the first epitope and the second epitope may be located within a distance from each other in the 3-dimensional structure of SARS-CoV-2 such that a quencher present on one of the first aptamer or the second aptamer may quench a fluorescent signal from a fluorophore present on the other of the first aptamer or the second aptamer.
  • the first epitope may be a VSGTNGT epitope encoded by amino acids 70 to 77 of insert region 1 of a S1 subunit
  • the second epitope may be a RSYLTP epitope encoded by amino acids 247 to 252 of insert region 3 of a S1 subunit.
  • the physical proximity of the quencher to the fluorophore may reduce the amount of fluorescence emitted in the presence of the target.
  • Each of these insert regions will be repeated a total of three times in the ultimate trimer structure of SARS-CoV-2 virus.
  • FIG. 4A illustrates a protein model of 3-dimensional structure of the S1 domain of SARS-CoV-2 spike protein.
  • Two insert regions present on an outer region of the S1 protein may include insert region 1 and insert region 3 as described herein. As shown, these two regions are predicted to be in close physical proximity to one another.
  • FIG. 4B illustrates a magnified perspective of the physical relationship between these two insert regions.
  • the composition comprises FRET pairs.
  • the composition comprising FRET pairs may comprise a first aptamer which binds to a first epitope of SARS-CoV-2, preferably the S1 domain of SARS-CoV- 2 spike protein, and a second aptamer, which binds to a second epitope of SARS-CoV- 2, preferably the S1 domain of SARS-CoV-2 spike protein.
  • the first epitope and the second epitope are in physical proximity and may be used as a basis for the transference of signals between the bound aptamers such as a FRET signal.
  • the first aptamer may comprise a fluorophore that is excited at wavelength one and emits at wavelength two.
  • the second aptamer may comprise a fluorophore that is not excited at wavelength one, but is excited at wavelength two such that the emission from an aptamer bound at the first epitope could then be used to excite the aptamer bound at the second epitope.
  • the aptamer bound at the second epitope may emit at wavelength three.
  • the second fluorescence signal would only be present when both aptamers are bound to a SARS-CoV-2 protein.
  • the first epitope and the second epitope may be located within a distance from each other in the 3-dimensional structure of SARS-CoV-2 such that upon excitation at wavelength one, the first fluorophore will emit at wavelength two to excite fluorophore two to emit at wavelength three.
  • the first epitope may be a VSGTNGT epitope encoded by amino acids 70 to 77 of insert region 1 of a S1 subunit
  • the second epitope may be a RSYLTP epitope encoded by amino acids 247 to 252 of insert region 3 of a S1 subunit.
  • Non-limiting examples of FRET pairs include but are not limited to be 4- (4'-dimethylaminophenylazo) benzoic acid (DABCYL) and TAMRA, QD490 and doxorubicin, Cy5 and BHQ2, Cy3 and FITC, silver nanoclusters and BHQ2, fluorescein and tetramethylrhodamine; rhodamine 6G and malachite green, and FITC and thiosemicarbazole.
  • Methods of using aptamer and antisense molecule are disclosed herein.
  • Methods of using fluorophores and quenchers are disclosed herein.
  • Methods of using FRET pairs are disclosed herein.
  • compositions comprising a plurality of aptamers or aptamer conjugates are disclosed herein.
  • the composition can comprise one or more, two or more, three of more (etc) aptamers.
  • the composition herein may further comprise at least one of water, salts, a polar aprotic solvent, organic solvents, DMSO, methanol, ethanol, one or more buffers, a detergent, a surfactant, 0.1% Tween, or BSA.
  • Methods of using the aptamers (or aptamer conjugates) according to the disclosure disclosed herein are directed to detecting SARS-CoV-2 on a surface.
  • the aptamers may be used to detect SARS-CoV-2 virus in real- time.
  • Methods of detecting the presence or absence of SARS-CoV-2 virus may comprise: a) contacting one or more aptamer with a location of interest, wherein the location of interest is one being interrogated for the presence of SARS-CoV-2; b) allowing the aptamer to bind to SARS-CoV-2 virus, if present; c) optionally washing the location of interest to remove any unbound aptamer; and d) visualizing the aptamer bound to SARS-CoV-2 virus.
  • the methods of detecting the presence or absence of SARS-CoV-2 virus may comprise: a) allowing one or more aptamer to bind to SARS-CoV-2 virus, if present, at a location of interest; b) optionally washing the location of interest to remove any unbound aptamer; and d) visualizing the aptamer bound to SARS-CoV-2 virus.
  • the surface may be an inorganic surface.
  • An inorganic surface may be any surface of a non-living being. The surface can be solid or porous.
  • Non-limiting examples of an inorganic surface include metal surfaces, cardboard surfaces, plastic surfaces (including those made of organic molecules), textiles, carbon-based materials, bed linen, medical equipment, clothing, floors, walls, and the like.
  • the surface may be an organic surface.
  • an organic surface may be that of a being infected (during and after infection) with SARS-CoV-2.
  • Non-limiting examples of an organic surface include biological tissue (e.g. skin, biopsy surface), blood plasma, respiratory tract fluid, and other.
  • the aptamers disclosed herein may be used as an anti-viral agent.
  • the aptamers according to the disclosure disclosed herein may be used as carriers to deliver disinfection agents to selectively inactivate and/or kill SARS-CoV-2 virus.
  • Other methods of use for detection may include detection in human and animal food production.
  • methods of using one or more aptamers herein may utilize direct interference to exert an effect on the virus. Non-limiting examples include, inhibiting viral enzymes, interfering with viral coats, and disrupting viral life cycle (for example, disrupting reverse transcription, chromosomal integration, proteolytic processing, viral expression, packing, and entry).
  • the method of using one or more aptamers herein may impede the capacity of the virus to bind to the ACE2 receptor.
  • a method of detecting the presence, absence and/or concentration of a plurality of viral particles on a surface wherein the viral particle comprises a target molecule and wherein the method comprises: a) contacting a surface suspected having viral particles located thereon with an aptamer or aptamer conjugate which is capable of specifically binding the target molecule; and b) determining the presence, absence and/or concentration of viral particles on the surface.
  • the target molecule is a surface protein of the viral particle.
  • the target molecule is an epitope of a spike protein of a coronavirus.
  • the target molecule is an epitope of a spike protein of a SARS-CoV-2 virus particle.
  • the step of determining the presence, absence and/or concentration of viral particles on the surface comprises detecting viral particles on the surface.
  • the method comprises utilising the detection methods and method steps as described herein.
  • the aptamers of certain embodiments may act as detection agents by binding to SARS-CoV-2 virus particles and being detected via one or more of the detection methods described herein.
  • Embodiments provide a system, a method or compositions which combines a higher level of specificity for the detection of SARS-CoV-2 as distinct from other coronaviruses and a detection system that comprises two independent and specific binding events as a basis for a signal.
  • Embodiments may be based on an analysis of variation in the spike protein from SARS-like and MERS-like coronaviruses derived from both humans and other hosts and the determination that the variation in the inserted regions described herein for SARS-CoV-2 are unique to SARS-CoV-2.
  • the aptamers as described herein are for use in a method of detecting the presence, absence and/or determining concentration of SARS-CoV-2 viral particles.
  • the aptamers are for use in detecting the presence, absence and/or determining concentration of SARS- CoV-2 viral particles located on a surface.
  • the method may involve the direct or indirect contact of a composition comprising the aptamer described herein with the surface. Indirect contact may be via a collecting element which is brought into contact with the surface and subsequently brought into contact with the aptamer.
  • a method of determining the presence, absence and/or concentration of SARS-CoV-2 viral particles in a sample comprising: a) contacting the sample with an aptamer as described herein; wherein the contact is direct or indirect contact; and b) determining the presence, absence and/or concentration of SARS-CoV-2 viral particles in the sample.
  • the step of determining comprises determining whether the aptamer or aptamer conjugate is bound a SARS-CoV-2 viral particle.
  • the step of determining comprises detecting binding of the aptamer or aptamer conjugate to a SARS-CoV-2 viral particle, wherein detection of the bound aptamer indicates the presence of a SARS-CoV-2 viral particle in the sample.
  • a method of detecting the presence, absence and/or determining the concentration of SARS-CoV- 2 viral particles located on a surface comprising: a) contacting the surface directly or indirectly with an aptamer as described herein; and b) determining the presence, absence and/or concentration of SARS-CoV-2 viral particles on the surface.
  • the step of determining comprises determining whether the aptamer or aptamer conjugate is bound to a SARS-CoV-2 viral particle.
  • the surface is a surface suspected of having SARS- CoV-2 viral particles located thereon.
  • the step of determining comprises detecting binding of the aptamer or aptamer conjugate to a SARS-CoV-2 viral particle, wherein detection of the bound aptamer indicates the presence of a SARS-CoV-2 viral particle on the surface.
  • the method comprises detecting the presence of the aptamer or aptamer conjugate bound to the SARS-CoV-2 viral particle, wherein detection of the bound aptamer indicates the presence of a SARS-CoV-2 viral particle in the sample.
  • the method comprises detecting the amount of aptamer-SARS-CoV-2 viral particle complexes present.
  • the method comprises detecting the presence, absence and/or determining the concentration of SARS-CoV-2 viral particles by photonic detection, electronic detection, acoustic detection, electrochemical detection, electro-optic detection, enzymatic detection, chemical detection, biochemical detection or physical detection. Further details of exemplary detection systems are provided herein.
  • the surface may be an inanimate surface.
  • the surface may be for example a surface located in a healthcare setting (e.g., a hospital, a pharmacy, a doctor’s surgery and/or care home facility).
  • the aptamers may be for use in detecting SARS- CoV-2 viral particles located on a surface of an object in an environment such as a school, a prison, a hostel, a dormitory, a train, a bus, an airplane etc.
  • the surface may be located on an object in a location such as a hospital or other healthcare setting.
  • the object may be an operating table, a hospital bed, a surgical instrument, a table, operating scrubs, a refuse container, eating utensils, a chair, a door handle, a door knob, etc.
  • the surface may be located in a location such as walls, ceilings and/or floors in hospital wards, operating theatres, care home rooms, and the like.
  • the surface may be a surface of an object in a community setting for example a shop, a bar and/or a restaurant. The surface may be located on a wall, a floor, an item of furniture, cutlery, packaging, drinking vessels and the like.
  • the surface is located in a household environment.
  • the surface is located in a food production facility.
  • the surface is composed on stainless steel.
  • the surface is composed of cardboard.
  • the surface is composed of paper.
  • the surface is composed of plastic.
  • the surface is composed of glass.
  • the surface is composed of cloth.
  • the method comprises contacting a surface with a composition comprising one or more aptamers according to the present disclosure. In other embodiments, the method comprises contacting a composition comprising one or more aptamers according to the present disclosure with a surface.
  • the method comprising applying a composition comprising the one or more aptamers to the surface.
  • the method comprises contacting a composition comprising one or more aptamers according to the present disclosure with a surface indirectly.
  • the method may comprise providing the aptamer in a composition which is capable of being dispersed across the surface.
  • immediate contact with the surface dispersed uniformly for maximum surface area coverage and wettability facilitates the accessibility of aptamer(s) to target molecules on the SARS- CoV-2 viral particle.
  • Most environmental surface areas are neutral (uncharged) or have negative electrostatic energy.
  • the aptamer is applied to a target surface area using electrostatic force of attraction. It is considered that electrostatically applied liquids have a wrapping effect, so that complex objects and areas hidden from the line of sight get coated with the liquid.
  • Coulomb Based on Coulomb’s law, an electrostatic application system applies aptamer/buffer solutions more evenly to all surfaces.
  • Coulomb states that the magnitude of the electrostatic force of interaction between two-point charges is directly proportional to the scalar multiplication of the square of the distance between them. The force is along the straight line joining them. Charged spray droplets are attracted to surfaces and are considered to have an enveloping effect around the object to insure all sides are covered.
  • the systems and methods provided herein place a positive or negative charge on the chemical solution as it leaves the spray nozzle. Because most surface areas are neutral or negative, a positively charged electrostatic spray application system optimizes adhesion and attraction. The dispersed droplets may spread out more evenly and seek out the negative (-) or neutrally charged surface.
  • the composition comprising the aptamers as described herein is more targeted and provides more consistent coverage with less waste.
  • the method comprises applying a composition comprising an aptamer to a surface by a spray gun modified with an electrode. The electrode charges liquid droplets comprising the aptamers which are then guided to the surface, which is typically oppositely charged to the aptamers.
  • the method comprises producing a composition comprising the aptamer.
  • the aptamers are provided in a dried form and are dissolved completely to a desired stock concentration with a buffer solution or dH 2 O. This may be achieved by, for example, shaking the composition for a predetermined period of time (e.g., 20 minutes, 25 minutes, 30 minutes or more, e.g., 35 minutes, 40 minutes, 45 minutes or greater).
  • the composition may comprise an organic solvent (e.g., DMSO, ethanol and/or methanol). Additionally, the composition may comprise a salt such as for example a sodium ion.
  • the method comprises dissolving the aptamer in a buffer solution.
  • the buffer solution may be selected from, for example PBS, HEPES, Tris etc.
  • aptamers are stable at neutral pH range (7.0-8.0).
  • a heating and a cooling step may be performed for the proper folding of aptamer structure in a buffer solution (for example heating at 95 °C for 5 min followed by slow cooling to room temperature).
  • the method comprises providing a 2+ ion such as magnesium in the buffer solution. Divalent ions such as magnesium may be advantageous in some embodiments to maintain a proper structure of the aptamer.
  • Nucleic acid aptamer in the binding buffer condition pH 7.4 is negatively charged and through electrostatic interactions the aptamer could favor binding to positively charged areas.
  • the method comprises applying a composition comprising the aptamer to the surface by spraying the surface.
  • the aptamers may be freeze-dried prior to being sprayed onto the surface.
  • the method comprises a step of contacting the surface with a freeze dried composition comprising the aptamer as described herein.
  • the aptamer dissolved or suspended in liquid is atomized into fine droplets which are frozen instantaneously by a cryogenic fluid, usually liquid nitrogen.
  • a cryogenic fluid usually liquid nitrogen.
  • the frozen particles are subjected to freeze drying, in which the solvents are sublimed at low temperature and pressure, leading to the formation of dried porous particles.
  • Porous particles with large physical size and low density exhibit small aerodynamic size, which can promote high flowability.
  • the small contact surface area to volume ratio leads to low cohesion force between particles, thereby facilitating dispersibility in air.
  • porous particles have high specific surface area, thereby enhancing dissolution rate.
  • the method comprises dissolving freeze-dried aptamers in a solution prior to contacting the surface with a liquid solution.
  • the method of detecting SARS-CoV-2 viral particles at a location may comprise applying one or more of the aptamers of the disclosure to a location suspected of comprising SARS-CoV-2 viral particles. Following a predetermined period of time sufficient to permit the aptamer binding to SARS-CoV-2 viral particles, the surface may be washed one or more times to remove any unbound aptamer. In some embodiments, e.g. when a FRET pair is used, or beacon as described herein, the washing step is not required.
  • the aptamers are designed to attach to the target i.e. a SARS-CoV-2 viral particle and fluoresce.
  • the aptamers will not fluoresce by attaching to the inorganic surface alone. Therefore, concentration of aptamers in a composition e.g. a buffer solution is important.
  • the aptamer comprises a detection molecule e.g. a fluorophore.
  • the detection molecule emits energy in the visible spectrum.
  • the detection molecule is a near-infrared fluorophore that emits in the range of between 650 and 900 nm.
  • the detection molecule emits in the range of between 450 and 650 nm. Further details of exemplary fluorophores are provided herein.
  • the method further comprises a step of washing the surface subsequent to step (a) and prior to step (b).
  • the method comprises the use of a FRET system to detect the presence of SARs-CoV-2 on a surface.
  • FRET Fluorescence resonance energy transfer
  • FRET pair Fluorescence resonance energy transfer
  • This transfer of energy results in a quenching of the donor emission and is typically re-emitted by the acceptor at a longer wavelength.
  • the target e.g. the SARS-CoV-2 viral particle
  • competitive binding/hybridization of the recognition domain with the target molecule results in dose-dependent separation of the stem-loop hairpin. Consequently, the FRET quenching signal is altered in a dose-dependent manner.
  • the intensity of donor emission is dependent on several factors, including the distance and the dipole orientation between the fluorophores, the overlap of the emission and absorbance spectra with the acceptor molecule, and the refractive index of the solvent. However, while multiple factors influence FRET, the principle conditions required for FRET are relatively few.
  • the donor and acceptor molecules must be in close proximity to one another (typically 10-100 ⁇ ).
  • the absorption/excitation spectrum of the acceptor molecule must overlap the emission spectrum of the donor molecule.
  • the donor and acceptor transition dipole orientations must be approximately parallel. Assuming the donor acceptor pairs are compatible, the most critical element necessary for FRET to occur is proximity of the pair.
  • aptamers can tolerate non-physiological conditions, high temperatures, extreme pH, and organic solvents, and consequently are highly amenable to functionalisation.
  • aptamers can be labelled with an array of different donor-acceptor molecules and emit signals at differing wavelengths to create a molecular aptamer beacon capable of high specific target binding and dose- dependent signal generation.
  • the aptamer may comprise a FRET pair of molecules.
  • the aptamer may comprise a donor molecule at one end of the aptamer and an acceptor molecule at the other. In the absence of a target, these probes are designed to form stem-loop hairpin structures that bring the donor-acceptor pair into proximity to one another, quenching the signal of the donor molecule.
  • molecular aptamer beacons rely on a “closed” conformation when the target is absent enabling stem-loop formation and allowing interaction of the functionalized termini. Target binding denatures the stem and activates/changes the signal. This method of action is termed “target-induced structure switching”.
  • the aptamer comprises a FRET pair. Further details of exemplary FRET pairs are provided herein.
  • the method comprises the use of a detection molecule such as an antisense nucleic acid molecule.
  • the detection molecule comprises an antisense nucleic acid molecule which comprises a nucleic acid sequence which is at least partially complementary to a nucleic acid sequence of the aptamer.
  • the antisense nucleic acid molecule comprises or consists essentially of a nucleic acid sequence which is complementary to, and is capable of binding to at least a portion of the following nucleic acid sequence: TGTCACATCTACACTGCTCGAAG (SEQ ID NO: 1) [0280] In some embodiments, the antisense nucleic acid molecule comprises or consists essentially of a nucleic acid sequence which is complementary to and is capable of binding to at least a portion of the following nucleic acid sequence: ATTCAGACAGCGTTCCC (SEQ ID NO: 2) [0281] The antisense nucleic acid molecule may bind to one or more of the nucleic acid residues comprised in the primer regions detailed above.
  • the antisense nucleic acid molecule may bind to 1, 2, 3, 4, 5, or more residues in one of the primer regions of the aptamer.
  • the antisense nucleic acid molecule is a single stranded RNA (ssRNA) molecule.
  • the antisense nucleic acid molecule is a single stranded DNA (ssDNA) molecule.
  • the antisense nucleic acid molecule comprises one or more modified nucleotides.
  • the antisense molecule may comprise one or more missense mutations such that certain nucleic acid residue position(s) are not complementary to the aptamer sequence.
  • Missense mutations of the antisense molecule may be introduced to create antisense molecules which have varying affinity for the aptamer.
  • the antisense nucleic acid molecule comprises one of a FRET pair, whilst the aptamer comprises a second of a FRET pair. Further details of exemplary FRET pairs are provided herein.
  • the aptamer comprises a fluorophore attached thereto, and the antisense nucleic acid molecule comprises a quencher molecule attached thereto.
  • the aptamer comprises a quencher attached thereto, and the antisense nucleic acid molecule comprises a fluorophore attached thereto.
  • FIG. 6 illustrates the proportional difference in fluorescence between the presence and absence of target as a function of antisense concentration.
  • the fluorescence is presented indirectly in terms of the concentration of free aptamer and aptamer bound to target. The total amount of aptamer stays the same regardless of antisense concentration.
  • the relationship between fluorescence observed and aptamer concentration can determine the location on the curve shown in FIG.6, for example.
  • the threshold for detection will enable the highest antisense concentration that can be used to be determined.
  • the simulation can be used to optimise a signal/noise ratio in which the signal is as close to zero as possible in the absence of the target, but which is detectable in the presence of the target.
  • target can be used to refer to e.g. the viral particle and more specifically the target molecule of the viral particle e.g. an epitope of the spike protein of SARS-CoV-2.
  • the detection molecule comprises an antisense nucleic acid molecule as described herein
  • the antisense nucleic acid molecule may comprise a quencher molecule.
  • the single stranded antisense nucleic acid molecule comprises a plurality of quencher molecules.
  • Reference to a quencher molecule herein may include by way of example quencher molecules selected from the group consisting of Black Hole Quencher molecules (Sigma-Aldrich).
  • BHQ-1 is a quencher which is sold under Catalog Reference Number 26-6472 from GeneLink for example and has an absorbance maximum of 534 nm and an effective absorbance range of 480-580 nm. It is typically paired with fluorescent dyes that emit in the yellow-green part of the visible range (519-556 nm).
  • the quencher molecule is provided in a molar excess.
  • the aptamer may comprise a fluorophore attached thereto.
  • the fluorophore may be selected from the group consisting of: FAM, TET, HEX, TAMRA, Texas Red and Cy5.
  • the FRET pair may be DABCYL and TAMRA.
  • the FRET pair may be QD490 and doxorubicin.
  • the FRET pair may be Cy5 and BHQ2.
  • the FRET pair may be Cy3 and FITC.
  • the FRET pair may be silver nanoclusters and BHQ2.
  • the fluorophore may be, for example, 5- (2'- aminoethyl) aminonaphthalene-1-sulfonic acid (“EDANS”), fluorescein or anthranilamide.
  • the quencher may be, for example, a chemical group such as 4- (4'- dimethylaminophenylazo) benzoic acid (“DABCYL”), rhodamine or eosin.
  • QD refers to quantum dot
  • Cy5 refers to cyanine5
  • BHQ2 refers to black hole quencher 2
  • TAMRA refers to tetramethylrhodamine
  • DABCYL refers to 4-(4-dimethylaminophenylazo)-benzoic acid
  • Cy3 refers to cyanine3
  • FITC refers to fluorescein isothiocyanate.
  • the detection molecule comprises a quantum dot.
  • Quantum dots may have a broad absorbance and narrow emission spectra. They may also be photochemically stable.
  • a quantum dot may be attached to either the aptamer or the antisense nucleic acid molecule e.g.
  • An exemplary method of making the quantum dot-aptamer complexes may include: [0306] Either the aptamer contains a 5′ amine and the complementary 3′ quencher or the aptamer contains a 3′ quencher and the complementary strand 5′ amine. Further a 3′ amine could be used with a 5′ quencher.
  • the strands can be annealed in 10 mM NaCl, 0.1 M MOPS buffer, pH 7.0 by heating to 85 °C for fifteen minutes in a water bath and while still in the water bath cooled to room temperature. Strands can be stored refrigerated.
  • the annealed strands can be conjugated to quantum dots such as but not limited to T1 or T2 Carboxyl Birch Yellow quantum dots. These dots and strands may be mixed with a molar ratio of approximately 8 duplex DNA strands per dot.
  • the quantum dot is selected from the group consisting of CdS, CdTe, CdTe/ZnS, CdSe and CdSe/ZnS-based quantum dots.
  • the quantum dot may be functionalised.
  • exemplary functionalised quantum dots include e.g. silica functionalised SiO 2 - CdZnSeS quantum dots and thioglycolic acid (TGA)-capped CdZnSeS/ZnSe1.0S1.3 alloyed quantum dots.
  • TGA thioglycolic acid
  • Various quantum dots can be obtained from e.g. ThermoFisher Scientific.
  • the quencher molecule may be a gold nanoparticle.
  • the quencher molecule may be graphene.
  • the gold nanoparticle may be selected from a nanosphere, a nanoshell and a nanorod.
  • Gold nanoparticles typically have a particle size distribution between 1 nm and 100 nm.
  • the gold nanoparticles are functionalised on the surface.
  • the method further comprises contacting the surface (directly or indirectly) with reflective photonic crystals.
  • the photonic crystals may enhance signal intensity within a predetermined wavelength range.
  • Photonic crystals are materials that change the optical properties of incident light and create a forbidden gap in the photonic band structure.
  • the method comprising detecting the loss of quenching as a result of the aptamer binding to the target.
  • the step of detecting may comprise illuminating the location.
  • the method comprises detecting binding of the aptamer to a SARS-CoV-2 viral particle using a light source, such as a laser; focusable optics, such as a lens; filters or monochromators to effect changes in the spectrum of excitation or fluorescence emission; and a CCD camera or a single photon count detector to measure fluorescence.
  • a light source such as a laser
  • focusable optics such as a lens
  • filters or monochromators to effect changes in the spectrum of excitation or fluorescence emission
  • a CCD camera or a single photon count detector to measure fluorescence.
  • the method may comprise a set of conditions for illuminating the location using a light source.
  • the light source may be in the form of a forensic light source.
  • the light source may be in the form of a Polilight® Flare.
  • the light source may be capable of switching between different wavelengths, each wavelength being suited to a specific interchangeable filter.
  • the forensic light source may be in the form of a LED, laser, Polilight® or the like.
  • the light source is a handheld light source.
  • the handheld light source may be a Polilight Flare+2, which is a battery operated, handheld LED light source, available from e.g. Rofin Forensic.
  • each Polilight Flare “torch” may produce light a specified wavelength range.
  • the light source may produce light at a wavelength of between about 360 nm – 385 nm (UV light).
  • the light source may produce light at a wavelength of between about 405 nm – 420 nm. In some embodiments, the light source may produce light at a wavelength of between about 435 nm – 465 nm. In some embodiments, the light source may produce light at a wavelength of between about 485 nm – 515 nm. In some embodiments, the light source may produce light at a wavelength of between about 510 nm – 545 nm. In some embodiments, the light source may produce light at a wavelength of between about 530 nm – 560 nm. In some embodiments, the light source may produce light at a wavelength of between about 585 nm – 605 nm.
  • the light source may produce light at a wavelength of between about 615 nm – 635 nm. In some embodiments, the light source may produce light at a wavelength of between about 400 nm – 700 nm. In some embodiments, the light source may produce light at a wavelength of between about 835 nm – 865 nm. In some embodiments, the light source may produce light at a wavelength of between about 935 nm – 965 nm. [0315] In some embodiments, the light source used may be compatible with a detectable molecule conjugated to the aptamer. In some embodiments, the aptamer will be conjugated to a detection molecule.
  • the detection molecule may be a fluorophore which emits in a spectral range which corresponds to the output of the light source.
  • the aptamer may be conjugated to a fluorophore which emits at a wavelength of about 505 nm.
  • the light source produces light having a wavelength of about 505 nm.
  • the method may comprise the use of a bandpass filter in combination with the light source. The bandpass filter may be configured to transmit light of a certain wavelength band and reject stray light outside the predetermined wavelength band.
  • the light source is configured to produce narrow bands of light having centre wavelengths of 365 nm, 415 nm, 450 nm, 505 nm, 530 nm, 545 nm, 620 nm, and 850 nm.
  • the light source is configured to produce narrow bands of light having a center wavelength of 505 nm, in addition to white light wavelengths.
  • the bandpass filter is a 590 nm bandpass filter.
  • the method may further comprise visualising the location of the surface with viewing goggles, glasses, or the like.
  • the viewing goggles are of a colour which corresponds to the colour of light produced by the light source and emitted by the detection molecule conjugated to the aptamer.
  • the goggles are orange and thus are suitable for use in combination with a light source which produces light having a wavelength of between about 485 nm – 515 nm, e.g. 505 nm, and an aptamer which comprises a detection molecule that emits at a wavelength of approximately 505 nm.
  • the method comprises detection of the SARS-CoV-2 viral particle via a colorimetric detection system.
  • the aptamer is conjugated to a gold nanoparticle (GNP).
  • the method comprises contacting the surface with a composition comprising an aptamer conjugated to a gold nanoparticle.
  • the gold nanoparticle may be selected from a nanosphere, a nanoshell and a nanorod.
  • Gold nanoparticles typically have a particle size distribution between 1 nm and 100 nm.
  • the gold nanoparticles are functionalised on the surface. [0319] If the SARS-CoV-2 viral particle is present on the surface, and located by the collecting element, the aggregation of the GNPs will cause a visible shift in the colour of the solution.
  • the collecting element may be a cotton swab.
  • the GNPs aggregate in the presence of a target because the aptamers binding to the target bring them into physical proximity with each other.
  • the method may comprise detecting the colour shift of the solution directly by eye. Alternatively, the colour shift may be detected using a spectrophotometer.
  • the method comprises the use of graphene-gold nanoparticle complexes which have a peroxidase-like activity, mediating a catalytic reaction associated with colour change upon addition of substrate (3,3′,5,5′ tetramethylbenzidine).
  • the ssDNA aptamer prevents the peroxidase substrates from contacting the active interface and depresses the catalytic ability of the graphene-AuNPs.
  • the method comprises the use of detection molecules such as intercalating dyes (for example, cyber green, ethidium bromide, and others known in the art), or bioluminescent proteins as energy donors combined with dark quenchers, graphene oxide (GO), carbon nanostructures, enzymes and redox-active mediators.
  • detection molecules such as intercalating dyes (for example, cyber green, ethidium bromide, and others known in the art), or bioluminescent proteins as energy donors combined with dark quenchers, graphene oxide (GO), carbon nanostructures, enzymes and redox-active mediators.
  • the method comprises the use of a DNA intercalating dye such as but not limited to 1,1′-(4,4,7,7-tetramethyl-4,7-diazaundecamethylene)- bis-4-[3-methyl-2,3-dihydro-(benzo-1,3-thiazole)-2-methylidene]-pyridinium tetraiodide (BOBO-3).
  • the intercalating dye acts as a FRET acceptor and may be for use with a FRET pair member such as a quantum dot.
  • BOBO-3 intercalated into the double-stranded stem portion of the beacon and is a FRET acceptor of the QD emission in the absence of target.
  • the duplex form of the aptamer results in release of BOBO-3 and direct QD emission.
  • Ag-SiO 2 nanoparticles may be used as a detection molecule as part of a detection system.
  • the detection system may also comprise thiazole orange.
  • the conformation of the aptamers change into a G-quadruplex structure, causing thiazole orange fluorescence.
  • a composition comprising one or more aptamer conjugates and graphene oxide (GO) is provided.
  • the composition is a suspension.
  • the composition comprises a buffer.
  • the composition further comprises a blocking agent to minimize or eliminate non-specific binding.
  • the blocking agent includes, but is not limited to, polyethylene glycol (PEG) (including polymeric chain of various lengths), Tween (e.g., Tween 20, Tween 40, Tween 80), nucleic acid (e.g., oligonucleotides, sheared salmon sperm DNA), polyvinyl pyrrolidine or any blocking agent known in the art.
  • PEG polyethylene glycol
  • Tween e.g., Tween 20, Tween 40, Tween 80
  • nucleic acid e.g., oligonucleotides, sheared salmon sperm DNA
  • polyvinyl pyrrolidine any blocking agent known in the art.
  • the detectable moiety comprises a fluorescent moiety and visualization comprises visualizing and/or measuring the level of fluorescence.
  • the detectable moiety comprises biotin having a binding affinity for streptavidin protein conjugates, such as streptavidin/horseradish peroxidase and visualization comprises visualizing using a colorimetric reaction.
  • the detectable moiety gold nanoparticles conjugated to the aptamer and visualization comprises visualizing using a colorimetric assay.
  • the detectable moiety comprises a quantum dot, that fluoresces.
  • the visualizing step comprises imaging the sample.
  • the visualizing step comprises measuring the level of fluorescence.
  • the visualizing step comprises comparing the fluorescence level to a negative control sample.
  • the method does not comprise a washing step.
  • the method further comprises the step of incubating the aptamer conjugates with the sample for a predetermined period of time to allow the aptamer conjugate to bind to SARS-CoV-2 if present.
  • the sample is contacted first with a blocking agent and subsequently with the combination of aptamer conjugates-graphene oxide.
  • the sample is a solid surface.
  • the methods comprises spraying, immersing, fogging, vaporizing, coating, adding an aliquot of the solution directly either by pouring, or swabbing, or with a pipetting device to a sample with the composition comprising one or more aptamer conjugates and graphene oxide.
  • the composition comprises one or more different aptamers having a binding affinity to the same binding region of SARS-CoV-2.
  • the composition comprises one or more different aptamers having a binding affinity to one or more different binding regions of SARS-CoV-2.
  • each aptamer can comprise a different detectable moiety.
  • Graphene oxide is prepared from graphene by the exposure of graphene to oxygen donor sources such as NaNO 3, H 2 SO 4 , H 3 PO 4 and KMnO 4 .
  • the graphene oxide comprises an oxygen content of about 36%.
  • the graphene oxide comprises an oxygen content greater than 35%, for example about 44-45%.
  • the graphene oxide once formed self-assembles into two-dimensional sheets of varying sizes.
  • the total surface area of the graphene oxide is about 736.6 m 2 /g. In some embodiments, the total surface area can be calibrated based on the amount of graphene oxide used and/or on the level of fluorescence quenching. Without being bound to any theory, determination of the appropriate amount of GO to be used for a desired level of aptamer quenching can be a consideration of the total surface area of the GO in the solution.
  • the graphene oxide is in the form of nanoparticles. In some embodiments, the average size of the nanoparticles is 10 to 500 nm.
  • Aptamers adhere to the graphene oxide (GO) sheets based on Van der Waals forces and hydrogen bonds.
  • a detectable moiety such as a fluorescent moiety
  • the fluorescence of the fluorescent moiety is quenched by the association with the graphene oxide surface.
  • the aptamer dynamically binds and unbinds to the GO very rapidly. The presence of a target protein that the aptamer binds changes the equilibrium of aptamer/GO binding, such that the amount of aptamer bound to GO is less.
  • the aptamer in the presence of a SARS-CoV-2 region for which the aptamer binds with a binding affinity greater than binding affinity to the graphene oxide, fluorescence is emitted.
  • the aptamer binds with a binding affinity that is twice, ten, twenty, thirty, forty, fifty, sixty, seventy, eighty, ninety, hundred greater, five hundred, thousand times or more than binding affinity to the graphene oxide.
  • the aptamer binds with a binding affinity that is between 2 and 1000 fold, between 10 and 1000 fold, between 50 and 1000 fold, between 100 and 1000 fold, between 2 and 100 fold, between 10 and 100 fold, between 50 and 100 fold, than binding affinity to the graphene oxide.
  • the aptamers described herein may be modified in that a guanine residue present in the aptamer may be modified. In the presence of tetra-n-propylammonium hydroxide and dimethylformamide, the guanine of single- stranded DNA reacts with 3,4,5-trimethoxylphenylglyoxal, producing a high-energy intermediate.
  • the method comprises detecting the presence, absence and/or concentration of SARS-CoV-2 viral particles using a chemiluminesence (CL) detection system.
  • CL chemiluminesence
  • “CL” is defined as material molecules generating optical radiation after absorbing chemical energy.
  • the intensity of the luminous radiation reflects the concentration of the analytes.
  • CL analysis has high sensitivity (detection limit of 10 ⁇ 12 to 10 ⁇ 21 mol) due to the ability to carry out photon metering without interference from scattered light background when an external excitation source exists.
  • the aptamer is conjugated to an enzyme.
  • a detection molecule such as an antisense nucleic acid molecule may be conjugated to an enzyme.
  • the aptamer(s) is attached to a conductive polymer, wherein the binding of the target molecule to the aptamer(s) and the resulting change in the conformation of the aptamer(s) beacon produces a conformational change in the polymer so that conductivity is altered. The change in conductivity may be determined, for example, by measuring a resistance in the polymer.
  • the method comprises contacting a surface with an aptamer(s) as defined herein indirectly. Thus, in some embodiments the method comprises contacting the surface with a collecting element.
  • the collecting element may be for example a cotton-tipped swab element. Such cotton-tipped swab elements may be obtained from e.g. Thermo Fisher Scientific. In some embodiments, the collecting element may be a cloth e.g. an antistatic cloth e.g. a microfibre cloth. [0342] In some embodiments, the method further comprises wetting the collecting element prior to contacting the surface. [0343] In some embodiments, the method further comprises a step of contacting the collecting element with a solution comprising an aptamer as described herein. In some embodiments, the solution further comprises a detection molecule as described herein. If the collecting element comprises SARS-CoV-2 viral particles, the aptamer should bind to the target molecule.
  • the target molecule may be an epitope of the spike protein as described herein.
  • the method comprises the use of a detection system as described herein.
  • the aptamer(s) may comprise one of a FRET pair.
  • the aptamer(s) may comprise a detection molecule as described herein e.g. a beacon molecule.
  • the method comprises contacting a collecting element which has been previously been contacted with the surface with a solution comprising the aptamer(s) and the detection molecule.
  • the method comprises preparing the solution comprising the aptamer(s) and the detection molecule prior to contacting the collecting element with the solution.
  • the solution comprises a molar excess of the detection molecule.
  • the method comprises contacting the surface, directly or indirectly with a plurality of aptamers, each aptamer being capable of specifically binding a different epitope of the SARS-CoV-2 viral particle.
  • the method comprises contacting the surface with a first aptamer which is capable of specifically binding to a first epitope of a SARS-CoV-2 viral particle and a second aptamer which is capable of specifically binding to a second epitope of a SARS-CoV-2 viral particle, wherein one of the first or the second aptamer is associated with a first member of a FRET pair and one of the first or the second aptamer is associated with a second member of a FRET pair.
  • the first aptamer is capable of specifically binding to a VSGTNGT epitope of a S1 subunit of the spike protein of SARS-CoV-2.
  • the second aptamer is capable of binding to RSYLTP epitope of a S1 subunit of the spike protein of SARS-CoV-2.
  • an aptamer which is capable of specifically binding to the RSYLTP epitope and the VSGTNGT epitope is provided.
  • two or more different aptamers having a specific binding affinity for two or more different target peptides, wherein the target peptides are fragments of the surface protein are provided.
  • an aptamer that bound to the VSGTNGT site and a different aptamer that bound to the RSYLTP site would be physically proximal to each other in space. This physical proximity is used as a basis for the transference of signals between the bound aptamers such as a FRET signal.
  • an aptamer binding to one site could be excited at a specific wavelength that would not excite the aptamer bound to the other site. The light of the emission from such an aptamer could then be captured by the second aptamer as excitation, thus eliciting an emission at a different wavelength.
  • this second fluorescence signal would only be present when both aptamers are bound to a SARS-CoV-2 protein, providing a high level of specificity in the identification of the presence of this virus.
  • one of the binding aptamers has a fluorophore and the other aptamer has a quencher. The physical proximity of the quencher to the fluorophore would reduce the amount of fluorescence emitted in the presence of the target.
  • two or more different aptamers are developed for two or more different binding sites, and an aptamer comprising two or more different aptamers that bind to the two or more different binding sites can be produced.
  • a first aptamer that binds for example the VSGTNGT site and a second aptamer that binds the RSYLTP site can be developed.
  • the first and second aptamer can be combined into a contiguous sequence.
  • the aptamer is formed by combining both aptamers into one contiguous sequence such that in its native state a quencher moiety is physically aligned with a fluorophore, and when both aptamer domains, the domain that binds to one of the insertion sites, and the domain that binds to the other insertion site, are bound to their insertion sites, the quencher is physically separated from the fluorophore thus allowing the emittance of fluorescence.
  • the two insertions in the SARS-CoV-2 S1 protein enable the development of an aptamer development and detection strategy with a high level of specificity.
  • a composition comprising an aptamer that binds SARS- CoV-2.
  • Embodiment 2. A composition according to embodiment 1, wherein the aptamer binds a spike protein on a surface protein of SARS-CoV-2.
  • Embodiment 3. A composition according to embodiment 1 or 2, wherein the aptamer binds to an S1 domain of the spike protein.
  • Embodiment 4. A composition according to any one of embodiments 1 to 3, wherein the aptamer is made by selecting for aptamers from a na ⁇ ve DNA aptamer library that bind to the S1 domain.
  • Embodiment 6 A composition according to embodiment 5, wherein the selecting further comprises collecting aptamers that bound to the immobilized recombinant S1 SARS-CoV-2 protein.
  • Embodiment 7 A composition according to embodiment 6, wherein the selecting further comprises a second round of selection comprising a negative selection against aptamers binding a target other than recombinant S1 SARS-CoV-2 protein.
  • Embodiment 9. A composition according to embodiments 7 or 8, wherein the target other than recombinant S1 SARS-CoV-2 protein is a SARS-CoV protein.
  • Embodiment 10. A composition according to embodiments 8 or 9, wherein the selecting comprises repeating the process of negative selection followed by positive selection until the amount of selected library recovered after a selection round containing both negative and positive selections increases relative to the amount recovered in previous selection rounds.
  • Embodiment 12 A composition according to any one of embodiments 1 to 11, wherein the aptamer is a single stranded DNA aptamer comprising a detectable label.
  • Embodiment 13 A composition according to embodiment 12, wherein the detectable label is a fluorescent label.
  • Embodiment 14 A composition according to embodiment 12 or 13, wherein the fluorescent label is quenchable by a quencher.
  • Embodiment 15 The composition according to embodiment 14, wherein in the unbound state, when the aptamer is not bound to its target, the fluorescent label is quenched, and in the bound state, when the aptamer is bound to its target, the fluorescent label is not quenched.
  • Embodiment 16 Embodiment 16.
  • Embodiment 17 The composition according embodiment 15, wherein the quencher is present on the aptamer and in the unbound state is proximal to the fluorescent label such that fluorescence is quenched, and in the bound state is distal to the fluorescent labels such that fluorescence is not quenched.
  • composition according to any one of embodiments 1 to 17 further comprising at least one of water, salts, a polar aprotic solvent, DMSO, ethanol, methanol, one or more buffers, a detergent, a surfactant, 0.1% Tween, or BSA.
  • Embodiment 19 An aptamer capable of specifically binding to a SARS-CoV- 2 protein.
  • Embodiment 20 An aptamer according to embodiment 19, wherein the SARS-CoV-2 protein is a spike protein on a surface of SARS-CoV-2.
  • Embodiment 21 An aptamer according to embodiment 20, wherein the aptamer binds to an S1 domain of the spike protein.
  • Embodiment 22 An aptamer according to embodiment 19 or 21, wherein the aptamer is made by selecting for aptamers from a na ⁇ ve DNA aptamer library that bind to the S1 domain.
  • Embodiment 23 An aptamer according to embodiment 22, wherein the selecting comprises a first round of selection comprising: [0384] combining sequences of the na ⁇ ve DNA aptamer library with an immobilized recombinant S1 SARS-CoV-2 protein to form a combination.
  • Embodiment 24 An aptamer according to embodiment 23, wherein the selecting further comprises collecting aptamers the bound to the immobilized recombinant S1 SARS-CoV-2 protein.
  • Embodiment 25 An aptamer according to embodiment 24, wherein the selecting further comprises a second round of selection comprising a negative selection against aptamers binding a target other than recombinant S1 SARS-CoV-2 protein.
  • Embodiment 26 An aptamer according to embodiment 25, wherein the second round of selection further comprises a positive selection of aptamers binding the recombinant S1 SARS-CoV-2 protein 2.
  • Embodiment 27 An aptamer according to embodiments 25 or 26, wherein the target other than recombinant S1 SARS-CoV-2 protein is a SARS-CoV protein.
  • Embodiment 28 Embodiment 28.
  • the selecting comprises repeating the process of negative selection followed by positive selection until the amount of selected library recovered after a selection round containing both negative and positive selections increases relative to the amount recovered in previous selection rounds.
  • Embodiment 31 An aptamer according to embodiment 30, wherein the detectable label is a fluorescent label.
  • Embodiment 32 An aptamer according to embodiment 30 or 31, wherein the fluorescent label is quenchable by a quencher.
  • Embodiment 33 The aptamer of embodiment 32, wherein in the unbound state, when the aptamer is not bound to its target, the fluorescent label is quenched, and in the bound state, when the aptamer is bound to its target, the fluorescent label is not quenched.
  • Embodiment 34 The aptamer of embodiment 33, wherein the quencher is present on a DNA strand complimentary to a sequence of the aptamer such that in the unbound state the DNA strand is bound to the aptamer and in the bound state the DNA strand is not bound to the aptamer.
  • Embodiment 35 The aptamer of embodiment 33, wherein the quencher is present on the aptamer and in the unbound state is proximal to the fluorescent label such that fluorescence is quenched, and in the bound state is distal to the fluorescent labels such that fluorescence is not quenched.
  • Embodiment 36 Embodiment 36.
  • an aptamer according to any one of embodiments 19 to 22, wherein the aptamer comprises, consists essentially of, or consists of: a forward primer recognition region; a reverse primer recognition region; and a random region in between the forward primer recognition region and the reverse primer recognition region, wherein the random region comprises nucleotides whose sequence differs between individual aptamers.
  • an aptamer according to any one of embodiments 19 to 36 wherein the capability of specifically binding to a region of a SARS-CoV-2 protein is a capability of binding to a unique sequence of the S1 domain of the spike protein, preferably where the unique sequence is selected from the group consisting of insert region 1 (VSGTNGT at amino acid sequence 70-77), insert region 2 (KSWM at amino acid sequence 150-153), insert region 3 (RSYLTP at amino acid sequence 247-252), and insert region 4 (SPRR at amino acid sequence 680-683). [0399] Embodiment 38.
  • An aptamer comprising, consisting essentially of, or consisting of: a nucleic acid sequence having at least 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to an aptamer of any one of embodiments 19–37; a nucleic acid sequence having at least about 30 consecutive nucleotides of any one the nucleic acid sequences made according to any one of embodiments 19 to 37; or a nucleic acid sequence having at least about 30 consecutive nucleotides of a sequence having at least 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,90, 91, 92, 93, 94,
  • Embodiment 39 A composition comprising the aptamer of any one of embodiments 19 to 38, or 98.
  • Embodiment 40 The composition of embodiment 39 further comprising at least one of water, salts, a polar aprotic solvent, DMSO, ethanol, methanol, one or more buffers, a detergent, a surfactant, 0.1% Tween, or BSA.
  • Embodiment 41 Embodiment 41.
  • a composition comprising a first aptamer and a second aptamer, wherein: the first aptamer specifically binds to a first location on a target and comprises a first fluorescent label that excites at a first wavelength and emits at a second wavelength, the target comprising an S1 spike protein of SARS-CoV-2, the second aptamer specifically binds to a second location on the target and comprises a second fluorescent label that excites at the second wavelength and emits at a third wavelength, and upon binding of the first aptamer and the second aptamer simultaneously to the target and excitation at the first wavelength, the second fluorescent label emits at the third wavelength, wherein the first aptamer is an aptamer of any one of embodiments 19 to 38, or 98, and the second aptamer is an aptamer of any one of embodiments 19 to 38, or 98 but other than the first aptamer.
  • Embodiment 42 An antisense nucleic acid comprising a sequence complementary to at least six consecutive nucleotides of any of the aptamer of any one of embodiments 19 to 38, or 98.
  • Embodiment 43 The antisense nucleic acid according to embodiment 42, wherein the at least six nucleotides are complementary to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, or 25 consecutive nucleotides of the aptamer.
  • Embodiment 44 Embodiment 44.
  • the antisense nucleic acid according to embodiment 52 wherein the at least six nucleotides are complementary to 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, or 25 consecutive nucleotides of the aptamer.
  • Embodiment 45 The antisense nucleic acid according to any one of embodiments 42 to 44, wherein the antisense nucleic acid is a DNA.
  • Embodiment 46 The antisense nucleic acid according to any one of embodiments 42 to 44, wherein the antisense nucleic acid is an RNA.
  • Embodiment 47 Embodiment 47.
  • Embodiment 48 A composition comprising the aptamer(s) of any of embodiments 19 to 38, or 98 and the antisense nucleic acid of any one of embodiments 42 to 45.
  • Embodiment 49 A composition comprising the aptamer(s) of any of embodiments 19 to 38, or 98 and the antisense nucleic acid of any one of embodiments 42 to 45.
  • Embodiment 50 Embodiment 50.
  • detecting the presence of SARS-CoV-2 virus on a surface comprises: contacting the surface with an aptamer or composition herein; and detecting the presence, absence or amount of SARS-CoV-2 virus, wherein detecting occurs by visualizing the presence or absence of SARS-CoV-2 virus on the surface according to embodiments 52 to 75.
  • Embodiment 51 A method according to embodiment 50, wherein the surface is an organic surface or an inorganic surface.
  • Embodiment 52 Embodiment 52.
  • a method of detecting the presence, absence and/or concentration of SARS-CoV-2 at a location comprises: a) contacting the location with an aptamer as embodied in any of embodiments 19 to 38, or 98; wherein the contact is direct or indirect contact; and b) determining the presence, absence and/or concentration of SARS-CoV-2 at the location.
  • Embodiment 53 The method of embodiment 52, wherein the step (b) comprises: i) detecting the aptamer bound to a SARS-CoV-2 viral particle, wherein detection of the bound aptamer indicates the presence of a SARS-CoV-2 viral particle at the location.
  • Embodiment 54 Embodiment 54.
  • step (a) comprises: i) contacting the location with the aptamer for a period of time sufficient for the aptamer to bind to the SARS-CoV-2 viral particle to form an aptamer-SARS-CoV-2 viral particle complex.
  • step (b) comprises detecting the aptamer-SARS-CoV-2 viral particle complex.
  • step (b) comprises providing a visual indication of the presence of SARS-CoV-2 viral particle.
  • Embodiment 57 Embodiment 57.
  • Embodiment 52 which is for detecting the presence, absence and/or concentration of a SARS-CoV-2 viral particle on a surface located at the location.
  • Embodiment 58 The method of embodiment 52, wherein the location is selected from a location in a healthcare facility e.g. a hospital, a care home, a laboratory, an educational facility e.g. a school or a university, a community care facility, e.g. a nursing home and a care home.
  • Embodiment 59 The method of embodiment 52, wherein the surface is selected from the group consisting a surface of a hospital bed, an operating table, surgical equipment, walls, ceilings, floors, tables, chairs and door handles.
  • Embodiment 60 The method of embodiment 52 wherein step (a) comprises contacting the surface with a composition comprising the aptamer by liquid or aerosol spraying or wiping the surface with the composition comprising the aptamer.
  • Embodiment 61 The method of embodiment 52 which comprises electrostatically spraying the composition onto the surface.
  • Embodiment 62 The method of embodiment 52 which comprises filling a sprayer device with a composition comprising the aptamer prior to step (a).
  • Embodiment 63 The method of embodiment 52, which comprises immersing the surface suspected of comprising the SARS-CoV-2 viral particle in a composition comprising the aptamer.
  • Embodiment 64 Embodiment 64.
  • Embodiment 65 The method of embodiment 52, wherein step (a) comprises: i) contacting the location with a collecting element; and ii) contacting the collecting element with a composition comprising the aptamer.
  • step (a) comprises: i) contacting the location with a collecting element; and ii) contacting the collecting element with a composition comprising the aptamer.
  • step (ii) comprises locating the collecting element in a liquid composition comprising the aptamer.
  • Embodiment 68 The method of any of embodiments 52 to 67 wherein the step of detecting is performed in less than 15 minutes e.g. 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 minute.
  • Embodiment 69 The method of embodiment 52, wherein the binding of aptamer to the SARS-CoV-2 viral particle can be observed without instrumentation.
  • Embodiment 70 The method of embodiment 52, wherein binding of aptamer to the SARS-CoV-2 viral particle results in the appearance or disappearance of fluorescence and/ or a qualitative or quantitative color change.
  • Embodiment 71 The method of any of embodiments 52 to 70 wherein step (b) comprises measuring a FRET signal between the quencher molecule and the fluorophore.
  • Embodiment 72 The method of embodiment 52, which comprises contacting the surface with a plurality of aptamers, each aptamer being capable of specifically binding to a different epitope of the SARS-CoV-2 viral particle.
  • Embodiment 73 The method of embodiment 52 comprising detecting the loss of quenching as a result of the aptamer binding to the SARS-CoV-2 viral particle.
  • Embodiment 74 The method of embodiment 52, wherein the step of detecting comprises illuminating the location.
  • Embodiment 75 The method of embodiment 52 which further comprises comparing the FRET signal measured in step (b) against a control in which SARS- CoV-2 is absent.
  • Embodiment 76 The method of any of embodiments 52 to 75 (to include direct and non-direct contact), wherein the composition comprises a first aptamer and a second aptamer, wherein the first aptamer is capable of specifically binding to a first epitope of a SARS-CoV-2 and the second aptamer is capable of specifically binding to a second epitope of SARS-CoV-2, wherein the first epitope and the second epitope are different.
  • Embodiment 77 Embodiment 77.
  • Embodiment 76 wherein one of the first aptamer or the second aptamer is associated with a first member of a FRET pair and one of the first or the second aptamer is associated with a second member of a first FRET pair, wherein preferably one of the first member and the second member of the FRET pair is a donor molecule and the other of the first member and the second member is an acceptor molecule.
  • Embodiment 78 The method of embodiment 77, wherein one of the first member and the second member of the FRET pair is a fluorophore molecule and the other of the first member and the second member is a quencher molecule.
  • Embodiment 79 Embodiment 79.
  • Embodiment 80 The method of any of embodiments 77 to 79, which comprises a step of: detecting binding of the first aptamer and the second aptamer to a SARS-CoV-2 viral particle, wherein said detection comprises detecting a first fluorescence signal.
  • Embodiment 81 The method of any of embodiments 77 to 79, comprising detecting the loss of quenching as a result of the first aptamer and the second aptamer binding to the SARS-CoV-2 viral particle.
  • Embodiment 82 The method of any of embodiments 76 to 81, wherein one of the first aptamer and the second aptamer is capable of specifically binding to a VSGTNGT epitope of a S1 subunit of the spike protein of SARS-CoV-2.
  • Embodiment 83 The method of any of embodiments 76 to 83, wherein one of the first aptamer and the second aptamer is capable of specifically binding to capable of binding to RSYLTP epitope of a S1 subunit of the spike protein of SARS- CoV-2.
  • Embodiment 84 Embodiment 84.
  • composition comprises a third aptamer which is capable of specifically binding to a third epitope of SARS-CoV-2 and a fourth aptamer which is capable of specifically binding to a fourth epitope of SARS-CoV-2, wherein preferably the third epitope and the fourth epitope are different from the first epitope and the second epitope and from each other.
  • Embodiment 86 is associated with a first member of a second FRET pair and one of the third aptamer or the fourth aptamer is associated with a second member of a second FRET pair, wherein one of the first member and the second member of the second FRET pair is a donor molecule and the other of the first member and the second member is an acceptor molecule and further wherein the second FRET pair is different from the first FRET pair.
  • Embodiment 85 which comprises a step of: detecting binding of the third aptamer and the fourth aptamer to a SARS-CoV-2 viral particle, wherein said detection comprises detecting a second fluorescence signal.
  • Embodiment 87 The method of embodiment 85 comprising detecting the loss of quenching as a result of the third aptamer and the fourth aptamer binding to the SARS-CoV-2 viral particle.
  • Embodiment 88 The method of any of embodiments 84 to 87, wherein one or more of the third aptamer or fourth aptamer is capable of specifically binding to a VSGTNGT epitope of a S1 subunit of the spike protein of SARS-CoV-2.
  • Embodiment 89 The method of any of embodiments 84 to 88, wherein one or more of the third aptamer or the fourth aptamer is capable of specifically binding to capable of binding to SYLTPQ epitope of a S1 subunit of the spike protein of SARS- CoV-2.
  • Embodiment 90 The method of any of embodiments 52 to 89, which comprises: a. contacting the surface with a plurality of aptamers, each aptamer being capable of specifically binding to a different epitope of the SARS-CoV-2 viral particle and b. detecting binding or absence of binding of the plurality of aptamers to SARS- CoV-2.
  • Embodiment 91 Embodiment 91.
  • Embodiment 92 The method of any of embodiments 52 to 91, which comprises a step of: c) contacting the surface with an anti-viral agent.
  • Embodiment 93 The method of any of embodiments 52 to 92, which comprises a step of: c) contacting the location with an anti-viral agent for a period of time sufficient to reduce the concentration of SARS-CoV-2 at the location.
  • Embodiment 94 The method of embodiment 93, which comprises performing step (c) if SARS-CoV-2 is determined to be present.
  • Embodiment 95 The method of any of embodiments 91 to 94, wherein the anti-viral agent is selected from the group consisting of hydrogen peroxide, Peroxyacetic acid; Hydrogen Peroxide, Quaternary ammonium, Sodium hypochlorite, Sodium chlorite, Hypochlorous acid.
  • Embodiment 96 A method of reducing the concentration of SARS-CoV-2 at a location, wherein the method comprises: a) contacting the location with an aptamer as embodied in any of embodiments 19 to 38, or 98, wherein the aptamer is conjugated to an anti-viral agent.
  • Embodiment 97 Embodiment 97.
  • Embodiment 96 which comprises spraying or wiping a surface at the location with a composition comprising the aptamer conjugated to an anti-viral agent.
  • Embodiment 98 The aptamer of embodiments 19 to 38 further comprising a conjugated antiviral agent or radioisotope.
  • Embodiment 99 The composition of embodiments 1 to 18, wherein the aptamer comprises a conjugated antiviral agent or radioisotope.
  • Embodiment 100 In an aspect, the disclosure relates to an aptamer that binds to SARS-CoV-2.
  • the aptamer binds to a SARS-CoV-2 spike (S) protein on a surface of a SARS-CoV-2 virus.
  • the aptamer binds to the SH1 (S1) domain of the spike protein.
  • the aptamer comprises, consists essentially of, or consists of a detectable label.
  • the detectable label may be a fluorescent label.
  • the detectable label may be bound to an oligonucleotide that binds the aptamer.
  • the disclosure relates to an oligonucleotide the binds to an aptamer herein.
  • the disclosure relates to a composition comprising one or more aptamers herein.
  • the disclosure relates to a composition comprising an aptamer that binds to SARS-CoV-2.
  • the disclosure relates to a composition comprising an aptamer that binds to the SH1 (S1) domain of the spike protein of SARS-CoV-2.
  • the composition comprises an aptamer having a fluorescent label.
  • the aptamer further comprises a quencher molecule on at least one of the aptamers or an oligonucleotide with a sequence complimentary to a portion of the aptamer.
  • the aptamer is made by selecting for aptamers that bind to SARS-CoV-2 from a na ⁇ ve DNA aptamer library.
  • the aptamer is made by selecting for aptamers that bind to the S1 domain of the SARS-CoV-2 spike protein from a na ⁇ ve DNA aptamer library. Selecting the aptamer may comprise selecting for aptamers that bind to a recombinant SARS-CoV-2 protein. Selecting the aptamer may comprise selecting for aptamers that bind to an isolated or reconstituted portion of SARS-CoV-2. Selecting the aptamer may comprise selecting for aptamers that bind to recombinant S1-SARS- CoV-2.
  • Embodiments disclosed herein provide methods and products which have utility in the detection of SARS-CoV-2 on surfaces.
  • Embodiments disclosed herein provide the ability to detect the presence of SARS-CoV-2 on such surfaces.
  • a method of detecting the presence, absence and/or concentration of a plurality of viral particles on a surface wherein the viral particle comprises a target molecule and wherein the method comprises: a) contacting a surface suspected having viral particles located thereon with an aptamer which is capable of specifically binding the target molecule; and b) determining the presence, absence and/or concentration of viral particles on the surface.
  • the aptamers as described herein are for use in a method of detecting the presence, absence and/or concentration of SARS-CoV-2 viral particles.
  • the aptamers are for use in detecting the presence, absence and/or concentration of SARS-CoV-2 viral particles located on a surface.
  • the method may involve the direct or indirect contact of a composition comprising the aptamer described herein with the surface. Indirect contact may be via a collecting element which is brought into contact with the surface and subsequently brought into contact with the aptamer.
  • a method of determining the presence, absence and/or concentration of SARS-CoV-2 viral particles in a sample comprising: a) contacting the sample with an aptamer as described herein; wherein the contact is direct or indirect contact; and b) determining the presence, absence and/or concentration of SARS-CoV-2 viral particles in the sample.
  • the step of determining comprises determining whether the aptamer is bound a SARS-CoV-2 viral particle.
  • Embodiment 101 The aptamer of embodiment 101, wherein the aptamer has a specific binding affinity for a spike protein or fragment thereof, wherein the spike protein is on a surface of SARS-CoV-2.
  • Embodiment 103 The aptamer of embodiment 102, wherein the aptamer has a specific binding affinity for the S1 domain of the spike protein or fragment thereof.
  • Embodiment 104 The aptamer of embodiment 101, wherein the aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • Embodiment 105 Embodiment 105.
  • Embodiment 101 wherein the aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • Embodiment 106 The aptamer of embodiment 101, wherein the aptamer comprises a single-stranded DNA aptamer.
  • Embodiment 107 The aptamer of embodiment 101, wherein the aptamer comprises a detectable label.
  • Embodiment 108 Embodiment 108.
  • the detectable label comprises a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non-metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, a liposome, or combination thereof.
  • Embodiment 109 Embodiment 109.
  • Embodiment 110 A composition comprising at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein or fragment thereof.
  • Embodiment 111 A composition comprising at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein or fragment thereof.
  • composition of embodiment 110 wherein the at least one aptamer has a specific binding affinity for a spike protein or fragment thereof, wherein the spike protein is on a surface of SARS-CoV-2.
  • Embodiment 112. The composition of embodiment 111, wherein at least one aptamer has a specific binding affinity for the S1 domain of the spike protein or fragment thereof.
  • Embodiment 113. The composition of embodiment 110, wherein the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • Embodiment 114 Embodiment 114.
  • composition of embodiment 110 wherein the at least one aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • Embodiment 115 The composition of embodiment 110, wherein the at least one aptamer comprises a single-stranded DNA aptamer.
  • Embodiment 116 The composition of embodiment 110, wherein the at least one aptamer comprises a detectable label.
  • Embodiment 117 The composition of embodiment 110 or embodiment 16, further comprising graphene oxide (GO).
  • Embodiment 118 Embodiment 118.
  • the detectable label comprises a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non-metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, a liposome, or combination thereof.
  • Embodiment 119 Embodiment 119.
  • composition of embodiment 112 wherein the aptamer has a specific binding affinity for insert region 1 (VSGTNGT , SEQ ID NO: 16), insert region 2 (KSWM, SEQ ID NO: 17), insert region 3 (RSYLTP SEQ ID NO: 18), or insert region 4 (SPRR SEQ ID NO: 19) of the S1 domain of spike protein.
  • Embodiment 120 The composition of embodiment 110 comprising two or more aptamers having a specific binding affinity for two or more different epitopes of a S1 subunit of the spike protein of SARS-CoV-2, wherein the two or more aptamers have a different nucleotide sequence.
  • Embodiment 121 Embodiment 121.
  • a method of visualizing SARS-CoV-2 on a surface comprising: [0483] contacting a surface with at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein, wherein the SARS-CoV-2 protein comprises an S1 domain of the spike protein on a surface of SARS-CoV-2 or fragment thereof; and [0484] visualizing the presence or absence of SARS-CoV-2 on the surface.
  • Embodiment 122 The method of embodiment 121, wherein the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15 [0486] Embodiment 123.
  • Embodiment 124 The method of embodiment 121, wherein the aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
  • Embodiment 124 The method of embodiment 121, wherein the aptamer is conjugated to a detectable moiety thereby forming an aptamer conjugate.
  • Embodiment 125 The method of embodiment 124, wherein the detectable moiety is a fluorophore.
  • Embodiment 126 The method of embodiment 125, wherein the fluorophore emits at a wavelength of between about 500 nm and 510 nm.
  • Embodiment 127 The method of embodiment 124, further comprising illuminating the surface with a light source.
  • Embodiment 128 The method of embodiment 127, wherein light from the light source has a predetermined wavelength, and the predetermined wavelength corresponds to a wavelength of light emitted by the detectable moiety of the aptamer conjugate.
  • Embodiment 129 The method of embodiment 127, wherein the light source is configured to produce light at a wavelength of between about 485 nm and 515 nm.
  • Embodiment 130 The method of embodiment 127, further comprising filtering the light produced by the light source.
  • Embodiment 131 Embodiment 131.
  • Embodiment 127 comprising passing the light produced from the light source through a bandpass filter.
  • Embodiment 132 The method of embodiment 130, further comprising photographing a location on the surface, and detecting the presence or absence of the conjugated aptamer bound to SARS-CoV-2.
  • Embodiment 133 Embodiment 133.
  • a method of visualizing SARS-CoV-2 on a surface comprising: [0497] contacting a surface with a composition comprising at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein, wherein the SARS-CoV- 2 protein comprises an S1 domain of the spike protein on a surface of SARS-CoV-2 or fragment thereof; and [0498] visualizing the presence or absence of SARS-CoV-2 on the surface.
  • Embodiment 134 The method of embodiment 133, wherein the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15, [0500] Embodiment 135.
  • Embodiment 133 wherein the composition comprises two or more different aptamers.
  • Embodiment 136 The method of embodiment 133, wherein the at least one aptamer comprises a detectable label.
  • Embodiment 137 The method of embodiment 133, wherein the detectable label is a fluorescent label.
  • Embodiment 138 The method of embodiment 133, wherein the fluorescent label is quenchable by a quencher.
  • Embodiment 139 Embodiment 139.
  • composition further comprising an antisense nucleic acid comprising a quencher, wherein the an antisense nucleic acid is complementary to a sequence of the at least one aptamer, wherein the antisense nucleic acid is bound to the at least one aptamer when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof and wherein the antisense nucleic acid is not bound to the at least one aptamer when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof.
  • Embodiment 140 Embodiment 140.
  • the at least one aptamer comprises the quencher, wherein the quencher is proximal to the fluorescent label such that fluorescence is quenched when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof, and wherein the quencher is distal to the fluorescent label such that fluorescence is not quenched when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof.
  • Embodiment 141 Embodiment 141.
  • Embodiment 142 The method of embodiment 138, further comprising measuring a FRET signal between the quencher molecule and the fluorescent label.
  • Embodiment 143 The method of embodiment 137, wherein the composition further comprises graphene oxide.
  • Embodiment 144 The method of embodiment 133, wherein the surface is an organic or inorganic surface.
  • Embodiment 145 The method of embodiment 145.
  • a method of detecting the presence or absence of SARS- CoV-2 comprising: providing one or more aptamers conjugated to a detectable moiety, wherein the one or more aptamers have a specific binding affinity for a SARS-CoV-2 protein or fragment thereof, combining the one or more aptamers with graphene oxide, contacting the aptamer-graphene oxide combination with a sample to be tested; and visualizing the detectable moiety of the aptamer conjugate bound to a SARS- CoV-2 protein.
  • Embodiment 146 The method of embodiment 145, wherein the detectable moiety is a fluorescent label.
  • Embodiment 147 Embodiment 147.
  • Embodiment 148 The method of embodiments 145-147, wherein the graphene oxide is in the form of nanoparticles.
  • Embodiment 149 The method of embodiment 148, wherein the fluorescence of the fluorescent label is quenched by the association with the graphene oxide nanoparticle surface.
  • FIG. 7B shows the selection process used for selection rounds 6 to 8.
  • Libraries from selection rounds 4 to 8 inclusive were prepared for next generation sequencing.
  • the preparation process involved an amplification of an aliquot from each library first with primers that insert a unique hex code onto each library and subsequently with primers that reconstitute flanking universal primers for sequencing.
  • the amplified libraries were purified on a 20% acrylamide gel and pooled in one tube such that each library was equally represented.
  • the pool of libraries was submitted to The Centre for Applied Genomics (TCAG) at The Hospital for Sick Children (Toronto) for next generation sequencing (NGS) on an Illumina HiSeq instrument. Reads were 120 nucleotides, one way.
  • FIG. 8 provides an overview of the enrichment trajectories of the top twenty-two sequences analysed. Most of the sequences observed in selection round 9 were not observed in the NGS analysis of previous selection rounds. The sequences were present but at a frequency that was missed by the sub-sampling implicit in the NGS analysis process. The sequences COV19-1 and COV19-3 were observed in selection rounds 6 and 7. These were joined by observation of COV19-2, COV19-5, COV-19-18, and COV-19-22 in selection round 7. The enrichment rates between the selection for SARS-CoV-2 S1 and SARS-CoV S1 proteins in selection round 8 were also compared.
  • Each aptamer was spotted onto a gold surface at a concentration of 5 ⁇ M and a volume of 10 nL, the gold surface serving to reduce the disulphides to thiols, and then oxidize the thiols in a strong metal bond directly to the gold. The remainder of the surface was blocked with thiolylated PEG molecules.
  • Two negative control aptamers were also applied to the surface, each in triplicate, in an identical manner.
  • a solution containing the S1 proteins from SARS-CoV-2 and SARS-CoV were injected over the surface (also referred herein as chip) at various concentrations in a volume of 200 ⁇ L, and a flow rate of 50 ⁇ L/min.
  • the estimated kd value was then used to solve the association rate value, ka through the use of the following formula: x’ ⁇ ka*Rmax*c-(ka*c+kd)*x where x and x’ refer to the observed and the derivative of the observed resonance due to binding values for the association curves.
  • x and x refer to the observed and the derivative of the observed resonance due to binding values for the association curves.
  • the aptamers exhibited strong initial binding to the SARS-CoV S1 protein but all the aptamers including the negative aptamers (aptamers of the same length that were not selected for binding to any SARS target) also released it rapidly.
  • Cov19-1, Cov19-6 and Cov19-13 continued to exhibit strong binding behaviour to the SARS-CoV-2 S1 protein even at as low a concentration as 25 nM, while again no binding was observed against SARS-CoV S1 protein.
  • the estimated binding coefficients for Cov19-1, Cov19-6, and Cov19-13 can be found in Table 5. For example, Cov19-1 displayed a Kd of 7.44 x 10 -9 M, Cov19-6 displayed a Kd of 8.05 x 10 -9 M, and Cov19-13 displayed a Kd of 8.39 x 10 -9 M.
  • Example 3 Binding Analysis of Select Aptamers [0533] Due to the higher resonance observed in Example 2 with the SARS-CoV S1 protein relative to the SARS-CoV-2 S1 protein, glycerol was removed from the SARS- CoV S1 protein solution with the use of 3 kDa spin columns. The resulting material was re-injected across the same aptamer/SPRi chip described in Example 2. Of note, the SARS-CoV-2 S1 protein did not contain any glycerol. As a result, almost all resonance was lost. To ensure that protein was not lost, the concentration of protein was examined at a wavelength of 280 nm with an extinction coefficient derived from the amino acid sequence for this protein.
  • the estimated protein concentration was slightly higher than 250 nM for this injection. No binding was observed to the SARS- CoV S1 protein. The process was repeated at 500 nM SARS-CoV S1 protein resulting in the same result. Further, the analysis was repeated with SARS-CoV-2 S1 protein to ensure that this lack of observed binding was still relevant.
  • the estimated binding coefficients for Cov19-1, Cov19-6, and Cov19-13 shown at Table 6, have similar values to the ones estimated previously with 100 nM SARS-CoV-2 S1 protein. For example, Cov19-1 displayed a Kd of 1.15 x 10 -8 M, Cov19-6 displayed a Kd of 1.36 x 10 -8 M, and Cov19-13 displayed a Kd of 9.50 x 10 -9 M.
  • the predicted aptamer shapes for Cov19-1.1 and Cov19-1.2 are shown in FIG.11.
  • the original aptamer sequence for Cov19-5 having SEQ ID NO: 7 was used.
  • the aptamer has the capacity to form many different shapes at room temperature with slight variations in free energy ( ⁇ G) as shown, for example, in FIG.12. Aptamers were designed to reduce the variation in shape and to decrease the overall length of the aptamer.
  • the predicted aptamer shape for Cov19-5.1 (SEQ ID NO: 13), is shown in FIG.12.
  • the original aptamer sequence for Cov19-6 having SEQ ID NO: 8 was used.
  • the aptamer has the capacity to form many different shapes at room temperature with slight variations in free energy ( ⁇ G) as shown, for example, in FIG.13. Aptamers were designed to reduce the variation in shape and to decrease the overall length of the aptamer.
  • the predicted aptamer shape for Cov19-6.1 (SEQ ID NO: 14), is shown in FIG.14. [0538] The original aptamer sequence for Cov19-13 having SEQ ID NO: 9 was used.
  • the aptamer has the capacity to form many different shapes at room temperature with slight variations in free energy ( ⁇ G) as shown, for example, in FIG. 15. Aptamers were designed to reduce the variation in shape and to decrease the overall length of the aptamer.
  • the predicted aptamer shape for Cov19-13.1 (SEQ ID NO: 15), is shown in FIG.15.
  • Example 5 Binding Analysis of Optimized Aptamers [0539] The binding affinity for the optimized aptamers were determined and compared to the original aptamer as shown in Table 7. For example, Cov19-1 displayed a Kd of 3.03 x 10 -8 M, Cov19-5 displayed a Kd of 3.39 x 10 -8 M, Cov19-6 displayed a Kd of 3.21 x 10 -8 M, and Cov19-13 displayed a Kd of 3.40 x 10 -8 M.
  • Cov19-1.2 displayed a Kd of 4.05 x 10 -8 M
  • Cov19-5.1 displayed a Kd of 2.97 x 10 -8 M
  • Cov19-6.1 displayed a Kd of 2.80 x 10 -8 M
  • Cov19-13.1 displayed a Kd of 3.85 x 10 -8 M.
  • the optimized aptamers CoV19-5.1 and CoV19-6.1 provided improved binding affinity over the aptamers CoV19-5 and CoV19-6, respectively.
  • Table 7 Binding Affinity for Optimized Aptamers
  • Example 6 Application of Aptamer Cov19-5.1 to Live Virus
  • the experiments used three virus concentrations: 1 x 10 5.8 TCID50 virus/mL, 0.1 x, 0.01 x, and no virus as negative control, targeting total volume in microtiter plate well of 80 ⁇ L (assays were performed in cell media).
  • Example 7 Direct Detection on Surface [0541] Heat inactivated SARS-CoV-2 virus and vesicular stomatitis virus (VSV) were applied to a stainless-steel surface with a cell spreader. Full strength refers to 10 5.8 TCID50 for both viruses. As used herein TCID50 refers to median tissue culture infectious dose/mL. A 1 ⁇ M concentration of CoV19-5.1 aptamer having a Fam label was equilibrated with 25 ng/ ⁇ L of graphene oxide (GO), overnight. This solution was sprayed onto the surface borne virus with a hand-held sprayer, such that a confluent surface was formed (film). The media used for the viruses exhibited an orange auto- fluorescence.
  • GO graphene oxide
  • Step 1 Adherence of virus particles to surface
  • Liquid suspensions comprising the viral particles was used as the virus stock solutions.
  • the surface of a stainless-steel bench was cleaned and disinfected.
  • the virus stock solution was loaded onto the stainless-steel bench.
  • Using a cell spreader the solution was spread on the surface of the stainless-steel bench to ensure even drying of the solution.
  • the solution was then allowed to dry on the surface of the stainless-steel bench, by incubating it overnight ( ⁇ 12 h) at RT.
  • Step 2 Set up video recording equipment [0545]
  • a camera as described below was used to capture images along with a special flashlight (505 nm) and protective goggles. Both the camera and special flashlight were mounted on tripods.
  • FIG. 17 illustrates positioning of the camera and special flashlight relative to the spots on the surface.
  • the power switch was turned to “Record” and the Manual Focus switch on the lens was turned to “MF”.
  • the small ring was used to focus the camera on the field, with the lens zoomed in fully (completely extended from the camera). Recording was started and ended by pressing the Record button.
  • the camera was set for optimal video through the Menu settings, selecting “Movie rec. size” to “FHD 59.94P IP8”.
  • a polarization filter (Filter ONE circular polarizing filter, Hoya) was installed in front of the camera lens.
  • BP590 bandpass filter MidOpt
  • the polarizing filter contained two rings, one to tighten the filter, and one to rotate the filter.
  • the camera and light source were set up as follows. The maximum field of vision was 9 cm x 9 cm with the optimal area being no larger than 5 cm x 5 cm as indicated by the blue square in the picture. The orange safety eye shields were in place before turning on the light source, then the light was turned on by rotating the ring in the direction of the arrow and released. The light source was turned off by turning the ring in the same direction and released. The battery was returned to the camera as soon as possible after it finished charging so that the pre-set recording settings were not lost.
  • Step 3 Visualization
  • a mark was made on the surface with a sharpie and the camera was focused on that mark. Video recording began and then the solutions were applied to the spots. The room was not dark, but the lights were dimmed.
  • the aptamer/graphene oxide (GO) formulation used was 1 ⁇ M aptamer + 25 ng/ ⁇ L GO, in water, which was loaded onto the stainless-steel bench with a spray bottle/assembly. The sprayer was primed, with at least 3 full pumps by squeezing the trigger all the way in until the spray was complete, with no sputtering. At this point, the spray assembly was held approximately 40 cm away from the region on the intended surface.
  • the solution was sprayed by squeezing the trigger roughly “halfway” to allow the solution to come out as droplets and cover the intended region on the surface including the area where the virus-containing solution was dried.
  • the goggles were employed and the flashlight was turned on (505 nm wavelength).
  • Data acquisition was obtained by recording the video on the camera and capturing the subsequent images. The signal emanating from the region of the steel bench, where virus-containing solution was present was observed, and was compared to the region with no virus-containing solution. After five minutes, the flashlight was turned off, then switched back on when 20 minutes had elapsed since the aptamer + GO was applied onto the spots. The samples were then observed and then the flashlight was switched off.
  • the flashlight was turned on again and the samples were observed, and then the flashlight was switched off.
  • the virus spots on the stainless-steel surface were visualized with the camera and flashlight apparatus immediately prior to the application of the aptamer + GO formulation.
  • the media used for the viruses exhibited an orange auto-fluorescence.
  • the fluorescence changed to green (FIG.19).

Abstract

Aptamers capable of specifically binding to a SARS-CoV-2 protein and compositions comprising the aptamers are provided.

Description

APTAMERS AGAINST SARS-CoV-2, COMPOSITIONS COMPRISING APTAMERS AGAINST SARS-CoV-2 AND METHODS OF USING THE SAME RELATED APPLICATIONS [0001] This application claims the benefit of and the priority to U.S. Provisional Application Serial Number 63/002,270, filed March 30, 2020 and U.S. Provisional Application Serial Number 63/120,903, filed December 3, 2020, the entire disclosure of each of which is incorporated herein by reference in their entireties. SEQUENCE LISTING [0002] The instant application contains a Sequence Listing, submitted herewith which includes the file 193519-010202_ST25.txt having the following size 22,787 bytes, which was created on March 25, 2021, the contents of which are hereby incorporated by reference herein. FIELD [0003] Embodiments of the present disclosure relate to aptamers that specifically bind to spike proteins on the surface of the SARS-CoV-2 pathogen, and methods of using the same. Embodiments of the disclosure relate to methods of detecting the presence of SARS-CoV-2 pathogen on a surface. BACKGROUND [0004] SARS-CoV-2 is a member of the coronavirus family of pathogens. Coronaviruses (CoVs) are the largest group of viruses belonging to the Nidovirales order. These viruses cause a variety of diseases in animals, including intestinal and respiratory infections. Coronaviruses can also infect across species barriers causing such respiratory illness in human. These infections were thought to cause only mild respiratory symptoms in humans until the SARS (Severe Acute Respiratory Syndrome)-CoV outbreak of 2002-2003, which led to severe respiratory disease in many infected individuals. More recently, SARS-CoV-2 has emerged as the pathogen responsible for the COVID-19 pandemic of 2020-21, which has led to 1.47 million deaths worldwide (as of Nov. 30, 2020). While it is understood that the principal method of transmission of SARS-CoV-2 viral particles is through direct human to human transmission e.g. through expulsion of viral particles through a sneeze or a cough, transmission can also occur through contact with a surface on which viral particles are present. As such, being able to identify SARS-CoV-2 on surfaces may help reduce spread of the virus, that is, detected virus may be avoided or targeted for destruction. SARS-CoV-2 remains a significant healthcare issue. Therefore, there is an urgent need for the rapid identification of the presence of SARS-CoV-2. SUMMARY [0005] In some embodiments, is provided an aptamer having a specific binding affinity for a surface protein of a SARS-CoV-2 virus particle or fragment thereof. In some embodiments, the aptamer has a specific binding affinity for a spike protein or fragment thereof, wherein the spike protein is on a surface of SARS-CoV-2. In some embodiments, the aptamer has a specific binding affinity for the S1 domain of the spike protein or fragment thereof. In some embodiments, the aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. In some embodiments, the aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. In some embodiments, the aptamer comprises a single- stranded DNA aptamer. [0006] In some embodiments, the aptamer comprises a detectable label. In some embodiments, the detectable label comprises a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non- metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, a liposome, or combination thereof. [0007] In some embodiments, the aptamer has a specific binding affinity for insert region 1 (VSGTNGT, SEQ ID NO: 16), insert region 2 (KSWM, SEQ ID NO: 17), insert region 3 (RSYLTP, SEQ ID NO: 18), or insert region 4 (SPRR SEQ ID NO: 19) of the S1 domain of spike protein. [0008] In some embodiments, is provided a composition comprising at least one aptamer having a specific binding affinity for a surface protein of a SARS-CoV-2 virus particle or fragment thereof. In some embodiments, the at least one aptamer has a specific binding affinity for a spike protein or fragment thereof, wherein the spike protein is on a surface of SARS-CoV-2. In some embodiments, the at least one aptamer has a specific binding affinity for the S1 domain of the spike protein or fragment thereof. In some embodiments, the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. In some embodiments, the at least one aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. In some embodiments, the at least one aptamer comprises a single-stranded DNA aptamer. [0009] In some embodiments, the at least one aptamer comprises a detectable label. In some embodiments, the composition further comprises graphene oxide (GO). In some embodiments, the detectable label comprises a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non- metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, a liposome, or combination thereof. [0010] In some embodiments, the aptamer has a specific binding affinity for insert region 1 (VSGTNGT , SEQ ID NO: 16), insert region 2 (KSWM, SEQ ID NO: 17), insert region 3 (RSYLTP SEQ ID NO: 18), or insert region 4 (SPRR SEQ ID NO: 19) of the S1 domain of spike protein. [0011] In some embodiments, is provided a composition comprising two or more aptamers having a specific binding affinity for two or more different epitopes of a S1 subunit of the spike protein of SARS-CoV-2, wherein the two or more aptamers have a different nucleotide sequence. [0012] In some embodiments, is provided a method of visualizing a SARS-CoV-2 virus particle on a surface, comprising: contacting a surface with at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein, wherein the SARS-CoV- 2 protein comprises an S1 domain of the spike protein on a surface of SARS-CoV-2 or fragment thereof; and visualizing the presence or absence of the SARS-CoV-2 virus particle on the surface. [0013] In some embodiments, the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. In some embodiments, the aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. In some embodiments, the aptamer is conjugated to a detectable moiety thereby forming an aptamer conjugate. In some embodiments, the detectable moiety is a fluorophore. In some embodiments, the fluorophore emits at a wavelength of between about 500 nm and 510 nm. [0014] In some embodiments, the method further comprises illuminating the surface with a light source. In some embodiments, the light source has a predetermined wavelength, and the predetermined wavelength corresponds to a wavelength of light emitted by the detectable moiety of the aptamer conjugate. In some embodiments, the light source is configured to produce light at a wavelength of between about 485 nm and 515 nm. [0015] In some embodiments, the method further comprises filtering the light produced by the light source. In some embodiments, the method further comprises passing the light produced from the light source through a bandpass filter. In some embodiments, the method further comprises photographing a location on the surface and detecting the presence or absence of the conjugated aptamer bound to SARS- CoV-2. [0016] In some embodiments, is provided a method of visualizing a SARS-CoV-2 virus particle on a surface, comprising: contacting a surface with a composition comprising at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein, wherein the SARS-CoV-2 protein comprises an S1 domain of the spike protein on a surface of SARS-CoV-2 or fragment thereof; and visualizing the presence or absence of the SARS-CoV-2 virus particle on the surface. In some embodiments, the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. In some embodiments, the composition comprises two or more different aptamers. [0017] In some embodiments, the at least one aptamer comprises a detectable label. In some embodiments, the detectable label is a fluorescent label. In some embodiments, the fluorescent label is quenchable by a quencher. [0018] In some embodiments, the composition further comprising an antisense nucleic acid comprising a quencher, wherein the an antisense nucleic acid is complementary to a sequence of the at least one aptamer, wherein the antisense nucleic acid is bound to the at least one aptamer when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof and wherein the antisense nucleic acid is not bound to the at least one aptamer when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof. [0019] In some embodiments, the at least one aptamer comprises the quencher, wherein the quencher is proximal to the fluorescent label such that fluorescence is quenched when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof, and wherein the quencher is distal to the fluorescent label such that fluorescence is not quenched when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof. [0020] In some embodiments, the at least one aptamer is not bound to the SARS- CoV-2 protein or fragment thereof, the fluorescent label is quenched, and wherein, when the aptamer the SARS-CoV-2 protein or fragment thereof, the fluorescent label is not quenched. [0021] In some embodiments, the method further comprises measuring a FRET signal between the quencher molecule and the fluorescent label. [0022] In some embodiments, the composition further comprises graphene oxide. [0023] In some embodiments, the surface is an organic or inorganic surface. [0024] In some embodiments, is provided a method of detecting the presence or absence of SARS-CoV-2 comprising: providing one or more aptamers conjugated to a detectable moiety, wherein the one or more aptamers have a specific binding affinity for a SARS-CoV-2 protein or fragment thereof, combining the one or more aptamers with graphene oxide, contacting the aptamer-graphene oxide combination with a sample to be tested; and visualizing the detectable moiety of the aptamer conjugate bound to a SARS-CoV-2 protein. [0025] In some embodiments, the detectable moiety is a fluorescent label. In some embodiments, the one or more aptamers comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. In some embodiments, the graphene oxide is in the form of nanoparticles. In some embodiments, the fluorescence of the fluorescent label is quenched by the association with the graphene oxide nanoparticle surface. BRIEF DESCRIPTION OF THE DRAWINGS [0026] The following detailed description of the embodiments of the present disclosure will be better understood when read in conjunction with the appended drawings. For the purposes of illustration, there are shown in the drawings, embodiments. It is understood, however, that the disclosure is not limited to the precise arrangements shown. In the drawings: [0027] FIG.1A shows a schematic aptamer of the naïve aptamer library; [0028] FIG.1B shows a selection process for developing a single stranded aptamer; [0029] FIG.2A shows the functional subunits of the SARS-CoV S protein; [0030] FIG.2B shows the SARS-CoV S protein highlighting epitope differences in the receptor binding motif (illustrated in the darkened portion on the top) between SARS-CoV-2 and SARS-CoV; [0031] FIG. 2C shows a top view of the SARS-CoV S protein of FIG. 2B with the receptor binding motif illustrated in the darkened portion; [0032] FIG.3 shows a model aptamer selection process; [0033] FIG. 4A shows a protein model of a 3-dimensional structure of the S1 domain of SARS-CoV-2 spike protein highlighting regions of primary epitope difference between SARS-CoV-2 and SARS-CoV S1 protein; [0034] FIG.4B shows a magnified perspective of the physical relationship between two amino acid motifs present in the S1 domain of SARS-CoV-2 spike protein and absent in the S1 domain of SARS-CoV spike protein; [0035] FIG. 5 shows a graphical representation plotting the effect of different concentrations of antisense strand in the presence and in the absence of target protein; [0036] FIG. 6 shows the proportional difference in fluorescence between the presence and absence of target as a function of antisense strand concentration; [0037] FIG.7A shows an aptamer selection process for selection rounds 1-6; [0038] FIG.7B shows an aptamer selection process for selection rounds 6-8; [0039] FIG.8 provides an overview of the enrichment trajectories of the top twenty sequences analysed in selection round 8 for SARS-CoV-2 S1 protein displayed as frequency of sequence (selection round 6; selection round 7); [0040] FIG.9 provides a comparison of the enrichment rates between the selection for SARS-CoV-2 S1 and SARS-CoV S1 proteins in selection round 8 displayed as frequency of sequence; [0041] FIG.10 shows the predicted aptamer shapes for Cov19-1 (SEQ ID NO: 3); [0042] FIG. 11 shows the predicted aptamer shapes for Cov19-1 (SEQ ID NO: 3) and Cov19-1.2 (SEQ ID NO: 12); [0043] FIG. 12 shows the predicted aptamer shapes for Cov19-5 (SEQ ID NO: 7) and Cov19-5.1 (SEQ ID NO: 13); [0044] FIG.13 shows the predicted aptamer shapes for Cov19-6 (SEQ ID NO: 8); [0045] FIG.14 shows the predicted aptamer shape for Cov19-6.1 (SEQ ID NO: 14); [0046] FIG. 15 shows the predicted aptamer shapes for Cov19-13 (SEQ ID NO: 9) and Cov19-13.1 (SEQ ID NO: 15); [0047] FIG.16 is a bar graph showing the apparent percent of aptamer bound for different concentration titrates of live virus binding to aptamer Cov19-5.1; [0048] FIG. 17 illustrates the positioning of the camera and special flashlight relative to the spots on the surface; [0049] FIG. 18 is a photograph showing the virus spots on the stainless-steel surface as visualized with the camera and flashlight apparatus immediately prior to the application of the Aptamer + graphene oxide (GO) formulation; [0050] FIG. 19 is a photograph showing the virus spots on the stainless-steel surface as visualized with the camera and flashlight apparatus immediately after the application of the Aptamer + GO formulation; and [0051] FIG. 20 is a photograph showing the virus spots on the stainless-steel surface as visualized with the camera and flashlight apparatus 24 minutes after the application of the Aptamer + GO formulation. DETAILED DESCRIPTION [0052] Certain terminology is used in the following description for convenience only and is not limiting. The phrase “at least one” followed by a list of two or more items such as A, B, or C, means any individual one of A, B, or C as well as any combination thereof. Terms such as “approximately,” “about,” “substantially” are construed as modifying terms defined by the circumstances in which they are used. If otherwise undefined, the degree of modification includes the degree of expected experimental error. [0053] Most general molecular biology, microbiology recombinant DNA technology and immunological techniques can be found in Sambrook et al., Molecular Cloning, A Laboratory Manual (2001) Cold Harbor-Laboratory Press, Cold Spring Harbor, N.Y. or Ausubel et al., Current protocols in molecular biology (1990) John Wiley and Sons, N.Y. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., Academic Press; and the Oxford University Press, provide a person skilled in the art with a general dictionary of many of the terms used in this disclosure. [0054] Units, prefixes and symbols are denoted in their Système International d’ Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation. Unless otherwise indicated, nucleic acid sequences are written left to right in 5’ to 3’ orientation. SARS-CoV-2 [0055] SARS-CoV-2 is a member of the coronavirus family of pathogens. Coronaviruses (CoVs) are the largest group of viruses belonging to the Nidovirales order. These viruses cause a variety of diseases in animals, including intestinal and respiratory infections. Coronaviruses can also infect across species barriers causing such respiratory illness in human. However, these infections were thought to cause only mild respiratory symptoms in humans until the SARS (Severe Acute Respiratory Syndrome)-CoV outbreak of 2002-2003, which led to severe respiratory disease in many of infected individuals. [0056] Within the coronavirus family, at least 6 members have been shown to transmit within humans: HCoV-OC43, HCoV-HKU1, HCoV-NL63, HCoV-229E, SARS-CoV, and MERS (Middle East Respiratory Syndrome)-CoV, responsible for the epidemic that emerged in the Middle East in 2012. The former four of this family are responsible for causing an estimated 15% to 30% of respiratory tract infections each year, while the latter two of this family demonstrated more severe respiratory disease. SARS-CoV-2 is a pathogen responsible for severe respiratory disease outbreaks. [0057] Coronaviruses comprise a non-segmented, positive-sense RNA genome of approximately 30 kb. The organization of the genome of coronaviruses from the 5’ end to the 3’ end is as follows: 5’-leader-untranslated region (UTR); replicase; S (Spike); E (Envelope); M (membrane); N (Nucleocapsid); and the 3’ UTR-poly (A) tail. The four structural proteins are spike (S) protein, envelope (E) protein, membrane protein (M), and nucleocapsid (N) protein. [0058] SARS-CoV-2, like other coronaviruses is a single-positive-stranded RNA virus whose genome contains 29891 nucleotides, corresponding to 9860 amino acids. Although not certain, genomic analysis suggest that SARS-CoV-2 may have evolved from a strain of coronavirus found in bats. Evidence to support this includes the fact that SARS‐CoV‐2 shares 88% sequence identity to two coronaviruses found in bats, bat‐SL-CoVZC45 and bat‐SL‐CoVZXC21. [0059] Further, evidence demonstrates that both SARS-CoV and MERS-CoV originated from bats as well. A large number of Chinese horseshoe bats contain sequences of SARS-related CoVs, as well as serologic evidence for a prior infection with a related CoVs, and serologic studies of dromedary camels, the probable intermediary between bats and humans, demonstrated MERS-CoV antibodies in these camels in areas where both infection of humans and camels occurred. SARS- CoV-2 also shares 79% sequence identity with SARS-CoV and 50% sequence identity with MERS-CoV. [0060] Regarding the individual domains of SARS-CoV-2, the nucleocapsid (N) protein portion has nearly 90% amino acid sequence identity with SARS-CoV. However, the N protein antibodies of SARS-CoV, although they may cross react with SARS-CoV-2, they do not provide cross-immunity. [0061] The spike (S) protein of coronaviruses is a large type 1 transmembrane protein, which is highly glycosylated, containing 21 to 35 N-glycosylation sites. Although the S protein of SARS-CoV-2 has a higher sequence identity with the S protein of SARS-CoV compared with the S protein of MERS CoV, the amino acid sequence of SARS-CoV-2 differs from other coronaviruses specifically in the regions of 1ab polyprotein and the surface glycoprotein or S-protein. [0062] All coronavirus S proteins share the same organization in two domains. An N-terminal domain called S1 which is responsible for receptor binding, and a C- terminal S2 domain, which is responsible for membrane fusion of the virus with a target cell. Diversity among coronaviruses is often reflected in the variable S proteins, which have evolved into forms that differ in their ability to interact with receptors on target cells and in their response to various environmental stimuli of virus-target cell membrane fusion. Between the S1 and S2 domain, the S2 domain is most conserved among coronaviruses. In contrast, the S1 domain diverges in sequence even among species of a single coronavirus. Within the S1 domain are an N-terminal domain and a C-terminal domain, both which function as receptor binding domains. [0063] Structural depictions of the SARS-CoV S protein can be found in FIGs.2A- 2C. For example, FIG.2A shows the functional subunits of the SARS-CoV S protein, FIG. 2B shows the SARS-CoV S protein highlighting epitope differences in the receptor binding motif (illustrated in the darkened portion on the top) between SARS- CoV-2 and SARS-CoV, and FIG. 2C shows a top view of the SARS-CoV S protein of FIG.2B with the receptor binding motif illustrated in the darkened portion. [0064] The S1 domain of coronaviruses may recognize different receptors on target cells. For example, SARS-CoV recognizes and interacts with angiotensin converting enzyme (ACE2), which is expressed in human airway epithelia, as well as lung parenchyma. In contrast, MERS-CoV recognizes and interacts with dipeptidyl peptidase 4 (DPP4) on target cells, while other coronaviruses interact with aminopeptidase (APN). Recent data suggest that SARS-CoV-2 interacts with and uses the ACE2 receptor for entry, and the cellular serine protease TMPRSS2 for S protein priming. Although not proven as of yet, furin may also play a role in precleavage at the S1/S2 site infected cells. [0065] The nature of the contours on the SARS-CoV-2 spike glycoproteins allow the virus to stick more strongly to the surface of target cells than previous coronaviruses, including the ones responsible for SARS-CoV and MERS-CoV. This may aid, at least in part, the transmission of SARS-CoV-2; less virus may be needed to infect a person if the bond between viral protein and target cells is tighter. [0066] SARS-CoV-2, like other members of the coronavirus family, has a crown- like appearance under an electron microscope due to the presence of spike (S) proteins, which assemble into trimers on the virus’ surface. These trimers form a distinctive crown-like, or “corona”-like appearance. SARS-CoV-2 has a round or elliptical form and has a diameter of approximately 60 nM – 140 nM. [0067] Another feature of the spikes of coronaviruses is that each spike is formed by the connected S1 and S2 domains described above, and the spike activates and allows for the virus to enter a target cell only once these domains are cleaved. The separation of these domains from one another in SARS-CoV was more difficult compared with those of SARS-CoV-2. Also, the SARS-CoV-2 spike proteins may have a furin-like cleavage site, similar to MERS-CoV, making SARS-CoV-2 spike proteins readily cut by the enzyme furin, which is expressed in human organs such as liver, small intestines, and lungs, meaning that the virus can potentially attack several organs at once. [0068] In certain circumstances, viral transmission may be via direct person-to- person contact or via contact with a surface on which viral particles are located. For example, it is understood that whilst the principal method of transmission of SARS- CoV-2 viral particles (the virus that causes COVID-19) is through direct human to human transmission, e.g. through expulsion of viral particles through a sneeze or a cough, it is also considered that transmission can occur through contact with a surface on which viral particles are present. Recent studies have shown that SARS- CoV-2 particles remain viable for extended periods of time on surfaces composed on certain materials (see for example NEJM, March 17, 2020, Letters to Editors, Van Doremalen et al.). [0069] This study concluded that the longest viability of SARS-CoV-2 was on stainless steel and plastic with the estimated median half-life of SARS-CoV-2 was approximately 5.6 hours on stainless steel and 6.8 hours on plastic. Thus, in order to minimize the spread of SARS-CoV-2 via fomite transmission, it is important to know if a surface is contaminated with SARS-CoV-2 and, if so, disinfect the surface to kill the viral particles. Particularly, although not exclusively, it may be advantageous to determine viral load in a total environmental surface area rather than small sampled surfaces as this would facilitate proper use of cleaning and disinfection targeted to hot spot areas. [0070] Being able to identify/visualize SARS-CoV-2 on surfaces may help reduce spread of the virus. Detected virus may be avoided or targeted for destruction. [0071] SARS-CoV-2’s ability to survive on surfaces varies; however, it is not thought to last for extended periods of time. For example, SARS-CoV-2 may rest intact for approximately one day on cardboard and about two-three days on steel and plastic surfaces. [0072] Because each SARS-CoV-2 particle is enclosed by a sphere of lipid molecules, they can be disrupted by common disinfectants and detergents. Washing these surfaces, including skin, is effective at disrupting the lipid coat of SARS-CoV- 2, and killing it. [0073] Current measures for curbing transmission of SARS-CoV-2 include: identifying patients with severe acute respiratory infections at first point of contact to minimise exposure to others; use of personal protection equipment (PPE) to avoid direct contact with patient’s secretions or bodily fluids; good hand hygiene, including cleaning hands with soap and water or an alcohol-based hand rub to prevent SARS- CoV-2 from being passed from one person to another; carefully cleaning hospital rooms and medical equipment that have been used for patients with SARS-CoV-2; using contact precautions to prevent SARS-CoV-2 from spreading to others; maintaining acceptable distances from potential carriers or those infected with the virus; and contact tracing to control the spread of the virus. [0074] Those most vulnerable to the disease are thought to be the elderly and patients with underlying medical conditions. However, an increase number of those infected and requiring medical support appears to be on the rise, at least in the United States in subjects previously considered to be low-risk, for example, younger and otherwise healthy individuals. [0075] Despite these preventative measures, SARS-CoV-2 remains a significant healthcare issue. Therefore, there is a need for rapid identification of the presence of SARS-CoV-2. [0076] In the following, embodiments are explained in more detail by means of non-limiting examples. [0077] A method of selecting aptamers capable of specifically binding SARS-CoV- 2 is provided. The method of selecting aptamers is also a method of making aptamers. Embodiments include one or more aptamers made by the method described herein, and compositions comprising one or more aptamers made by the method described herein. Embodiments include employing the aptamer(s) or composition(s). The method of employing may include surface detection of SARS-CoV-2. The surface may be inanimate. For example, the surface can be a non-living surface. In other embodiments, the surface may be a tissue. The method of employing may include inactivating SARS-CoV-2. The inactivating may be preventing binding of the SARS- CoV-2 to a cell. The method of employing may be targeted delivery of an inactivating moiety to SARS-CoV-2. [0078] The method of employing may comprise detection of SARS-CoV-2 infection in one or more of biological tissues and fluids. The method may include assays directed to detection of SARS-CoV-2 on biological tissues. The method may include assays directed to detection of SARS-CoV-2 in biological fluids, when the fluids are present on a surface, for example. The method may include assays directed to detection of SARS-CoV-2 in respiratory tract fluid on a surface. The assays may be conducted at a time before SARS-CoV-2 infection is known or suspected, during SARS-CoV-2 infection, or after infection. [0079] The method of employing may comprise detection of SARS-CoV-2 on non- living surfaces. [0080] The method of employing may comprise detection of SARS-CoV-2 in human and animal food production. [0081] The method of employing may comprise using one or more aptamer(s) herein as a carrier(s) to deliver disinfection agents to selectively kill SARS-CoV-2 virus. The delivery may be to virus on a non-living surface. Aptamers have shown, in studies, the ability to inhibit viral enzymes, interfere with viral coats, and disrupt steps of a viral life cycle (including reverse transcription, chromosomal integration, proteolytic processing, viral expression, packing, and entry). Aptamer Selection Process [0082] The method of selecting for aptamers capable of specifically binding SARS- CoV-2 comprises performing a first selection round, which is a first positive round of selection. The first positive round of selection comprises immobilizing a SARS-CoV-2 protein and combining sequences of a naïve DNA aptamer library with the immobilized SARS-CoV-2 protein to form a combination. [0083] The immobilized SARS-CoV-2 protein may comprise a full-length protein, or a fragment of a SARS-CoV-2 protein. The protein may be a spike protein of SARS- CoV-2. The protein may be the S1 (S) domain of the spike protein or a fragment thereof. The protein may be the S2 domain of the spike protein or a fragment thereof. The fragment of the S1 domain may comprise, consist essentially of, or consist of amino acids 1 to 681, or amino acids located in portions within the S1 domain that are not present in the S1 domain of other coronavirus proteins. The immobilized protein may comprise, consist essentially of, or consist of amino acids belonging to insert region 1 (amino acids 70 to 77; VSGTNGT, SEQ ID NO: 16), insert region 2 (amino acids 150 to 153; KSWM, SEQ ID NO: 17), insert region 3 (amino acids 247 to 252; RSYLTP, SEQ ID NO: 18), or insert region 4 (amino acids 680 to 683; SPRR, SEQ ID NO: 19) of the S1 spike protein of SARS-CoV-2. [0084] The SARS-CoV-2 protein may be a recombinant protein. In some embodiments, the recombinant protein comprises a tag. The tag may be an affinity tag. Non-limiting examples of the tag include but are not limited to a poly-histidine (HIS), chitin binding protein (CBP), maltose binding protein (MBP), streptavidin, or glutathione-S-transferase (GST). The tag may be any known in the art for use in binding to a target protein. For example, the target protein can be immobilized through the tag onto a support. [0085] In some embodiments, the SARS-CoV-2 protein is immobilized on a support. The support may comprise a moiety that binds a tag as described herein. In some embodiments, the tag is a HIS tag and the support comprises a nickel containing moiety. [0086] The method of selecting for aptamers capable of binding SARS-CoV-2 may comprise washing the combination. The washing may be performed with a reagent or buffer that allows for the bound aptamers to remain bound to the immobilized SARS- CoV-2 protein and for the unbound aptamers to be washed away. In some embodiments, buffers may be chosen that decrease the affinity of aptamers having less specificity to the immobilized recombinant protein. These buffers may include detergents, salts, surfactant, and other components generally known to be included in wash buffers. The concentration of each of the buffer components, as well as the pH, may vary depending on the required stringency of the washing step. [0087] The method of selecting for aptamers capable of binding SARS-CoV-2 further comprises eluting aptamers remaining bound. Elution may be performed by varying the pH or ionic strength. Elution may be performed by denaturing conditions (or means thereof), exposure to organic solvents, or exposure to specific competitors. A composition comprising 6 M urea may be used to elute bound aptamers from the immobilized recombinant proteins. [0088] The method of selecting for aptamers capable of binding SARS-CoV-2 further comprises amplifying the eluted aptamers to form double-stranded amplicons of the eluted aptamers. Amplifying comprises a polymerase chain reaction (PCR) with a forward primer that binds to a 5’ forward primer recognition region and a reverse primer that binds to a 3’ reverse primer recognition region included on each aptamer of the naïve DNA aptamer library, as illustrated in FIG. 1A. Amplification of the eluted aptamers to form double-stranded amplicons may also introduce a promoter. The promoter may be a T7 promoter, which may be used to drive transcription of an antisense RNA strand. [0089] The method of selecting for aptamers capable of binding SARS-CoV-2 further comprises transcribing the double-stranded amplicons to form antisense RNA strands and reverse transcribing the antisense RNA strands into cDNA as illustrated in FIG. 1B. The method further comprises treating the sample comprising the antisense RNA strands with DNase. The method further comprises treating the sample comprising the cDNA strands with RNase. Generation of the cDNA corresponding to the eluted aptamers results in generation of a first round aptamer library. [0090] The method of selecting for aptamers capable of specifically binding SARS- CoV-2 further comprises performing a second selection round, comprising a first negative round of selection and a second positive round selection. The first negative round of selection comprises selecting for aptamers from the first round aptamer library that do not bind a non-SARS-CoV-2 protein, which may be a recombinant protein. The method comprises combining the first round aptamer library to a first non-SARS-CoV-2 recombinant protein. The first non-SARS-CoV-2 recombinant protein may be a coronavirus protein. The first non-SARS-CoV-2 recombinant protein may be a coronavirus protein spike protein. Non-limiting examples of the second non- SARS-CoV-2 recombinant protein include but are not limited to a SARS-CoV recombinant protein, a SARS-CoV recombinant spike protein, a SARS-CoV recombinant S1 spike protein, or portions of the foregoing. As illustrated in FIGs.2A – 2C, the receptor binding motif of SARS-CoV comprises a greater number of non- identical residues (R1) to the equivalent portion of SARS-CoV-2 than identical residues (R2), and as shown in Tables 1 and 3. [0091] The immobilized SARS-CoV may comprise a full-length SARS-CoV protein. The immobilized SARS-CoV protein may comprise a fragment of the full-length protein. The fragment of the full length protein may be the spike protein portion. The spike protein portion may be the S1 (S) domain of the spike protein or the S2 domain of the spike protein. The immobilized SARS-CoV may comprise the entire S1 domain of the spike protein, or a fragment thereof. The fragment of the S1 domain may comprise, consist essentially of, or consist of amino acids 1 to 667 of the S1 domain (SEQ ID NO: 22). A non-limiting example of the fragment of the S1 domain comprises, consists essentially of, or consists of amino acids 14 to 667 of the S1 protein of SARS- CoV, and amino acids 1 to 13 encode for a signal peptide (SEQ ID NO: 22). Table 1 below illustrates amino acid sequence comparison between full-length spike protein for SARS-CoV-2 and SARS-CoV. Sequences unique to SARS-CoV or common to both SARS-CoV and SARS-CoV-2 may be ones that should be screened against in the first negative round of selection. [0092] As with an immobilized SARS-CoV-2 protein, a non-SARS-CoV-2 protein, in any round of selection where it is utilized, may comprises a tag. The tag may be an affinity tag. The tag may be a poly-histidine (HIS) tag, chitin binding protein (CBP), maltose binding protein (MBP), streptavidin, or glutathione-S-transferase (GST). The tag may be one known in the art for use in binding to a target protein. Also as with SARS-CoV-2, a non-SARS-CoV-2 protein, in any round of selection where it is utilized, may be immobilized on a support. The support may be one that binds the tag. The tag may be a HIS tag and the support may comprise a nickel containing moiety. [0093] The first negative round of selection further comprises collecting the unbound first round aptamers from the first negative selection round and amplifying them by PCR to form a second round double-stranded form (as with prior amplification steps, a promoter may be included or introduced during amplification), which can then be transcribed to RNA to form second round antisense RNA strands, which can by reverse transcribed, using reverse transcriptase, into second round cDNA, as illustrated in FIG. 1B, to form a second round aptamer library of the negative selection. After transcribing, the second round double-stranded form may be degraded with DNase. After reverse transcribing, the second round antisense RNA strands may be degraded, which may be accomplished with RNase. [0094] The second positive round selection comprises selecting for aptamers from the second round aptamer library of the negative selection that bind a SARS-CoV-2 recombinant protein as described in the foregoing. Aptamers that have the capacity to bind SARS-CoV-2 protein are retained, and aptamers that do not are discarded (unbound). The retained aptamers are eluted, collected and PCR amplified as described above. In some embodiments, a T7 promoter is created on the 3’ end of the amplicon. This T7 promoter may be used to drive the creation of an antisense RNA with the use of a T7 DNA directed RNA polymerase enzyme. In some embodiments, the remaining double stranded DNA template may be removed with DNase treatment. The antisense RNA is then reverse transcribed back into a sense strand using a reverse transcriptase enzyme. [0095] Additional rounds of selection may occur, as described above for the second selection round comprising both negative and positive rounds of selection as illustrated in block arrows 2 to 6 of FIG. 3. Recovered aptamer library from each second selection round may be exposed to immobilized S1 protein from SARS-CoV in a negative selection step, wherein sequences that do not exhibit binding to the SARS- CoV S1 protein, for example, are preferably kept and are exposed to the SARS-CoV- 2 S1 protein for a positive selection as described for the second positive selection round. The amplification and recovery of sense single strands are repeated in the same way. [096] The process described for the second selection round is repeated for as many selection rounds as necessary in order to ensure that the selection process has matured to the extent that enriched sequences will have a copy number greater than one when a subsample of the hbrary is analysed, for example, through next generation sequencing. The point of aptamer library maturation is estimated by evaluating the amount of aptamer library recovered after a selection round (the number of PCR cycles required to amphfy the library) as a proportion of the amount of library used to initiate said selection round. When this proportion increases relative to the previous selection round, this means that the proportion of sequences within the library that bind in the desired way to the target are dominating the selected library.
[097] The number of positive and negative selection steps performed in any given selection round may vary. In some embodiments, 1 to 15 rounds of second round selection, or any integer in between can be performed.
[098] In some embodiments, the non-SARS-CoV-2 protein may be a non-SARS- CoV-2 protein other than SARS-CoV. In some embodiments, the non-SARS-CoV-2 protein may be a CoV-Ni protein, a CoV-Ni spike protein, or the CoV-Ni S1 domain of the spike protein, or fragments thereof. Any of these proteins may be recombinant, may include a tag, and may be immobilized, as described above for the first non- SARS-CoV-2 protein. The fragment of the S1 domain may comprise, consist essentially of, or consist of amino acids 1 to 748 of the S1 domain of CoV-Ni. Table 1 below illustrates amino acid sequence comparison between full-length spike protein for each of SARS-CoV-2 (SEQ ID NO: 21), SARS-CoV (SEQ ID NO: 22), and CoV-Ni (SEQ ID NO: 23).
Table 1:
Figure imgf000019_0001
Figure imgf000020_0001
[099] The mature selected library is divided into at least two aliquots as shown in FIG. 3 (for example, 7 A to 9A and 7B to 9B). One of the aliquots is carried forward in a positive selection against the SARS-CoV-2 S1 protein (See A series), either with or without negative selection against SARS-CoV S1 protein. The other of the aliquots is carried forward in a positive selection against the SARS-CoV S1 protein (See B, C, or D series). This process is carried out for two to three selection rounds, with the selected library from each aliquot being reapplied only within its respective selection channel. [0100] The mature library used for the aliquots as well as each of the selected libraries from the two or three parallel selection rounds are analysed, for example, by next generation sequencing (NGS) or Sanger sequencing. In this analysis, those sequences that preferentially enrich in the SARS-CoV-2 S1 protein selection relative to the same sequence in the SARS-CoV S1 protein selection are identified. Libraries at any stage may be analyzed for statistical significance in terms of motif frequencies and copy number of entire sequences. Copy number may be evaluated in terms of abundance (number of copies of a given sequence) and enrichment (increase in copy number over selection rounds). [0101] Binding analysis may be conducted on libraries at any stage, pools of two or more aptamers, or single aptamers. The binding analysis may be performed by immobilizing the aptamers on a surface followed by combining with SARS-CoV-2, portions of SARS-CoV-2, various S1 proteins of SARS-CoV-2, SARS-CoV, CoV-N1, or other coronaviruses or portions thereof used during negative selection. The surface may be a gold surface and the aptamers may be immobilized through a thiol conjugation. In some embodiments, each aptamer is applied to the surface in triplicate. In some embodiments, human serum albumin may be used as a test for potential binding in plasma. Kon and Koff values for each aptamer for each target protein may be evaluated. A similar binding analysis may be used in method of detecting SARS-CoV-2 by passing combining the libraries at any stage, pools of two or more aptamers, or single aptamers with sample being tested for presence of SARS- CoV-2. Aptamers [0102] The aptamers described herein are artificial ligands comprising DNA, RNA, or modifications thereof, capable of specifically binding to a target as defined herein with high affinity and specificity. As used herein, “aptamer,” “nucleic acid molecule,” or “oligonucleotide” are used interchangeably to refer to a non-naturally occurring nucleic acid molecule that has a desirable action on a target as defined herein. [0103] In some embodiments, the DNA or RNA may include natural components. In some embodiments, the DNA or RNA may include solely natural components, solely modified components, or a combination of natural and modified components. [0104] In some embodiments, the aptamers may be DNA aptamers. For example, the aptamers may be single-stranded DNA (ssDNA). In some embodiments, the aptamers may be RNA aptamers. For example, the aptamers may be single-stranded RNA (ssRNA). [0105] In some embodiments, the aptamers may comprise natural, modified, or non-natural nucleotides and/or base derivatives (or combinations thereof). In some embodiments, the aptamers comprise one or more modifications such that they comprise a chemical structure other than deoxyribose, ribose, phosphate, adenine (A), guanine (G), cytosine (C), thymine (T), or uracil (U). The aptamers may be modified at the nucleobase, at the sugar or at the phosphate backbone. [0106] In some embodiments, the aptamers comprise one or more modified nucleotides. Exemplary modifications include for example nucleotides comprising an alkylation, arylation or acetylation, alkoxylation, halogenation, amino group, or another functional group. Examples of modified nucleotides include, but are not limited to, 2’-fluoro ribonucleotides, 2’-NH2-, 2’-OCH3- and 2’-O-methoxyethyl ribonucleotides, which are used for RNA aptamers. [0107] In some embodiments, the aptamers may be wholly or partly phosphorothioate or DNA, phosphorodithioate or DNA, phosphoroselenoate or DNA, phosphorodiselenoate or DNA, locked nucleic acid (LNA), peptide nucleic acid (PNA), N3’-P5’ phosphoramidate RNA/DNA, cyclohexene nucleic acid (CeNA), tricyclo DNA (tcDNA) or spiegelmer, or the phosphoramidate morpholine (PMO) components or any other modification known to those skilled in the art (see also Chan et al., Clinical and Experimental Pharmacology and Physiology (2006) 33, 533-540). [0108] Some of the modifications may allow the aptamers to be stabilized against nucleic acid-cleaving enzymes. In the stabilization of the aptamers, a distinction can generally be made between the subsequent modification of the aptamers and the selection with already modified RNA/DNA. The stabilization may be such that it either does not affect the affinity of the modified RNA/DNA aptamers or any effect on said affinity is such that the utility of the aptamers remains. The stabilization may prevent the rapid decomposition of the aptamers in an organism, biological solutions, or solutions, by RNases/DNases. An aptamer is referred to as stabilized if the half- life of the aptamer in the sample (e.g., biological medium, organism, solution) is greater than one minute, greater than one hour, or greater than one day. The aptamers may be modified with reporter molecules, which may enable detection of the labelled aptamers. Reporter molecules may also contribute to increased stability of the aptamers. [0109] Aptamers form a three-dimensional structure that depends on their nucleic acid sequence. The three-dimensional structure of an aptamer may arise due to Watson and Crick intramolecular base pairing, Hoogsteen base pairing (quadruplex), wobble-pair formation, or other non-canonical base interactions. The three- dimensional structure enables aptamers, analogous to antigen-antibody binding, to bind target structures accurately. A nucleic acid sequence of an aptamer may, under defined conditions, have a three-dimensional structure that is specific to a defined target structure. [0110] In some embodiments, there is provided an aptamer comprising a nucleic acid sequence selected from a nucleic acid sequence as set forth in Table 2. Table 2 – Aptamer Sequences
Figure imgf000023_0001
Figure imgf000024_0001
[0111] In some embodiments, the disclosure comprises aptamer(s) capable of binding specifically to SARS-CoV-2. In some embodiments, the binding may be to a surface structure of SARS-CoV-2. In some embodiments, the binding may be to a surface protein of SARS-CoV-2. In some embodiments, the binding may be to the spike protein of SARS-CoV-2. In some embodiments, the binding may be to the S1 or S2 domain of the SARS-CoV-2 spike protein. In some embodiments, the binding may be to a region within amino acids 1 to 681 of the S1 domain, or to a region of the S1 domain comprising, consisting essentially of, or consisting of amino acids 70 to 77, 150 to 153, 247 to 252, or 680 to 683. [0112] In some embodiments, the disclosure includes an aptamer made according to the method of selecting for aptamers capable of specifically binding SARS-CoV-2. In some embodiments, the aptamer may bind a SARS-CoV-2 protein. In some embodiments, the specific binding may be to the S1 domain of the spike protein of SARS-CoV-2. In some embodiments, the specific binding may be to a portion of the S1 domain. In some embodiments, the specific binding may be to the region including amino acids 1 to 681. In some embodiments, the portion may comprise, consist essentially of, or consisting of the regions including amino acids 70 to 77, 150 to 153, 247 to 252, or 680 to 683 of the S1 spike protein of SARS-CoV-2. In some embodiments, the binding to these non-limiting examples may also include binding to regions that border the exemplified amino acid sequences. [0113] In some embodiments, an aptamer may bind “specifically” to a target as defined herein if the aptamer binds with preferential or high affinity to the target molecule but does not bind or binds with only low affinity to other structurally related molecules (e.g., SARS-CoV or other related non-SARS-CoV-2 coronaviruses). [0114] In some embodiments, the naïve DNA aptamer library includes aptamers made according to the methods described herein and comprising a forward primer region at the 5’ end, a reverse primer region at the 3’ end, and random region located in between each nucleotide. In some embodiments, the forward primer region has a length of 20 to 25 nucleotides. In some embodiments the forward primer region has a length of 23 nucleotides. In some embodiments, the reverse primer region has a length of 15 to 20 nucleotides. In some embodiments the reverse primer region has a length of 17 nucleotides. In some embodiments, the random region has a length of 35 to 45 nucleotides. In some embodiments the random region has a length of 40 nucleotides. The solution space for a random region of 40 nucleotides is 1.2*1024. In some embodiments, a naïve DNA aptamer library of 1*1015 of these aptamer possibilities will be exposed and or combined with the immobilized recombinant target protein. [0115] In some embodiments, the aptamers are RNA aptamers and comprise a sequence in which one or some or all of the deoxyribonucleotides in any of the sequences set forth in SEQ ID NOs. 3 to 15 are substituted for their equivalent ribonucleotide residues AMP, GMP, UMP or CMP. [0116] The aptamers according to some embodiments may comprise modified nucleic acids as described herein. [0117] In some embodiments, the aptamers are prepared using principles of in vitro selection known in the art, that include iterative cycles of target binding, partitioning and preferential amplification of target binding sequences. Selection may be performed using immobilized target proteins. Immobilization may include, but is not limited to, immobilization to a solid surface. In a non-limiting example, the solid surface may be beads. In a non-limiting example, the solid surface may be magnetic beads. [0118] Non-limiting examples of amplification methods include polymerase chain reaction (PCR), ligation amplification (or ligase chain reaction, LCR), strand displacement amplification, nucleic acid sequence-based amplification, and amplification methods based on the use of Q-beta replicase. In a non-limiting embodiment, at least one type of aptamer may be immobilized on a solid surface during amplification. Each of these exemplary methods is well known in the art. [0119] In some embodiments, the aptamers are selected from a nucleic acid molecule library such as a single-stranded DNA or RNA nucleic acid molecule library. The aptamers may be selected from a “universal aptamer selection library” that is designed such that any selected aptamers need little to no adaptation to convert into any of the listed assay formats. [0120] Once selected, the aptamer may be further modified before being used e.g. to remove one or both primer sequences and/or parts of the randomized sequence not required for target binding. [0121] Typically, aptamers of the embodiments comprise a first primer region (e.g. at the 5’ end), a second primer region (e.g. at the 3’ end), or both. The primer regions may serve as primer binding sites for PCR amplification of the library and selected aptamers. [0122] The skilled person would understand that different primer sequences can be selected depending, for example, on the starting library and/or aptamer selection protocol. In some embodiments, the primer comprises or consists of a nucleic acid sequence of SEQ ID NO: 1 and/or 2. In some embodiments, aptamers may comprise SEQ ID NO: 1 and/or 2. In some embodiments, any one of one to all of the nucleotides disclosed by SEQ ID NO: 1 or 2 may be modified. In some embodiments, the primer region length may also be varied. [0123] The first primer region and/or second primer region may comprise a detectable label as described herein. As used herein the terms “detectable label” and “detectable moiety” are used interchangeably. In some embodiments, the first primer region and/or second primer region may be fluorescently labelled. Non-limiting examples of fluorescent labels include but are not limited to fluorescein, green fluorescent protein (GFP), yellow fluorescent protein, cyan fluorescent protein, and others. In some embodiments, a fluorescein label is used. In some embodiments, other forms of detecting the primer may be used, including but not limited to phosphate (PO4) labelling, isotope labelling, electrochemical sensors, colorimetric biosensors, and others. [0124] In some embodiments, the aptamers comprise or consist of a nucleic acid sequence selected from any one of SEQ ID NOs: 3 to 15. [0125] In some embodiments, the aptamers comprise or consist of a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 3 to 15. [0126] As used herein, “sequence identity” refers to the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in said sequences after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, CLUSTALW or Megalign (DNASTAR) software. For example, % nucleic acid sequence identity values can be generated using sequence comparison computer programs found on the European Bioinformatics Institute website (www.ebi.ac.uk). [0127] As used herein, when describing the percent identity of a nucleic acid, such as an aptamer, the sequence of which is at least, for example, about 90% identical to a reference nucleotide sequence, it is intended that the nucleic acid sequence is identical to the reference sequence except that the nucleic acid sequence may include up to ten point mutations (e.g. substitution, deletion, insertion) per each 100 nucleotides of the reference nucleic acid sequence. These mutations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those 5' or 3' terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. [0128] In some embodiments, aptamers comprise, consist essentially of, or consist of a minimal effective fragment of SEQ ID NOs: 3 to 15. Herein, a “minimal effective fragment” is understood to mean a fragment (e.g. portion) of the full-length aptamer capable of binding to a target as defined herewith with the same or improved affinity as compared to the full-length aptamer. A minimal effective fragment may compete for binding to a target as defined herein with the full-length aptamer. [0129] In some embodiments, the aptamers comprise, consist essentially of, or consist of at least 10 contiguous nucleic acid residues of any of the sequences as set forth in any one of SEQ ID NOs: 3 to 15 and show equivalent or improved binding to the target molecule. In some embodiments, the aptamers comprise, consist essentially of, or consist of at least 10 contiguous nucleic acid residues of any of the sequences as set forth in any one of SEQ ID NOs: 3 to 15 and show adequate binding to the target molecule. Adequate binding includes binding to target molecule that occurs with affinity and specificity as described herein, or an affinity and/or specificity of binding less than that of the full-length aptamer sequence above but still capable of delivering a report of the presence of its respective target. [0130] In some embodiments, the aptamer comprises, consists essentially of, or consists of at least 10 contiguous nucleotides of any of the sequences as set forth in any one of SEQ ID NOs: 3 to 15. [0131] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 3. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 3, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0132] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 4. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 4, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0133] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 5. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 5, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0134] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 6. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 6, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0135] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 7. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 7, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0136] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 8. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 8, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0137] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 9. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 9, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0138] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 10. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 10, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0139] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 11. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 11, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0140] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 12. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 12, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0141] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 13. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 13, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0142] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, or 57 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 14. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 14, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0143] In some embodiments, an aptamer comprises, consists essentially of, or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52 contiguous nucleotides in the nucleic acid sequence of SEQ ID NO: 15. The aptamer may comprise, consist essentially of, or consist of any span of contiguous nucleotides from SEQ ID NO: 15, where the span has a length chosen in one nucleotide increments from 10 nucleotides to full length. [0144] In some embodiments, these sequences relate to aptamer fragments with equivalent, suitable, or improved binding to a target protein as described herein as compared to full-length aptamer. [0145] In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identity with any of SEQ ID NOs: 3 to 15. In this context the term “about” typically means the referenced nucleotide sequence length plus or minus 10% of that referenced length. [0146] In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 85% or more identity with any of SEQ ID NOs: 3 to 12. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 85% or more identity with SEQ ID NO: 13. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 85% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 85% or more identity with SEQ ID NO: 15. [0147] In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 90% or more identity with any of SEQ ID NOs: 3 to 12. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 90% or more identity with SEQ ID NO: 13. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 90% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 90% or more identity with SEQ ID NO: 15. [0148] In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 95% or more identity with any of SEQ ID NOs: 3 to 12. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 95% or more identity with SEQ ID NO: 13. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 95% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 95% or more identity with SEQ ID NO: 15. [0149] In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 96% or more identity with any of SEQ ID NOs: 3 to 12. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 96% or more identity with SEQ ID NO: 13. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 96% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 96% or more identity with SEQ ID NO: 15. [0150] In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 97% or more identity with any of SEQ ID NOs: 3 to 12. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 97% or more identity with SEQ ID NO: 13. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 97% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 97% or more identity with SEQ ID NO: 15. [0151] In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 98% or more identity with any of SEQ ID NOs: 3 to 12. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 98% or more identity with SEQ ID NO: 13. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 98% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 98% or more identity with SEQ ID NO: 15. [0152] In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence having at least 99% or more identity with any of SEQ ID NOs: 3 to 12. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or more consecutive nucleotides of a sequence having at least 99% or more identity with SEQ ID NO: 13. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45 or more consecutive nucleotides of a sequence having at least 99% or more identity with SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more consecutive nucleotides of a sequence having at least 99% or more identity with SEQ ID NO: 15. [0153] In some embodiments, aptamers comprise, consist essentially of, or consist of at least about 10 contiguous nucleotides of any of the sequences as set forth in any one of SEQ ID NOs: 3 to 15. [0154] In some embodiments, aptamers comprise, consist essentially of, or consist of at least about 25 contiguous nucleotides of any of the sequences as set forth in any one of SEQ ID NOs: 3 to 15. [0155] In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of a sequence comprising any one of SEQ ID NOs: 3 to 11. [0156] In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10 or more consecutive nucleotides of a sequence comprising SEQ ID NO: 12. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10 or more consecutive nucleotides of a sequence comprising SEQ ID NO: 13. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10 or more consecutive nucleotides of a sequence comprising SEQ ID NO: 14. In some embodiments, aptamers comprise, consist essentially of, or consist of a nucleic acid sequence comprising at least about 10 or more consecutive nucleotides of a sequence comprising SEQ ID NO: 15. Support [0157] In some embodiments, the target peptide or protein is attached to a support. In a non-limiting example, the support may be a solid support. Non-limiting examples of a solid support include a membrane or a bead. In some embodiments, the support may be a two-dimensional support. A non-limiting example of a two-dimensional support is a microplate. In some embodiments, the support may be a three- dimensional support. A non-limiting example of a three-dimensional support is a bead. In some embodiments, the support may comprise at least one magnetic bead. [0158] In some embodiments, the protein comprises a polyhistidine tag (His tag) tag (e.g. hexa-histidine tag) at its N- or C-termini. For example, the protein can be a recombinant protein having Histidine residues at its C-terminus or its N-terminus. In some embodiments, the His-tagged protein can be immobilized onto a support carrying a histidine binding agent. For example, the His-tagged protein can be immobilized to a support having nickel nitrilotriacetic acid (Ni-NTA). [0159] In some embodiments, the support may comprise at least one nanoparticle. A non-limiting example of a nanoparticle is a gold nanoparticle or the like. In yet further embodiments, the support may comprise a microtiter or other assay plate, a strip, a membrane, a film, a gel, a chip, a microparticle, a nanofiber, a nanotube, a micelle, a micropore, a nanopore, or a biosensor surface. In some embodiments, the biosensor surface may be a probe tip surface, a biosensor flow-channel, or similar. [0160] In some embodiments, the support comprises a membrane. Non-limiting examples of a membrane include a nitrocellulose, a polyethylene (PE), a polytetrafluoroethylene (PTFE), a polypropylene (PP), a cellulose acetate (CA), a polyacrylonitrile (PAN), a polyimide (PI), a polysulfone (PS), a polyethersulfone (PES) membrane or an inorganic membrane comprising aluminum oxide (Al2O3), silicon oxide (SiO2), and/or zirconium oxide (ZrO2). Non-limiting examples of materials from which a support may be made include inorganic polymers, organic polymers, glasses, organic and inorganic crystals, minerals, oxides, ceramics, metals, especially precious metals, carbon, and semiconductors. In an embodiment, the organic polymer is a polymer based on polystyrene. Biopolymers, including but not limited to cellulose, dextran, agar, agarose and Sephadex, which may be functionalized in particular as nitrocellulose or cyanogen bromide Sephadex, may be polymers in a support. Detectable label [0161] In some embodiments, the aptamer comprises a detectable label. The aptamer with a detectable label may be a single-stranded DNA (ssDNA) aptamer. [0162] In some embodiments, the aptamers of the disclosure are used to detect and/or quantify the amount of a target as defined herein in a sample. Typically, the aptamers comprise a detectable label. Any label capable of facilitating detection and/or quantification of the aptamers may be used herein. Non-limiting examples of detectable labels are described below. [0163] In some embodiments, the detectable label is a fluorescent moiety, e.g. a fluorescent compound (also referred herein as fluorophore). In some embodiments, the aptamer comprises a fluorescent and a quencher compound. Fluorescent and quencher compounds are known in the art. See, for example, Mary Katherine Johansson, Methods in Molecular Biol. 335: Fluorescent Energy Transfer Nucleic Acid Probes: Designs and Protocols, 2006, Didenko, ed., Humana Press, Totowa, NJ, and Marras et al., 2002, Nucl. Acids Res.30, el22 (incorporated by reference herein). [0164] In some embodiments, the detectable label is FAM. In some embodiments, the FAM-label is conjugated to the 5’ end or the 3’ end of the aptamer to form an aptamer conjugate. One of ordinary skill in the art would understand that the label may be located at any suitable position within the aptamer. [0165] In some embodiments, the aptamer comprises a FAM fluorophore at its 5’ end. In some embodiments, the aptamer is synthesized by incorporating phosphoramidite one at a time into the nucleic acid chain and the FAM-labeled phosphoramidite is incorporated through the synthesis process. In some embodiments, the FAM fluorophore is attached at the 5’ end of the aptamer via a linker. In some embodiments, the detectable label is attached to an aptamer described herein via a moiety selected from a thiol group, an amine group, an azide, six-carbon linker, and an aminoallyl group and combinations thereof. In some embodiments, the FAM label can be incorporated into the aptamer using a forward primer with a FAM on the 5’ end. In some embodiments, the aptamer can be prepared by solid phase synthesis with the FAM label already in place, attached to the 5’ end as in the primer. [0166] Moieties that result in an increase in detectable signal when in proximity of each other may also be used herein, for example, as a result of fluorescence resonance energy transfer (“FRET”); suitable pairs include but are not limited to fluorescein and tetramethylrhodamine; rhodamine 6G and malachite green, and FITC and thiosemicarbazole, to name a few. [0167] In some embodiments, the detectable label is and/or comprises a fluorescent moiety, a colorimetric moiety or any detectable moiety known in the art. For example, the detectable moiety can be, but is not limited to, a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a protein, a dendrimer, or an organic polymer. In some embodiments, the detectable moiety can be a particle. For example, the detectable moiety can be, but is not limited to, a colloidal metallic particle, a colloidal non-metallic particle, a latex particle, a nanofiber, a nanotube, or a liposome. [0168] In some embodiments, the detectable label is a fluorescent protein such as Green Fluorescent Protein (GFP) or any other fluorescent protein known to those skilled in the art. [0169] In some embodiments, the detectable label is an enzyme. For example, the enzyme may be selected from horseradish peroxidase, alkaline phosphatase, urease, β-galactosidase or any other enzyme known to those skilled in the art. [0170] In some embodiments, the nature of the detection will be dependent on the detectable label used. For example, the label may be detectable by virtue of its color, e.g. gold nanoparticles. A color can be detected quantitatively by an optical reader or camera e.g. a camera with imaging software. [0171] In some embodiments, the detectable label is a fluorescent label e.g. a quantum dot. In such embodiments, the detection means may comprise a fluorescent plate reader, strip reader or similar, which is configured to record fluorescence intensity. [0172] In some embodiments in which the detectable label is an enzyme label, non- limiting detection means may, for example, be colorimetric, chemiluminescence and/or electrochemical (including, but not limited to using an electrochemical detector). Electrochemical sensing may be through conjugation of a redox reporter (including, but not limited to methylene blue or ferrocene) to one end of the aptamer and a sensor surface to the other end. A change in aptamer conformation upon target binding may change the distance between the reporter and sensor to provide a readout. [0173] In some embodiments, the detectable label may further comprise enzymes, including but not limited to, horseradish peroxidase (HRP), Alkaline phosphatase (APP) or similar, to catalytically turnover a substrate to give an amplified signal. [0174] Embodiments comprise a complex (e.g. aptamer conjugate) comprising aptamers of the disclosure and a detectable molecule. In some embodiments, the aptamers are covalently or physically conjugated to a detectable molecule. [0175] In some embodiments, the detectable molecule is a visual, optical, photonic, electronic, acoustic, opto-acoustic, mass, electrochemical, electro-optical, spectrometric, enzymatic, or otherwise physically, chemically or biochemically detectable label. [0176] In some embodiments, the detectable molecule is detected by luminescence, UV/VIS spectroscopy, enzymatically, electrochemically or radioactively. Luminescence refers to the emission of light. For example, photoluminescence, chemiluminescence and bioluminescence are used for detection of the label. In photoluminescence or fluorescence, excitation occurs by absorption of photons. Exemplary fluorophores include, but are not limited to, bisbenzimidazole, fluorescein, acridine orange, Cy5, Cy3 or propidium iodide, which can be covalently coupled to aptamers, tetramethyl-6-carboxyrhodamine (TAMRA), Texas Red (TR), rhodamine, Alexa Fluor dyes (et al. Fluorescent dyes of different wavelengths from different companies). The fluorescent label may be covalently coupled to aptamers. In some embodiments, fluorescent moieties may be incorporated into aptamers in the oligonucleotide synthesis process. For example, oligonucleotides may be synthesized from phosphoramidites. In some embodiments, fluorophores may be incorporated into the termini of aptamers through the use of a phosphoramidite that already has the fluorophore attached. In some embodiments, the fluorophore may be incorporated at a terminal position allowing for the use of phosphoramidites that do not support further elongation. [0177] In some embodiments, the detectable molecule is a colloidal metallic particle, including but not limited to a gold nanoparticle, colloidal non-metallic particle, quantum dot, organic polymer, latex particle, nanofiber (carbon nanofiber, as a non-limiting example), nanotube (carbon nanotube, as a non-limiting example), dendrimer, protein or liposome with signal-generating substances. Colloidal particles may be detected colorimetrically. [0178] In some embodiments, the detectable molecule is an enzyme. In some embodiments, the enzyme may convert substrates to colored products. Examples of the enzyme include but are not limited to peroxidase, luciferase, β-galactosidase or alkaline phosphatase. For example, the colorless substrate X-gal is converted by the activity of β-galactosidase to a blue product whose color is visually detected. [0179] In some embodiments, the detection molecule is a radioactive isotope. The detection may also be carried out by means of radioactive isotopes with which the aptamer is labelled, including but not limited to 3H, 14C, 32P, 33P, 35S or 125I. In an embodiment, scintillation counting may be conducted, and thereby the radioactive radiation emitted by the radioactively labelled aptamer target complex is measured indirectly. A scintillator substance is excited by the isotope’s radioactive emissions. During the transition of the scintillation material, back to the ground state, the excitation energy is released again as flashes of light, which are amplified and counted by a photomultiplier. [0180] In some embodiments, the detectable molecule is selected from digoxigenin and biotin. Thus, the aptamers may also be labelled with digoxigenin or biotin, which are bound for example by antibodies or streptavidin, which may in turn carry a label, such as an enzyme conjugate. The prior covalent linkage (conjugation) of an aptamer with an enzyme can be accomplished in several known ways. [0181] In some embodiments, detection of aptamer binding may also be achieved through labelling of the aptamer with a radioisotope in an RIA (radioactive immunoassay), preferably with 125I, or by fluorescence in a FIA (fluoroimmunoassay) with fluorophores. In some embodiments, the fluorophore is fluorescein or fluorescein isothiocyanate (FITC). [0182] Embodiments comprise methods for detecting the presence, absence or amount of a target molecule as defined herein in a sample. In the methods, the sample may be interacted (i.e. contacted) with an aptamer as described herein. For example, the sample and aptamers as described herein may be incubated under conditions sufficient for at least a portion of the aptamer to bind to a target as defined herein in the sample. [0183] A person skilled in the art will understand the conditions required for binding to occur between the aptamers described herein and a target as defined herein. In some embodiments, the sample and aptamer may be incubated at temperatures between about 4 °C and about 40 °C. In some embodiments, the sample and aptamer may be incubated at temperatures between about 20 °C and about 37 °C. In some embodiments, the sample and aptamer may be incubated at or about 22 °C. The incubation temperature may be selected from the range of 4 °C to less than 20 °C, 20 °C to less than 22 °C, 22 °C to less than 24 °C, 24 °C to less than 26 °C, 26 °C to less than 28 °C, 28 °C to less than 30 °C, 30 °C to less than 32 °C, 32 °C to less than 34 °C, 34 °C to less than 36 °C, 36 °C to 37 °C, and 37 °C to 40 °C. In some embodiments, the sample and aptamer may be diluted to different concentrations (e.g. at least about 1%, 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70% 80% v/v or more) with a buffer (exemplary buffers include but are not limited to PBS). The diluted concentrations may be selected from the range of 1% to less than 5%, 5% to less than 10%, 10% to less than 20%, 20% to less than 30%, 30% to less than 40%, 40% to less than 50%, 50% to less than 60%, 60% to less than 70%, 70% to less than 80%, or 80% to less than 90%. In some embodiments, the aptamer concentration before dilution may be from 100 nM to 50 µM. In some embodiments, the aptamer concentration before dilution may be selected from the range of 100 nM to 500 nM, 500 nM to 1 µM, 1 µM to 2 µM, 2 µM to 5 µM, 5 µM to 10 µM, 10 µM to 15 µM, 15 µM to 20 µM, 20 µM to 30 µM, 30 µM to 40 µM, 40 µM to 50 µM, 50 µM to 60 µM, 60 µM to 70 µM, 70 µM to 80 µM, 80 µM to 90 µM, 90 µM to 100 µM. In some embodiments, the aptamer concentration before dilution may be a concentration selected from the ranges described herein. The selected value may be selected from 0.1 µM increment concentrations in a range herein. In some embodiments, the aptamer concentration before dilution may be 2 µM. In some embodiments, the sample and aptamer may be incubated whilst shaking and/or mixing. In some embodiments, the sample and aptamer are incubated for at least 1 minute, at least 5 minutes, at least 15 minutes, at least 1 hour, or more. The sample and aptamer may be incubated for 1 minute to less than 5 minutes, 5 minutes to less than 15 minutes, 15 minutes to less than one hour, one hour to less than 24 hours, 24 hours to less than 48 hours. [0184] In some embodiments, binding of the aptamer and a target as defined leads to formation of an aptamer-target complex. The binding or binding event may be detected, for example, visually, optically, photonically, electronically, acoustically, opto-acoustically, by mass, electrochemically, electro-optically, spectrometrically, enzymatically or otherwise chemically, biochemically or physically as described herein. [0185] The binding of aptamer and the target may be detected using any suitable technique. As discussed above, for example, binding of the aptamer and the target may be detected using a biosensor. In some embodiments, binding of the aptamer and the target is detected using the non-limiting examples of SPR, RlfS, BLI, LFD or ELONA as described herein. [0186] In some embodiments, the aptamer can be attached to the surface of the biosensor using a biotin group. In some embodiments, the biotin group is attached at the 5’ end or the 3’ end of the aptamer. In some embodiments, the surface of the biosensor has an avidin/streptavidin attached thereto and the immobilization of the aptamer to the surface of the biosensor is via biotin-avidin interaction. In some embodiments, the surface of the biosensor is coated with avidin/streptavidin. [0187] In some embodiments, the aptamer is linked to a fluorescent moiety. In some embodiments, the aptamer is an aptamer conjugate comprising an aptamer conjugated with a fluorescent moiety. In some embodiments the fluorophore is at the 5’ end or the 3’ end of the aptamer. In some embodiments, the aptamer is associated with an antisense oligonucleotide having a fluorophore. In some embodiments the fluorophore is at the 5’ end or the 3’ end of the aptamer. In some embodiments the antisense oligonucleotide is complementary to the 5’ end or 3’ end of the aptamer. In some embodiments, the fluorophore is at the 5’ end or the 3’ end of the antisense oligonucleotide. [0188] It should be appreciated that a given aptamer may exist in dynamic equilibrium among many possible shapes. These shapes (also referred herein as structure or conformation) can be in flux with each other. The binding affinity of the aptamer to the target protein is dependent on the structure of the aptamers. In some embodiments, the aptamer structure comprises one or more stems and loops. [0189] To optimize the binding effectiveness of a given structure to a target protein, it is desirable if the structure of the selected aptamer is not in flux with other structures (for example in different environments) but is the structure which is predominantly present. As such, although the aptamers are selected using an affinity-based selection assay as described herein, further optimization may be required to achieve the desired binding affinity to the target protein. The predicted conformation(s)/structure(s) of each aptamer can be obtained in silico from the primary sequence. In some embodiments, the primary structure of the aptamers can be engineered (e.g., substitution, deletion) to stabilize the secondary structures or tertiary structures. In some embodiments, the aptamers can be truncated to stabilize the secondary structures. [0190] In some embodiments the aptamers are selected using an affinity-based selection assay, the predicted conformations are obtained in silico, the primary sequence is optimized (e.g. truncation/deletion, substitution etc.) so that the optimized aptamer exhibits the optimized conformation and is stabilized. The resulting optimized aptamers have fewer structures that are in flux, or exhibit a range or difference among structures in flux that is less than the non-optimized aptamers. These optimized aptamers can be retested for binding effectiveness in order to determine whether the structure that was stabilized is the desired shape that binds to the target protein. [0191] In some embodiments, the aptamer is an aptamer beacon that undergoes a conformational change when the aptamer binds to the target protein and the detection of the binding of the aptamer to the target protein relies on the conformational change of the aptamer. [0192] In some embodiments, the aptamer conjugate is an aptamer comprising a fluorescent moiety at a first end of the aptamer and a quencher moiety at a second end of the aptamer. In some embodiments, the aptamer comprises a loop, a first nucleic acid segment that is complementary to a second nucleic acid segment, wherein the first segment and the second segment forms a stem portion when the first segment and the second segment are hybridized, wherein the first segment of the aptamer comprises a fluorophore and the second segment of the aptamer comprises a quencher. [0193] In some embodiments, antisense oligonucleotides can be designed to hybridize to the first segment, the second segment or combination thereof and to disrupt the stem and loop structure of the aptamers. For example, the antisense oligonucleotides can be complementary to the 5’ end, the 3’ end, the 5’ end and the 3’ end of or any relevant sequence of the aptamer. In some embodiments, two antisense oligonucleotides are provided, wherein the first antisense oligonucleotide comprises a fluorophore and hybridizes to the first segment of the aptamer, the second antisense comprises a quencher and hybridizes to the second segment of the aptamer. [0194] In some embodiments, the quencher comprises a “dark” quencher. In some embodiments, the quencher comprises a Black Hole Quencher® (BHQ). For example, the 3 ’end of the antisense oligonucleotides can be linked to a Black Hole Quencher®. [0195] In some embodiments, the antisense oligonucleotides act competitively with the binding of the aptamer to the target protein. [0196] In some embodiments, upon binding of the aptamer to the target protein, the aptamer undergoes a conformation change, altering the distance between the fluorophore and the quencher, resulting in the emission of a fluorescent signal. [0197] In some embodiments, two or more different aptamers are provided configured to bind to two or more different target proteins in a sample, each aptamer comprising a different fluorophore. Kits [0198] Embodiments also provide a kit for detecting and/or quantifying SARS- CoV-2, wherein the kit comprises one or more aptamers as described herein. Typically, the kit also comprises a detectable molecule as described herein. [0199] Embodiments provide a kit that further comprises a light source as described herein. In an embodiment, the kit may further comprise a bandpass filter as described herein. In an embodiment, the kit may comprise viewing goggles or glasses or the like as described herein. In some embodiments, the kit comprises: a) A solution comprising aptamers having a detection molecule conjugated thereto e.g. a fluorophore capable of emitting at a wavelength of between about 485 – 515 nm. In some embodiments, the fluorophore is capable of emitting at a wavelength of between about 490 – 505 nm. In some embodiments the fluorophore is capable of emitting at a wavelength of about 505 nm; b) A light source. In some embodiments, the light source produces light having a wavelength of between about 485 – 515 nm. In some embodiments, the light source produces light having a wavelength of between about 490 – 505 nm; c) A bandpass filter. In some embodiments, the bandpass filter is a 590 nm bandpass filter; and d) Viewing goggles. In some embodiments, the viewing goggles are orange viewing goggles. [0200] In some embodiments, the kit further comprises instructions for use in accordance with any of the methods described herein. [0201] The kit may comprise further components for the reaction intended by the kit or the method to be carried out, for example components for an intended detection of enrichment, separation and/or isolation procedures. Non-limiting examples include buffer solutions, substrates for a color reaction, dyes or enzymatic substrates. In the kit, the aptamer may be provided in a variety of forms, including but not limited to being pre-immobilized onto a support (e.g. solid support), freeze-dried, or in a liquid medium. [0202] A kit herein may be used for carrying out any method described herein. It will be appreciated that the parts of the kit may be packaged individually in vials or in combination in containers or multi-container units. Typically, manufacture of the kit follows standard procedures which are known to the person skilled in the art.Embodiments comprise methods for detecting the presence, absence or amount of SARS-CoV-2 in a sample. In the methods, the sample may be contacted with one or more aptamers described herein. For example, the sample and aptamer(s) as described herein may be incubated under conditions sufficient for at least a portion of the aptamer(s) to bind to a target as defined herein in the sample. [0203] In some embodiments, aptamers can tolerate non-physiological conditions, high temperatures, extreme pH, and organic solvents, and consequently are highly amenable to functionalisation. An aptamer may be labelled with fluorophores, as an example. In some embodiments, aptamers may be labelled with an array of different donor-acceptor molecules. Aptamers may emit signals at differing wavelengths to create a molecular aptamer beacon (MAB) capable of high specific target binding and dose-dependent signal generation. In some embodiments, two separate aptamers herein may comprise a fluorescence resonance energy transfer (FRET) pair of detectable labels. [0204] In some embodiments, an aptamer may comprise a fluorophore at one position of the aptamer and quencher at another. In the absence of SARS-CoV-2, the aptamer may form a structure that brings the fluorophore and quencher pair into proximity to one another, quenching the signal of the fluorophore. Upon binding to SARS-CoV-2, the aptamer may change conformation, separating the fluorophore and quencher sufficiently to allow signal from the fluorophore. [0205] In some embodiments, an aptamer may comprise a fluorophore. An antisense nucleic acid capable of binding the aptamer and comprising a quencher of the fluorophore may be provided with this embodiment. In combination, and in the absence of SARS-CoV-2, the aptamer may bind the oligonucleotide, bringing the fluorophore and quencher pair into proximity to one another, quenching the signal of the fluorophore. Upon binding to SARS-CoV-2, the aptamer may change conformation, separating the fluorophore and quencher sufficiently to allow signal from the fluorophore. [0206] In some embodiments, an aptamer may comprise a quencher. An antisense nucleic acid capable of binding the aptamer and comprising a fluorophore that may be quenched by the quencher on the aptamer may be provided with this embodiment. In combination, and in the absence of SARS-CoV-2, the aptamer may bind the oligonucleotide, bringing the quencher and fluorophore pair into proximity to one another, quenching the signal of the fluorophore. Upon binding to SARS-CoV-2, the aptamer may change conformation, separating the fluorophore and quencher sufficiently to allow signal from the fluorophore. [0207] In some embodiments, an antisense nucleic acid capable of binding an aptamer herein is provided. The antisense nucleic acid may be coupled with a detectable label, fluorophore, or quencher, as described above. The antisense nucleic acid may be provided in combination with an aptamer herein. The combination may be in a composition herein, or a kit herein. The antisense nucleic acid molecule may comprise or consist essentially of, or consist of a sequence complementary to a unique primer region of an aptamer herein. The antisense nucleic acid molecule may comprise or consist essentially of, or consist of a sequence that is complementary to the following nucleic acid sequence: TGTCACATCTACACTGCTCGAAG (SEQ ID NO: 1) [0208] The antisense nucleic acid molecule may comprise or consist essentially of, or consist of a sequence that is complementary to the following nucleic acid sequence: ATTCAGACAGCGTTCCC (SEQ ID NO: 2) [0209] The antisense nucleic acid molecule may bind to one or more of the nucleic acid residues comprised in the primer regions detailed above. For example, the antisense nucleic acid molecule may bind to 1, 2, 3, 4, 5, or more residues in one of the primer regions of the aptamer. [0210] In some embodiments, the antisense nucleic acid molecule is a single stranded RNA molecule. In some embodiments, the antisense nucleic acid molecule is a single stranded DNA molecule. In some embodiments, the antisense nucleic acid molecule comprises one or more modified nucleotides. [0211] In some embodiments, the antisense nucleic acid molecule comprises one of a FRET pair, whilst the aptamer comprises a second of a FRET pair. [0212] Methods of using aptamer and antisense molecule are disclosed herein. Methods of using fluorophores and quenchers are disclosed herein. Methods of using FRET pairs are disclosed herein [0213] An embodiment provides an aptamer capable of binding an epitope of a S1 domain of a spike protein of SARS-CoV-2. The aptamer may bind an epitope of a S1 domain of a spike protein of SARS-CoV-2 comprising amino acids 1 to 664. The aptamer may bind an epitope of a S1 domain of a spike protein of SARS-CoV-2 comprising an amino acid region having a unique stretch of amino acids compared with SARS-CoV. Non-limiting examples of a unique stretch include continuous stretches of amino acids comprising, consisting essentially of, or consisting of 4 to 8 amino acids. The continuous stretches of amino acids may comprise, consist essentially of, or consist of amino acids corresponding to insert region 1, insert region 2, insert region 3, and insert region 4 of the S1 domain of the spike protein of SARS- CoV-2. There stretches of amino acids correspond to the VSGTNGT, KSWM, RSYLTP, and SPRR epitopes of SARS-CoV-2 S1 domain spike protein, respectively (SEQ ID Nos: 16-19). [0214] Compositions comprising, consisting essentially of, or consisting of at least one aptamer, at least two aptamers, at least three aptamers etc.., are provided herein. The aptamer may be made according to the method of selecting for aptamers capable of specifically binding SARS-CoV-2 described herein. The aptamer may be capable of binding an outer surface of SARS-CoV-2. The aptamer may be capable of binding a spike protein of SARS-CoV-2. The aptamer may be capable of binding an S1 domain of the spike protein of SARS-CoV-2. [0215] In some embodiments, the composition comprises a first aptamer which binds to a first epitope of SARS-CoV-2, preferably the S1 domain of SARS-CoV-2 spike protein, and a second aptamer, which binds to a second epitope of SARS-CoV- 2, preferably the S1 domain of SARS-CoV-2 spike protein. The first aptamer may comprise a fluorophore. The second aptamer may comprise a quencher of the fluorophore. The first epitope and the second epitope may be located within a distance from each other in the 3-dimensional structure of SARS-CoV-2 such that a quencher present on one of the first aptamer or the second aptamer may quench a fluorescent signal from a fluorophore present on the other of the first aptamer or the second aptamer. In some embodiments, the first epitope may be a VSGTNGT epitope encoded by amino acids 70 to 77 of insert region 1 of a S1 subunit, and the second epitope may be a RSYLTP epitope encoded by amino acids 247 to 252 of insert region 3 of a S1 subunit. In some embodiments, the physical proximity of the quencher to the fluorophore may reduce the amount of fluorescence emitted in the presence of the target. Each of these insert regions will be repeated a total of three times in the ultimate trimer structure of SARS-CoV-2 virus. [0216] FIG. 4A illustrates a protein model of 3-dimensional structure of the S1 domain of SARS-CoV-2 spike protein. Two insert regions present on an outer region of the S1 protein may include insert region 1 and insert region 3 as described herein. As shown, these two regions are predicted to be in close physical proximity to one another. FIG. 4B illustrates a magnified perspective of the physical relationship between these two insert regions. In some embodiments, the composition comprises FRET pairs. [0217] The composition comprising FRET pairs may comprise a first aptamer which binds to a first epitope of SARS-CoV-2, preferably the S1 domain of SARS-CoV- 2 spike protein, and a second aptamer, which binds to a second epitope of SARS-CoV- 2, preferably the S1 domain of SARS-CoV-2 spike protein. In some embodiments, the first epitope and the second epitope are in physical proximity and may be used as a basis for the transference of signals between the bound aptamers such as a FRET signal. The first aptamer may comprise a fluorophore that is excited at wavelength one and emits at wavelength two. The second aptamer may comprise a fluorophore that is not excited at wavelength one, but is excited at wavelength two such that the emission from an aptamer bound at the first epitope could then be used to excite the aptamer bound at the second epitope. The aptamer bound at the second epitope may emit at wavelength three. In this embodiment, the second fluorescence signal would only be present when both aptamers are bound to a SARS-CoV-2 protein. [0218] The first epitope and the second epitope may be located within a distance from each other in the 3-dimensional structure of SARS-CoV-2 such that upon excitation at wavelength one, the first fluorophore will emit at wavelength two to excite fluorophore two to emit at wavelength three. In some embodiments, the first epitope may be a VSGTNGT epitope encoded by amino acids 70 to 77 of insert region 1 of a S1 subunit, and the second epitope may be a RSYLTP epitope encoded by amino acids 247 to 252 of insert region 3 of a S1 subunit. [0219] Non-limiting examples of FRET pairs include but are not limited to be 4- (4'-dimethylaminophenylazo) benzoic acid (DABCYL) and TAMRA, QD490 and doxorubicin, Cy5 and BHQ2, Cy3 and FITC, silver nanoclusters and BHQ2, fluorescein and tetramethylrhodamine; rhodamine 6G and malachite green, and FITC and thiosemicarbazole. [0220] Methods of using aptamer and antisense molecule are disclosed herein. Methods of using fluorophores and quenchers are disclosed herein. Methods of using FRET pairs are disclosed herein. [0221] Compositions comprising a plurality of aptamers or aptamer conjugates are disclosed herein. The composition can comprise one or more, two or more, three of more (etc) aptamers. The composition herein may further comprise at least one of water, salts, a polar aprotic solvent, organic solvents, DMSO, methanol, ethanol, one or more buffers, a detergent, a surfactant, 0.1% Tween, or BSA. [0222] Methods of using the aptamers (or aptamer conjugates) according to the disclosure disclosed herein are directed to detecting SARS-CoV-2 on a surface. In some embodiments, the aptamers may be used to detect SARS-CoV-2 virus in real- time. Methods of detecting the presence or absence of SARS-CoV-2 virus may comprise: a) contacting one or more aptamer with a location of interest, wherein the location of interest is one being interrogated for the presence of SARS-CoV-2; b) allowing the aptamer to bind to SARS-CoV-2 virus, if present; c) optionally washing the location of interest to remove any unbound aptamer; and d) visualizing the aptamer bound to SARS-CoV-2 virus. In some embodiments, the methods of detecting the presence or absence of SARS-CoV-2 virus may comprise: a) allowing one or more aptamer to bind to SARS-CoV-2 virus, if present, at a location of interest; b) optionally washing the location of interest to remove any unbound aptamer; and d) visualizing the aptamer bound to SARS-CoV-2 virus. [0223] In some embodiments, the surface may be an inorganic surface. An inorganic surface may be any surface of a non-living being. The surface can be solid or porous. Non-limiting examples of an inorganic surface include metal surfaces, cardboard surfaces, plastic surfaces (including those made of organic molecules), textiles, carbon-based materials, bed linen, medical equipment, clothing, floors, walls, and the like. In some embodiments, the surface may be an organic surface. In some embodiments, an organic surface may be that of a being infected (during and after infection) with SARS-CoV-2. Non-limiting examples of an organic surface include biological tissue (e.g. skin, biopsy surface), blood plasma, respiratory tract fluid, and other. [0224] In some embodiments, the aptamers disclosed herein may be used as an anti-viral agent. In some embodiments, the aptamers according to the disclosure disclosed herein may be used as carriers to deliver disinfection agents to selectively inactivate and/or kill SARS-CoV-2 virus. [0225] Other methods of use for detection may include detection in human and animal food production. [0226] In some embodiments, methods of using one or more aptamers herein may utilize direct interference to exert an effect on the virus. Non-limiting examples include, inhibiting viral enzymes, interfering with viral coats, and disrupting viral life cycle (for example, disrupting reverse transcription, chromosomal integration, proteolytic processing, viral expression, packing, and entry). In some embodiments, the method of using one or more aptamers herein may impede the capacity of the virus to bind to the ACE2 receptor. [0227] In an aspect of the disclosure, there is provided a method of detecting the presence, absence and/or concentration of a plurality of viral particles on a surface, wherein the viral particle comprises a target molecule and wherein the method comprises: a) contacting a surface suspected having viral particles located thereon with an aptamer or aptamer conjugate which is capable of specifically binding the target molecule; and b) determining the presence, absence and/or concentration of viral particles on the surface. [0228] In some embodiments, the target molecule is a surface protein of the viral particle. In some embodiments, the target molecule is an epitope of a spike protein of a coronavirus. In some embodiments, the target molecule is an epitope of a spike protein of a SARS-CoV-2 virus particle. [0229] In some embodiments, the step of determining the presence, absence and/or concentration of viral particles on the surface comprises detecting viral particles on the surface. [0230] In some embodiments, the method comprises utilising the detection methods and method steps as described herein. [0231] The aptamers of certain embodiments may act as detection agents by binding to SARS-CoV-2 virus particles and being detected via one or more of the detection methods described herein. [0232] Embodiments provide a system, a method or compositions which combines a higher level of specificity for the detection of SARS-CoV-2 as distinct from other coronaviruses and a detection system that comprises two independent and specific binding events as a basis for a signal. [0233] Embodiments may be based on an analysis of variation in the spike protein from SARS-like and MERS-like coronaviruses derived from both humans and other hosts and the determination that the variation in the inserted regions described herein for SARS-CoV-2 are unique to SARS-CoV-2. [0234] In certain aspects of the present disclosure, the aptamers as described herein are for use in a method of detecting the presence, absence and/or determining concentration of SARS-CoV-2 viral particles. In some embodiments, the aptamers are for use in detecting the presence, absence and/or determining concentration of SARS- CoV-2 viral particles located on a surface. The method may involve the direct or indirect contact of a composition comprising the aptamer described herein with the surface. Indirect contact may be via a collecting element which is brought into contact with the surface and subsequently brought into contact with the aptamer. [0235] In an aspect of the present disclosure, there is provided a method of determining the presence, absence and/or concentration of SARS-CoV-2 viral particles in a sample, the method comprising: a) contacting the sample with an aptamer as described herein; wherein the contact is direct or indirect contact; and b) determining the presence, absence and/or concentration of SARS-CoV-2 viral particles in the sample. [0236] In some embodiments, the step of determining comprises determining whether the aptamer or aptamer conjugate is bound a SARS-CoV-2 viral particle. [0237] In some embodiments, the step of determining comprises detecting binding of the aptamer or aptamer conjugate to a SARS-CoV-2 viral particle, wherein detection of the bound aptamer indicates the presence of a SARS-CoV-2 viral particle in the sample. [0238] In a further aspect of the present disclosure, there is provided a method of detecting the presence, absence and/or determining the concentration of SARS-CoV- 2 viral particles located on a surface, the method comprising: a) contacting the surface directly or indirectly with an aptamer as described herein; and b) determining the presence, absence and/or concentration of SARS-CoV-2 viral particles on the surface. [0239] In some embodiments, the step of determining comprises determining whether the aptamer or aptamer conjugate is bound to a SARS-CoV-2 viral particle. [0240] In some embodiments, the surface is a surface suspected of having SARS- CoV-2 viral particles located thereon. [0241] In some embodiments, the step of determining comprises detecting binding of the aptamer or aptamer conjugate to a SARS-CoV-2 viral particle, wherein detection of the bound aptamer indicates the presence of a SARS-CoV-2 viral particle on the surface. [0242] In some embodiments, the method comprises detecting the presence of the aptamer or aptamer conjugate bound to the SARS-CoV-2 viral particle, wherein detection of the bound aptamer indicates the presence of a SARS-CoV-2 viral particle in the sample. [0243] In some embodiments, the method comprises detecting the amount of aptamer-SARS-CoV-2 viral particle complexes present. In some embodiments, the method comprises detecting the presence, absence and/or determining the concentration of SARS-CoV-2 viral particles by photonic detection, electronic detection, acoustic detection, electrochemical detection, electro-optic detection, enzymatic detection, chemical detection, biochemical detection or physical detection. Further details of exemplary detection systems are provided herein. [0244] The surface may be an inanimate surface. The surface may be for example a surface located in a healthcare setting (e.g., a hospital, a pharmacy, a doctor’s surgery and/or care home facility). The aptamers may be for use in detecting SARS- CoV-2 viral particles located on a surface of an object in an environment such as a school, a prison, a hostel, a dormitory, a train, a bus, an airplane etc. [0245] The surface may be located on an object in a location such as a hospital or other healthcare setting. For example, the object may be an operating table, a hospital bed, a surgical instrument, a table, operating scrubs, a refuse container, eating utensils, a chair, a door handle, a door knob, etc. Alternatively, or in addition, the surface may be located in a location such as walls, ceilings and/or floors in hospital wards, operating theatres, care home rooms, and the like. [0246] In some embodiments, the surface may be a surface of an object in a community setting for example a shop, a bar and/or a restaurant. The surface may be located on a wall, a floor, an item of furniture, cutlery, packaging, drinking vessels and the like. [0247] In some embodiments, the surface is located in a household environment. In some embodiments, the surface is located in a food production facility. [0248] In some embodiments, the surface is composed on stainless steel. In some embodiments, the surface is composed of cardboard. In some embodiments, the surface is composed of paper. In some embodiments, the surface is composed of plastic. In some embodiments, the surface is composed of glass. In some embodiments, the surface is composed of cloth. [0249] In some embodiments, the method comprises contacting a surface with a composition comprising one or more aptamers according to the present disclosure. In other embodiments, the method comprises contacting a composition comprising one or more aptamers according to the present disclosure with a surface. That is to say, in some embodiments, the method comprising applying a composition comprising the one or more aptamers to the surface. In some embodiments, the method comprises contacting a composition comprising one or more aptamers according to the present disclosure with a surface indirectly. [0250] In some embodiments in which the aptamer is contacted with the surface directly, the method may comprise providing the aptamer in a composition which is capable of being dispersed across the surface. In some embodiments, immediate contact with the surface dispersed uniformly for maximum surface area coverage and wettability facilitates the accessibility of aptamer(s) to target molecules on the SARS- CoV-2 viral particle. [0251] Most environmental surface areas are neutral (uncharged) or have negative electrostatic energy. In some embodiments, the aptamer is applied to a target surface area using electrostatic force of attraction. It is considered that electrostatically applied liquids have a wrapping effect, so that complex objects and areas hidden from the line of sight get coated with the liquid. [0252] Based on Coulomb’s law, an electrostatic application system applies aptamer/buffer solutions more evenly to all surfaces. Coulomb’s law states that the magnitude of the electrostatic force of interaction between two-point charges is directly proportional to the scalar multiplication of the square of the distance between them. The force is along the straight line joining them. Charged spray droplets are attracted to surfaces and are considered to have an enveloping effect around the object to insure all sides are covered. [0253] Using Coulomb’s law, the systems and methods provided herein place a positive or negative charge on the chemical solution as it leaves the spray nozzle. Because most surface areas are neutral or negative, a positively charged electrostatic spray application system optimizes adhesion and attraction. The dispersed droplets may spread out more evenly and seek out the negative (-) or neutrally charged surface. Thus, in some embodiments, the composition comprising the aptamers as described herein is more targeted and provides more consistent coverage with less waste. [0254] In some embodiments, the method comprises applying a composition comprising an aptamer to a surface by a spray gun modified with an electrode. The electrode charges liquid droplets comprising the aptamers which are then guided to the surface, which is typically oppositely charged to the aptamers. [0255] In some embodiments, the method comprises producing a composition comprising the aptamer. In some embodiments, the aptamers are provided in a dried form and are dissolved completely to a desired stock concentration with a buffer solution or dH2O. This may be achieved by, for example, shaking the composition for a predetermined period of time (e.g., 20 minutes, 25 minutes, 30 minutes or more, e.g., 35 minutes, 40 minutes, 45 minutes or greater). The composition may comprise an organic solvent (e.g., DMSO, ethanol and/or methanol). Additionally, the composition may comprise a salt such as for example a sodium ion. [0256] In some embodiments, the method comprises dissolving the aptamer in a buffer solution. The buffer solution may be selected from, for example PBS, HEPES, Tris etc. Typically, aptamers are stable at neutral pH range (7.0-8.0). A heating and a cooling step may be performed for the proper folding of aptamer structure in a buffer solution (for example heating at 95 °C for 5 min followed by slow cooling to room temperature). In some embodiments, the method comprises providing a 2+ ion such as magnesium in the buffer solution. Divalent ions such as magnesium may be advantageous in some embodiments to maintain a proper structure of the aptamer. [0257] Nucleic acid aptamer in the binding buffer condition (pH 7.4) is negatively charged and through electrostatic interactions the aptamer could favor binding to positively charged areas. To avoid this interaction with aptamer/buffer and container the use of anti-static treated materials (e.g., plastic and glass vessels) are important. Typically, the sprayer will be made of plastics. [0258] In some embodiments, the method comprises applying a composition comprising the aptamer to the surface by spraying the surface. [0259] In some embodiments, the aptamers may be freeze-dried prior to being sprayed onto the surface. Thus, in some embodiments the method comprises a step of contacting the surface with a freeze dried composition comprising the aptamer as described herein. [0260] During the spray freezing step, the aptamer dissolved or suspended in liquid is atomized into fine droplets which are frozen instantaneously by a cryogenic fluid, usually liquid nitrogen. Subsequently, the frozen particles are subjected to freeze drying, in which the solvents are sublimed at low temperature and pressure, leading to the formation of dried porous particles. Porous particles with large physical size and low density exhibit small aerodynamic size, which can promote high flowability. The small contact surface area to volume ratio leads to low cohesion force between particles, thereby facilitating dispersibility in air. In addition, porous particles have high specific surface area, thereby enhancing dissolution rate. [0261] In some embodiments, the method comprises dissolving freeze-dried aptamers in a solution prior to contacting the surface with a liquid solution. [0262] In some embodiments, the method of detecting SARS-CoV-2 viral particles at a location, e.g. a surface, may comprise applying one or more of the aptamers of the disclosure to a location suspected of comprising SARS-CoV-2 viral particles. Following a predetermined period of time sufficient to permit the aptamer binding to SARS-CoV-2 viral particles, the surface may be washed one or more times to remove any unbound aptamer. In some embodiments, e.g. when a FRET pair is used, or beacon as described herein, the washing step is not required. [0263] In some embodiments, for use on environmental surfaces such as stainless steel, polystyrene and other surfaces the aptamers are designed to attach to the target i.e. a SARS-CoV-2 viral particle and fluoresce. The aptamers will not fluoresce by attaching to the inorganic surface alone. Therefore, concentration of aptamers in a composition e.g. a buffer solution is important. [0264] The concentration of aptamer for use in some embodiments can be calculated using the following exemplary equation: [0265] Equation 1: Aptamer/target binding equation d[AT]/dt= ka[A][T]-kd[AT] where [A] represents concentration of free aptamer; [T] represents concentration of free target; [AT] represents aptamer bound to target, ka = the on rate for complex formation and kd = the rate at which the complex comes apart. [0266] The system can be described in full as follows: d[A]/dt = -ka[A][T]+kd[AT] d[T]/dt = -ka[A][T]+kd[AT] d[AT]/dt=ka[A][T]-kd[AT] [0267] This system of linked differential equations can be solved numerically from their initial settings (presence of aptamer, presence of target, and no complex) to their concentrations at equilibrium. Thus, the concentration of aptamer provided in a composition for use in the method of detecting SARS-CoV-2 can be calculated using the above equations. Detection [0268] In order to detect the presence of the target i.e. SARS-CoV-2, on a surface, a detection system may be utilised. Various exemplary detection systems are described herein. [0269] In some embodiments the aptamer comprises a detection molecule e.g. a fluorophore. In some embodiments, the detection molecule emits energy in the visible spectrum. In some embodiments, the detection molecule is a near-infrared fluorophore that emits in the range of between 650 and 900 nm. In some embodiments, the detection molecule emits in the range of between 450 and 650 nm. Further details of exemplary fluorophores are provided herein. [0270] In some embodiments, the method further comprises a step of washing the surface subsequent to step (a) and prior to step (b). [0271] In some embodiments, the method comprises the use of a FRET system to detect the presence of SARs-CoV-2 on a surface. [0272] Fluorescence resonance energy transfer (FRET) is a non-radiative energy transfer that occurs over nanometer scale distance (up to 10 nm) between a donor fluorophore molecule and an acceptor molecule, often termed a “FRET pair”. When a FRET pair is proximal to one another and correctly oriented, the luminescence spectrum of the donor overlaps with the absorption spectrum of the acceptor, resulting in an energy transfer. This transfer of energy results in a quenching of the donor emission and is typically re-emitted by the acceptor at a longer wavelength. In the presence of the target e.g. the SARS-CoV-2 viral particle, competitive binding/hybridization of the recognition domain with the target molecule results in dose-dependent separation of the stem-loop hairpin. Consequently, the FRET quenching signal is altered in a dose-dependent manner. [0273] The intensity of donor emission is dependent on several factors, including the distance and the dipole orientation between the fluorophores, the overlap of the emission and absorbance spectra with the acceptor molecule, and the refractive index of the solvent. However, while multiple factors influence FRET, the principle conditions required for FRET are relatively few. The donor and acceptor molecules must be in close proximity to one another (typically 10-100 Å). The absorption/excitation spectrum of the acceptor molecule must overlap the emission spectrum of the donor molecule. The donor and acceptor transition dipole orientations must be approximately parallel. Assuming the donor acceptor pairs are compatible, the most critical element necessary for FRET to occur is proximity of the pair. The efficiency of the process (E) depends on the inverse sixth-distance between donor and acceptor. [0274] This can be described in the equation, E = Ro6/(Ro6 + R6), where Ro is the ‘Forster distance’ – the distance between donor and acceptor at which energy transfer is 50%, and where R is the actual distance between donor and acceptor. The magnitude of Ro is dependent on the spectral properties of the donor and the acceptor. E is typically expressed as a percentage and offers an intuitive measure that corresponds to the fractional reduction in donor fluorescence intensity. [0275] In some embodiments, aptamers can tolerate non-physiological conditions, high temperatures, extreme pH, and organic solvents, and consequently are highly amenable to functionalisation. Thus, aptamers can be labelled with an array of different donor-acceptor molecules and emit signals at differing wavelengths to create a molecular aptamer beacon capable of high specific target binding and dose- dependent signal generation. In some embodiments, the aptamer may comprise a FRET pair of molecules. In some embodiments, the aptamer may comprise a donor molecule at one end of the aptamer and an acceptor molecule at the other. In the absence of a target, these probes are designed to form stem-loop hairpin structures that bring the donor-acceptor pair into proximity to one another, quenching the signal of the donor molecule. [0276] Typically, molecular aptamer beacons rely on a “closed” conformation when the target is absent enabling stem-loop formation and allowing interaction of the functionalized termini. Target binding denatures the stem and activates/changes the signal. This method of action is termed “target-induced structure switching”. As with molecular beacons, terminal signalling is often provided by FRET interactions that provide distance-dependent signal attenuation or wavelength shift in the absence of the target. [0277] In some embodiments, the aptamer comprises a FRET pair. Further details of exemplary FRET pairs are provided herein. [0278] In some embodiments, the method comprises the use of a detection molecule such as an antisense nucleic acid molecule. [0279] In some embodiments, the detection molecule comprises an antisense nucleic acid molecule which comprises a nucleic acid sequence which is at least partially complementary to a nucleic acid sequence of the aptamer. In some embodiments, the antisense nucleic acid molecule comprises or consists essentially of a nucleic acid sequence which is complementary to, and is capable of binding to at least a portion of the following nucleic acid sequence: TGTCACATCTACACTGCTCGAAG (SEQ ID NO: 1) [0280] In some embodiments, the antisense nucleic acid molecule comprises or consists essentially of a nucleic acid sequence which is complementary to and is capable of binding to at least a portion of the following nucleic acid sequence: ATTCAGACAGCGTTCCC (SEQ ID NO: 2) [0281] The antisense nucleic acid molecule may bind to one or more of the nucleic acid residues comprised in the primer regions detailed above. For example, the antisense nucleic acid molecule may bind to 1, 2, 3, 4, 5, or more residues in one of the primer regions of the aptamer. [0282] In some embodiments, the antisense nucleic acid molecule is a single stranded RNA (ssRNA) molecule. In some embodiments, the antisense nucleic acid molecule is a single stranded DNA (ssDNA) molecule. In some embodiments, the antisense nucleic acid molecule comprises one or more modified nucleotides. [0283] In some embodiments, the antisense molecule may comprise one or more missense mutations such that certain nucleic acid residue position(s) are not complementary to the aptamer sequence. Missense mutations of the antisense molecule may be introduced to create antisense molecules which have varying affinity for the aptamer. [0284] In some embodiments, the antisense nucleic acid molecule comprises one of a FRET pair, whilst the aptamer comprises a second of a FRET pair. Further details of exemplary FRET pairs are provided herein. [0285] In some embodiments, the aptamer comprises a fluorophore attached thereto, and the antisense nucleic acid molecule comprises a quencher molecule attached thereto. [0286] In some embodiments, the aptamer comprises a quencher attached thereto, and the antisense nucleic acid molecule comprises a fluorophore attached thereto. [0287] In some embodiments, the amount of aptamer and antisense molecule in a fluorophore-quencher system as described herein, may be calculated using the following equation: dx1=-a*x1*x2+b*x4-c*x1*x3+d*x5 dx2=-a*x1*x2+b*x4 dx3=-c*x1*x3+d*x5 dx4=a*x1*x2-b*x4 dx5=c*x1*x3-d*x5 wherein x1, x2, x3, x4, x5 represent the concentrations of free aptamer, free target, free antisense, complex between target and aptamer, and complex between aptamer and antisense, and wherein; a = kon for aptamer and target complex formation b = koff for aptamer and target complexes c = kon for aptamer and antisense complex formation d = koff for aptamer and antisense complexes [0288] Thus, in an exemplary system, the aptamer may exhibit a kon for both target and antisense of 1xE5, and a koff for the antisense of 1xE-1, and for the target of 1xE-3, and a concentration of 1xE-7 M of aptamer is used and a concentration of 1xE-7 of the target, the optimal concentration of antisense can be plotted as shown in FIG. 5, which plots the effect of different concentrations of antisense in the presence (1xE-7 M) and absence of target (SARS-CoV-2). [0289] As more antisense nucleic acid molecule is added, the background fluorescence is decreased and is the fluorescence associated with the signal. At an equimolar amount of antisense there is a lot of background fluorescence and very little difference in the presence of target. [0290] FIG. 6 illustrates the proportional difference in fluorescence between the presence and absence of target as a function of antisense concentration. [0291] The fluorescence is presented indirectly in terms of the concentration of free aptamer and aptamer bound to target. The total amount of aptamer stays the same regardless of antisense concentration. Aptamer bound to antisense is quenched, so it does not contribute to fluorescence. [0292] Thus, the relationship between fluorescence observed and aptamer concentration can determine the location on the curve shown in FIG.6, for example. The threshold for detection will enable the highest antisense concentration that can be used to be determined. In some embodiments, the simulation can be used to optimise a signal/noise ratio in which the signal is as close to zero as possible in the absence of the target, but which is detectable in the presence of the target. In the context of the present disclosure, the term “target” can be used to refer to e.g. the viral particle and more specifically the target molecule of the viral particle e.g. an epitope of the spike protein of SARS-CoV-2. [0293] In the absence of target, there will be little background signal from the aptamer. The abundance of the target would be positively correlated with an increase in fluorescence being expressed by the aptamer as a function of displacement of the antisense, and a loss of quenching capacity. [0294] In some embodiments, wherein the detection molecule comprises an antisense nucleic acid molecule as described herein, the antisense nucleic acid molecule may comprise a quencher molecule. In some embodiments, the single stranded antisense nucleic acid molecule comprises a plurality of quencher molecules. [0295] Reference to a quencher molecule herein may include by way of example quencher molecules selected from the group consisting of Black Hole Quencher molecules (Sigma-Aldrich). BHQ-1 is a quencher which is sold under Catalog Reference Number 26-6472 from GeneLink for example and has an absorbance maximum of 534 nm and an effective absorbance range of 480-580 nm. It is typically paired with fluorescent dyes that emit in the yellow-green part of the visible range (519-556 nm). [0296] In some embodiments, the quencher molecule is provided in a molar excess. [0297] In such embodiments, the aptamer may comprise a fluorophore attached thereto. The fluorophore may be selected from the group consisting of: FAM, TET, HEX, TAMRA, Texas Red and Cy5. [0298] In some embodiments, the FRET pair may be DABCYL and TAMRA. [0299] In some embodiments, the FRET pair may be QD490 and doxorubicin. [0300] In some embodiments, the FRET pair may be Cy5 and BHQ2. [0301] In some embodiments, the FRET pair may be Cy3 and FITC. [0302] In some embodiments, the FRET pair may be silver nanoclusters and BHQ2. [0303] In some embodiments, the fluorophore may be, for example, 5- (2'- aminoethyl) aminonaphthalene-1-sulfonic acid ("EDANS"), fluorescein or anthranilamide. The quencher may be, for example, a chemical group such as 4- (4'- dimethylaminophenylazo) benzoic acid ("DABCYL"), rhodamine or eosin. [0304] As used herein, “QD” refers to quantum dot; Cy5 refers to cyanine5; BHQ2 refers to black hole quencher 2; TAMRA refers to tetramethylrhodamine; DABCYL refers to 4-(4-dimethylaminophenylazo)-benzoic acid; Cy3 refers to cyanine3; and FITC refers to fluorescein isothiocyanate. [0305] In some embodiments, the detection molecule comprises a quantum dot. Quantum dots may have a broad absorbance and narrow emission spectra. They may also be photochemically stable. A quantum dot may be attached to either the aptamer or the antisense nucleic acid molecule e.g. by an amide bond. When the quantum dot and the quencher are separated by binding of the aptamer to the SARS-CoV-2 target, the quantum dot fluorescence is de-quenched and observable by a fluorescent reader or visible by eye. An exemplary method of making the quantum dot-aptamer complexes may include: [0306] Either the aptamer contains a 5′ amine and the complementary 3′ quencher or the aptamer contains a 3′ quencher and the complementary strand 5′ amine. Further a 3′ amine could be used with a 5′ quencher. The strands can be annealed in 10 mM NaCl, 0.1 M MOPS buffer, pH 7.0 by heating to 85 °C for fifteen minutes in a water bath and while still in the water bath cooled to room temperature. Strands can be stored refrigerated. The annealed strands can be conjugated to quantum dots such as but not limited to T1 or T2 Carboxyl Birch Yellow quantum dots. These dots and strands may be mixed with a molar ratio of approximately 8 duplex DNA strands per dot. [0307] In some embodiments, the quantum dot is selected from the group consisting of CdS, CdTe, CdTe/ZnS, CdSe and CdSe/ZnS-based quantum dots. The optical properties of quantum dots can often be tuned directly by size or monolayer of shell growth. In some embodiments, the quantum dot may be functionalised. Exemplary functionalised quantum dots include e.g. silica functionalised SiO2- CdZnSeS quantum dots and thioglycolic acid (TGA)-capped CdZnSeS/ZnSe1.0S1.3 alloyed quantum dots. [0308] Various quantum dots can be obtained from e.g. ThermoFisher Scientific. In some embodiments in which quantum dots are used as a detection molecule, the quencher molecule may be a gold nanoparticle. In some embodiments, the quencher molecule may be graphene. The gold nanoparticle may be selected from a nanosphere, a nanoshell and a nanorod. Gold nanoparticles typically have a particle size distribution between 1 nm and 100 nm. In some embodiments, the gold nanoparticles are functionalised on the surface. [0309] In some embodiments, the method further comprises contacting the surface (directly or indirectly) with reflective photonic crystals. The photonic crystals may enhance signal intensity within a predetermined wavelength range. Photonic crystals are materials that change the optical properties of incident light and create a forbidden gap in the photonic band structure. [0310] In some embodiments, the method comprising detecting the loss of quenching as a result of the aptamer binding to the target. The step of detecting may comprise illuminating the location. [0311] In some embodiments, the method comprises detecting binding of the aptamer to a SARS-CoV-2 viral particle using a light source, such as a laser; focusable optics, such as a lens; filters or monochromators to effect changes in the spectrum of excitation or fluorescence emission; and a CCD camera or a single photon count detector to measure fluorescence. [0312] The method may comprise a set of conditions for illuminating the location using a light source. In some embodiments, the light source may be in the form of a forensic light source. In some embodiments, the light source may be in the form of a Polilight® Flare. [0313] In some embodiments, the light source may be capable of switching between different wavelengths, each wavelength being suited to a specific interchangeable filter. The forensic light source may be in the form of a LED, laser, Polilight® or the like. In some embodiments, the light source is a handheld light source. In some embodiments, the handheld light source may be a Polilight Flare+2, which is a battery operated, handheld LED light source, available from e.g. Rofin Forensic. [0314] In some embodiments, each Polilight Flare “torch” may produce light
Figure imgf000064_0001
a specified wavelength range. For example, in some embodiments, the light source may produce light at a wavelength of between about 360 nm – 385 nm (UV light). In some embodiments, the light source may produce light at a wavelength of between about 405 nm – 420 nm. In some embodiments, the light source may produce light at a wavelength of between about 435 nm – 465 nm. In some embodiments, the light source may produce light at a wavelength of between about 485 nm – 515 nm. In some embodiments, the light source may produce light at a wavelength of between about 510 nm – 545 nm. In some embodiments, the light source may produce light at a wavelength of between about 530 nm – 560 nm. In some embodiments, the light source may produce light at a wavelength of between about 585 nm – 605 nm. In some embodiments, the light source may produce light at a wavelength of between about 615 nm – 635 nm. In some embodiments, the light source may produce light at a wavelength of between about 400 nm – 700 nm. In some embodiments, the light source may produce light at a wavelength of between about 835 nm – 865 nm. In some embodiments, the light source may produce light at a wavelength of between about 935 nm – 965 nm. [0315] In some embodiments, the light source used may be compatible with a detectable molecule conjugated to the aptamer. In some embodiments, the aptamer will be conjugated to a detection molecule. In some embodiments, the detection molecule may be a fluorophore which emits in a spectral range which corresponds to the output of the light source. In some embodiments, the aptamer may be conjugated to a fluorophore which emits at a wavelength of about 505 nm. In some embodiments, the light source produces light having a wavelength of about 505 nm. [0316] In some embodiments, the method may comprise the use of a bandpass filter in combination with the light source. The bandpass filter may be configured to transmit light of a certain wavelength band and reject stray light outside the predetermined wavelength band. In some embodiments, the light source is configured to produce narrow bands of light having centre wavelengths of 365 nm, 415 nm, 450 nm, 505 nm, 530 nm, 545 nm, 620 nm, and 850 nm. In some embodiments, the light source is configured to produce narrow bands of light having a center wavelength of 505 nm, in addition to white light wavelengths. In some embodiments, the bandpass filter is a 590 nm bandpass filter. [0317] In some embodiments, the method may further comprise visualising the location of the surface with viewing goggles, glasses, or the like. In some embodiments, the viewing goggles are of a colour which corresponds to the colour of light produced by the light source and emitted by the detection molecule conjugated to the aptamer. In some embodiments, the goggles are orange and thus are suitable for use in combination with a light source which produces light having a wavelength of between about 485 nm – 515 nm, e.g. 505 nm, and an aptamer which comprises a detection molecule that emits at a wavelength of approximately 505 nm. [0318] In some embodiments, the method comprises detection of the SARS-CoV-2 viral particle via a colorimetric detection system. For example, in some embodiments the aptamer is conjugated to a gold nanoparticle (GNP). In some embodiments, the method comprises contacting the surface with a composition comprising an aptamer conjugated to a gold nanoparticle. The gold nanoparticle may be selected from a nanosphere, a nanoshell and a nanorod. Gold nanoparticles typically have a particle size distribution between 1 nm and 100 nm. In some embodiments, the gold nanoparticles are functionalised on the surface. [0319] If the SARS-CoV-2 viral particle is present on the surface, and located by the collecting element, the aggregation of the GNPs will cause a visible shift in the colour of the solution. In some embodiments, the collecting element may be a cotton swab. The GNPs aggregate in the presence of a target because the aptamers binding to the target bring them into physical proximity with each other. The method may comprise detecting the colour shift of the solution directly by eye. Alternatively, the colour shift may be detected using a spectrophotometer. [0320] In some embodiments, the method comprises the use of graphene-gold nanoparticle complexes which have a peroxidase-like activity, mediating a catalytic reaction associated with colour change upon addition of substrate (3,3′,5,5′ tetramethylbenzidine). In this system, the ssDNA aptamer prevents the peroxidase substrates from contacting the active interface and depresses the catalytic ability of the graphene-AuNPs. However, catalytic activity is recovered when viruses are present because the combination of the aptamer and virus reduces the hindrance to catalysis. Finally, addition of 3,3′ ,5,5′ tetramethylbenzidine allows visualisation of the result. The resulting colour changes may be highly correlated to the amount of virus. [0321] In some embodiments, the method comprises the use of detection molecules such as intercalating dyes (for example, cyber green, ethidium bromide, and others known in the art), or bioluminescent proteins as energy donors combined with dark quenchers, graphene oxide (GO), carbon nanostructures, enzymes and redox-active mediators. [0322] In some embodiments, the method comprises the use of a DNA intercalating dye such as but not limited to 1,1′-(4,4,7,7-tetramethyl-4,7-diazaundecamethylene)- bis-4-[3-methyl-2,3-dihydro-(benzo-1,3-thiazole)-2-methylidene]-pyridinium tetraiodide (BOBO-3). The intercalating dye acts as a FRET acceptor and may be for use with a FRET pair member such as a quantum dot. BOBO-3 intercalated into the double-stranded stem portion of the beacon and is a FRET acceptor of the QD emission in the absence of target. When the target is present, the duplex form of the aptamer results in release of BOBO-3 and direct QD emission. [0323] In some embodiments, Ag-SiO2 nanoparticles may be used as a detection molecule as part of a detection system. The detection system may also comprise thiazole orange. Thus, in some embodiments, when the SARS-CoV-2 viral particle is bound by the aptamer, the conformation of the aptamers change into a G-quadruplex structure, causing thiazole orange fluorescence. In some embodiments, a composition comprising one or more aptamer conjugates and graphene oxide (GO) is provided. Graphene oxide self-assembles into two-dimensional sheets in an aqueous environment (See He et al., Chemical Physical Letters, Volume 287, Issues 1–2, 24 April 1998, Pages 53-56). In some embodiments, the composition is a suspension. In some embodiments, the composition comprises a buffer. In some embodiments, the composition further comprises a blocking agent to minimize or eliminate non-specific binding. In some embodiments, the blocking agent includes, but is not limited to, polyethylene glycol (PEG) (including polymeric chain of various lengths), Tween (e.g., Tween 20, Tween 40, Tween 80), nucleic acid (e.g., oligonucleotides, sheared salmon sperm DNA), polyvinyl pyrrolidine or any blocking agent known in the art. [0324] In some embodiments, there is provided a method of detecting the presence or absence of SARS-CoV-2 comprising: a) Providing one or more aptamer conjugates comprising one or more aptamers described herein, wherein the aptamer is conjugated to a detectable moiety. b) Combining the aptamer conjugates with a pre-determined concentration of graphene oxide; c) Contacting the aptamer conjugates-graphene oxide combination with a sample to be tested; d) Visualizing the detectable moiety of the aptamer conjugate bound to a SARS-CoV-2 protein. [0325] In some embodiments, the detectable moiety comprises a fluorescent moiety and visualization comprises visualizing and/or measuring the level of fluorescence. In some embodiments, the detectable moiety comprises biotin having a binding affinity for streptavidin protein conjugates, such as streptavidin/horseradish peroxidase and visualization comprises visualizing using a colorimetric reaction. In some embodiment, the detectable moiety gold nanoparticles conjugated to the aptamer and visualization comprises visualizing using a colorimetric assay. In some embodiment, the detectable moiety comprises a quantum dot, that fluoresces. [0326] In some embodiments, the visualizing step comprises imaging the sample. In some embodiments, the visualizing step comprises measuring the level of fluorescence. In some embodiments, the visualizing step comprises comparing the fluorescence level to a negative control sample. In some embodiments, the method does not comprise a washing step. [0327] In some embodiments, the method further comprises the step of incubating the aptamer conjugates with the sample for a predetermined period of time to allow the aptamer conjugate to bind to SARS-CoV-2 if present. [0328] In some embodiments, the sample is contacted first with a blocking agent and subsequently with the combination of aptamer conjugates-graphene oxide. [0329] In some embodiments, the sample is a solid surface. [0330] In some embodiments, the methods comprises spraying, immersing, fogging, vaporizing, coating, adding an aliquot of the solution directly either by pouring, or swabbing, or with a pipetting device to a sample with the composition comprising one or more aptamer conjugates and graphene oxide. [0331] In some embodiments, the composition comprises one or more different aptamers having a binding affinity to the same binding region of SARS-CoV-2. In some embodiments, the composition comprises one or more different aptamers having a binding affinity to one or more different binding regions of SARS-CoV-2. In some embodiments, each aptamer can comprise a different detectable moiety. [0332] Graphene oxide is prepared from graphene by the exposure of graphene to oxygen donor sources such as NaNO3, H2SO4, H3PO4 and KMnO4. In some embodiments, the graphene oxide comprises an oxygen content of about 36%. In some embodiments, the graphene oxide comprises an oxygen content greater than 35%, for example about 44-45%. [0333] The graphene oxide once formed self-assembles into two-dimensional sheets of varying sizes. In some embodiments, the total surface area of the graphene oxide is about 736.6 m2/g. In some embodiments, the total surface area can be calibrated based on the amount of graphene oxide used and/or on the level of fluorescence quenching. Without being bound to any theory, determination of the appropriate amount of GO to be used for a desired level of aptamer quenching can be a consideration of the total surface area of the GO in the solution. [0334] In some embodiments, the graphene oxide is in the form of nanoparticles. In some embodiments, the average size of the nanoparticles is 10 to 500 nm. [0335] Aptamers (APT) adhere to the graphene oxide (GO) sheets based on Van der Waals forces and hydrogen bonds. In some embodiments, when a detectable moiety such as a fluorescent moiety is conjugated to the aptamer, the fluorescence of the fluorescent moiety is quenched by the association with the graphene oxide surface. [0336] Without being bound to any theory the aptamer dynamically binds and unbinds to the GO very rapidly. The presence of a target protein that the aptamer binds changes the equilibrium of aptamer/GO binding, such that the amount of aptamer bound to GO is less. This way the greater the difference in affinity between aptamer and target (higher) and aptamer and GO the better. [0337] In some embodiments, in the presence of a SARS-CoV-2 region for which the aptamer binds with a binding affinity greater than binding affinity to the graphene oxide, fluorescence is emitted. In some embodiments, the aptamer binds with a binding affinity that is twice, ten, twenty, thirty, forty, fifty, sixty, seventy, eighty, ninety, hundred greater, five hundred, thousand times or more than binding affinity to the graphene oxide. In some embodiments, the aptamer binds with a binding affinity that is between 2 and 1000 fold, between 10 and 1000 fold, between 50 and 1000 fold, between 100 and 1000 fold, between 2 and 100 fold, between 10 and 100 fold, between 50 and 100 fold, than binding affinity to the graphene oxide. [0338] In some embodiments, the aptamers described herein may be modified in that a guanine residue present in the aptamer may be modified. In the presence of tetra-n-propylammonium hydroxide and dimethylformamide, the guanine of single- stranded DNA reacts with 3,4,5-trimethoxylphenylglyoxal, producing a high-energy intermediate. This intermediate can then deliver energy to a fluorescent dye (e.g., fluorescein, 6-FAM), which in turn can emit detectable light. [0339] In some embodiments, the method comprises detecting the presence, absence and/or concentration of SARS-CoV-2 viral particles using a chemiluminesence (CL) detection system. As used herein, “CL” is defined as material molecules generating optical radiation after absorbing chemical energy. In CL methods, the intensity of the luminous radiation reflects the concentration of the analytes. CL analysis has high sensitivity (detection limit of 10−12 to 10−21 mol) due to the ability to carry out photon metering without interference from scattered light background when an external excitation source exists. In some embodiments, the aptamer is conjugated to an enzyme. Alternatively, a detection molecule such as an antisense nucleic acid molecule may be conjugated to an enzyme. [0340] In some embodiments, the aptamer(s) is attached to a conductive polymer, wherein the binding of the target molecule to the aptamer(s) and the resulting change in the conformation of the aptamer(s) beacon produces a conformational change in the polymer so that conductivity is altered. The change in conductivity may be determined, for example, by measuring a resistance in the polymer. [0341] In some embodiments, the method comprises contacting a surface with an aptamer(s) as defined herein indirectly. Thus, in some embodiments the method comprises contacting the surface with a collecting element. The collecting element may be for example a cotton-tipped swab element. Such cotton-tipped swab elements may be obtained from e.g. Thermo Fisher Scientific. In some embodiments, the collecting element may be a cloth e.g. an antistatic cloth e.g. a microfibre cloth. [0342] In some embodiments, the method further comprises wetting the collecting element prior to contacting the surface. [0343] In some embodiments, the method further comprises a step of contacting the collecting element with a solution comprising an aptamer as described herein. In some embodiments, the solution further comprises a detection molecule as described herein. If the collecting element comprises SARS-CoV-2 viral particles, the aptamer should bind to the target molecule. The target molecule may be an epitope of the spike protein as described herein. [0344] In some embodiments, the method comprises the use of a detection system as described herein. For example, the aptamer(s) may comprise one of a FRET pair. Alternatively, the aptamer(s) may comprise a detection molecule as described herein e.g. a beacon molecule. [0345] In some embodiments, the method comprises contacting a collecting element which has been previously been contacted with the surface with a solution comprising the aptamer(s) and the detection molecule. [0346] In some embodiments, the method comprises preparing the solution comprising the aptamer(s) and the detection molecule prior to contacting the collecting element with the solution. [0347] In some embodiments, the solution comprises a molar excess of the detection molecule. [0348] In one aspect of the disclosure, the method comprises contacting the surface, directly or indirectly with a plurality of aptamers, each aptamer being capable of specifically binding a different epitope of the SARS-CoV-2 viral particle. In some embodiments, the method comprises contacting the surface with a first aptamer which is capable of specifically binding to a first epitope of a SARS-CoV-2 viral particle and a second aptamer which is capable of specifically binding to a second epitope of a SARS-CoV-2 viral particle, wherein one of the first or the second aptamer is associated with a first member of a FRET pair and one of the first or the second aptamer is associated with a second member of a FRET pair. [0349] In some embodiments, the first aptamer is capable of specifically binding to a VSGTNGT epitope of a S1 subunit of the spike protein of SARS-CoV-2. In some embodiments, the second aptamer is capable of binding to RSYLTP epitope of a S1 subunit of the spike protein of SARS-CoV-2. [0350] In some embodiments, an aptamer which is capable of specifically binding to the RSYLTP epitope and the VSGTNGT epitope is provided. [0351] In some embodiments, two or more different aptamers having a specific binding affinity for two or more different target peptides, wherein the target peptides are fragments of the surface protein, are provided. [0352] As noted in the alignment below in Table 3, there are significant contiguous amino acid insertions in the N-terminus of the S1 protein of SARS-CoV-2 as compared to the SARS-CoV S1 protein. [0353] Table 3:
Figure imgf000071_0001
[0354] These insertions are labelled with boxes in the sequence comparison above. The 3D structure of the SARS-CoV-2 spike protein has been modelled. The protein is expected to naturally form a homo trimer in its native state. [0355] This particular region will be repeated a total of three times in this trimer structure. [0356] Based on this analysis of the three-dimensional structure of this protein an aptamer that bound to the VSGTNGT site and a different aptamer that bound to the RSYLTP site would be physically proximal to each other in space. This physical proximity is used as a basis for the transference of signals between the bound aptamers such as a FRET signal. In this case, an aptamer binding to one site could be excited at a specific wavelength that would not excite the aptamer bound to the other site. The light of the emission from such an aptamer could then be captured by the second aptamer as excitation, thus eliciting an emission at a different wavelength. In this way, this second fluorescence signal would only be present when both aptamers are bound to a SARS-CoV-2 protein, providing a high level of specificity in the identification of the presence of this virus. [0357] Alternatively, one of the binding aptamers has a fluorophore and the other aptamer has a quencher. The physical proximity of the quencher to the fluorophore would reduce the amount of fluorescence emitted in the presence of the target. [0358] Alternatively, two or more different aptamers are developed for two or more different binding sites, and an aptamer comprising two or more different aptamers that bind to the two or more different binding sites can be produced. For example, a first aptamer that binds for example the VSGTNGT site and a second aptamer that binds the RSYLTP site can be developed. In some embodiments, the first and second aptamer can be combined into a contiguous sequence. In some embodiments, the aptamer is formed by combining both aptamers into one contiguous sequence such that in its native state a quencher moiety is physically aligned with a fluorophore, and when both aptamer domains, the domain that binds to one of the insertion sites, and the domain that binds to the other insertion site, are bound to their insertion sites, the quencher is physically separated from the fluorophore thus allowing the emittance of fluorescence. [0359] Thus, in some embodiments, the two insertions in the SARS-CoV-2 S1 protein enable the development of an aptamer development and detection strategy with a high level of specificity. [0360] Embodiment 1. A composition comprising an aptamer that binds SARS- CoV-2. [0361] Embodiment 2. A composition according to embodiment 1, wherein the aptamer binds a spike protein on a surface protein of SARS-CoV-2. [0362] Embodiment 3. A composition according to embodiment 1 or 2, wherein the aptamer binds to an S1 domain of the spike protein. [0363] Embodiment 4. A composition according to any one of embodiments 1 to 3, wherein the aptamer is made by selecting for aptamers from a naïve DNA aptamer library that bind to the S1 domain. [0364] Embodiment 5. A composition according to embodiment 4, wherein the selecting comprises a first round of selection comprising: [0365] combining sequences of the naïve DNA aptamer library with an immobilized recombinant S1 SARS-CoV-2 protein to form a combination. [0366] Embodiment 6. A composition according to embodiment 5, wherein the selecting further comprises collecting aptamers that bound to the immobilized recombinant S1 SARS-CoV-2 protein. [0367] Embodiment 7. A composition according to embodiment 6, wherein the selecting further comprises a second round of selection comprising a negative selection against aptamers binding a target other than recombinant S1 SARS-CoV-2 protein. [0368] Embodiment 8. A composition according to embodiment 7, wherein the second round of selection further comprises a positive selection of aptamers binding the recombinant S1 SARS-CoV-2 protein 2. [0369] Embodiment 9. A composition according to embodiments 7 or 8, wherein the target other than recombinant S1 SARS-CoV-2 protein is a SARS-CoV protein. [0370] Embodiment 10. A composition according to embodiments 8 or 9, wherein the selecting comprises repeating the process of negative selection followed by positive selection until the amount of selected library recovered after a selection round containing both negative and positive selections increases relative to the amount recovered in previous selection rounds. [0371] Embodiment 11. A composition according to embodiments 9 or 10, wherein the selecting further comprises: splitting the mature selected library into aliquots and performing parallel simultaneous selection on these aliquots with positive selection against SARS-CoV S1 protein in one instance and with continuing positive selection against SARS-CoV-2 S1 protein in another instance with a purpose of comparing the enrichment of abundance between the two parallel selection channels, wherein those aptamer sequences that exhibit higher rates of enrichment against the SARS-CoV-2 S1 protein as compared to their rates of enrichment against the SARS- CoV S1 protein in this process are selected. [0372] Embodiment 12. A composition according to any one of embodiments 1 to 11, wherein the aptamer is a single stranded DNA aptamer comprising a detectable label. [0373] Embodiment 13. A composition according to embodiment 12, wherein the detectable label is a fluorescent label. [0374] Embodiment 14. A composition according to embodiment 12 or 13, wherein the fluorescent label is quenchable by a quencher. [0375] Embodiment 15. The composition according to embodiment 14, wherein in the unbound state, when the aptamer is not bound to its target, the fluorescent label is quenched, and in the bound state, when the aptamer is bound to its target, the fluorescent label is not quenched. [0376] Embodiment 16. The composition according embodiment 15, wherein the quencher is present on an antisense nucleic acid, preferably a DNA strand, complimentary to a sequence of the aptamer such that in the unbound state the antisense nucleic acid is bound to the aptamer and in the bound state the antisense nucleic acid is not bound to the aptamer. [0377] Embodiment 17. The composition according embodiment 15, wherein the quencher is present on the aptamer and in the unbound state is proximal to the fluorescent label such that fluorescence is quenched, and in the bound state is distal to the fluorescent labels such that fluorescence is not quenched. [0378] Embodiment 18. The composition according to any one of embodiments 1 to 17 further comprising at least one of water, salts, a polar aprotic solvent, DMSO, ethanol, methanol, one or more buffers, a detergent, a surfactant, 0.1% Tween, or BSA. [0379] Embodiment 19. An aptamer capable of specifically binding to a SARS-CoV- 2 protein. [0380] Embodiment 20. An aptamer according to embodiment 19, wherein the SARS-CoV-2 protein is a spike protein on a surface of SARS-CoV-2. [0381] Embodiment 21. An aptamer according to embodiment 20, wherein the aptamer binds to an S1 domain of the spike protein. [0382] Embodiment 22. An aptamer according to embodiment 19 or 21, wherein the aptamer is made by selecting for aptamers from a naïve DNA aptamer library that bind to the S1 domain. [0383] Embodiment 23. An aptamer according to embodiment 22, wherein the selecting comprises a first round of selection comprising: [0384] combining sequences of the naïve DNA aptamer library with an immobilized recombinant S1 SARS-CoV-2 protein to form a combination. [0385] Embodiment 24. An aptamer according to embodiment 23, wherein the selecting further comprises collecting aptamers the bound to the immobilized recombinant S1 SARS-CoV-2 protein. [0386] Embodiment 25. An aptamer according to embodiment 24, wherein the selecting further comprises a second round of selection comprising a negative selection against aptamers binding a target other than recombinant S1 SARS-CoV-2 protein. [0387] Embodiment 26. An aptamer according to embodiment 25, wherein the second round of selection further comprises a positive selection of aptamers binding the recombinant S1 SARS-CoV-2 protein 2. [0388] Embodiment 27. An aptamer according to embodiments 25 or 26, wherein the target other than recombinant S1 SARS-CoV-2 protein is a SARS-CoV protein. [0389] Embodiment 28. An aptamer according to embodiments 26 or 27, wherein the selecting comprises repeating the process of negative selection followed by positive selection until the amount of selected library recovered after a selection round containing both negative and positive selections increases relative to the amount recovered in previous selection rounds. [0390] Embodiment 29. An aptamer according to embodiments 27 or 28, wherein the selecting further comprises: splitting the mature selected library into aliquots and performing parallel simultaneous selection on these aliquots with positive selection against SARS-CoV S1 protein in one instance and with continuing positive selection against SARS-CoV-2 S1 protein in another instance with a purpose of comparing the enrichment of abundance between the two parallel selection channels, wherein those aptamer sequences that exhibit higher rates of enrichment against the SARS-CoV-2 S1 protein as compared to their rates of enrichment against the SARS- CoV S1 protein in this process are selected. [0391] Embodiment 30. An aptamer according to any one of embodiments 19 to 29, wherein the aptamer is a single stranded DNA aptamer comprising a detectable label. [0392] Embodiment 31. An aptamer according to embodiment 30, wherein the detectable label is a fluorescent label. [0393] Embodiment 32. An aptamer according to embodiment 30 or 31, wherein the fluorescent label is quenchable by a quencher. [0394] Embodiment 33. The aptamer of embodiment 32, wherein in the unbound state, when the aptamer is not bound to its target, the fluorescent label is quenched, and in the bound state, when the aptamer is bound to its target, the fluorescent label is not quenched. [0395] Embodiment 34. The aptamer of embodiment 33, wherein the quencher is present on a DNA strand complimentary to a sequence of the aptamer such that in the unbound state the DNA strand is bound to the aptamer and in the bound state the DNA strand is not bound to the aptamer. [0396] Embodiment 35. The aptamer of embodiment 33, wherein the quencher is present on the aptamer and in the unbound state is proximal to the fluorescent label such that fluorescence is quenched, and in the bound state is distal to the fluorescent labels such that fluorescence is not quenched. [0397] Embodiment 36. An aptamer according to any one of embodiments 19 to 22, wherein the aptamer comprises, consists essentially of, or consists of: a forward primer recognition region; a reverse primer recognition region; and a random region in between the forward primer recognition region and the reverse primer recognition region, wherein the random region comprises nucleotides whose sequence differs between individual aptamers. [0398] Embodiment 37. An aptamer according to any one of embodiments 19 to 36, wherein the capability of specifically binding to a region of a SARS-CoV-2 protein is a capability of binding to a unique sequence of the S1 domain of the spike protein, preferably where the unique sequence is selected from the group consisting of insert region 1 (VSGTNGT at amino acid sequence 70-77), insert region 2 (KSWM at amino acid sequence 150-153), insert region 3 (RSYLTP at amino acid sequence 247-252), and insert region 4 (SPRR at amino acid sequence 680-683). [0399] Embodiment 38. An aptamer comprising, consisting essentially of, or consisting of: a nucleic acid sequence having at least 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to an aptamer of any one of embodiments 19–37; a nucleic acid sequence having at least about 30 consecutive nucleotides of any one the nucleic acid sequences made according to any one of embodiments 19 to 37; or a nucleic acid sequence having at least about 30 consecutive nucleotides of a sequence having at least 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity with any one of the nucleic acid sequences made according to any one of embodiments 19 to 37. [0400] Embodiment 39. A composition comprising the aptamer of any one of embodiments 19 to 38, or 98. [0401] Embodiment 40. The composition of embodiment 39 further comprising at least one of water, salts, a polar aprotic solvent, DMSO, ethanol, methanol, one or more buffers, a detergent, a surfactant, 0.1% Tween, or BSA. [0402] Embodiment 41. A composition comprising a first aptamer and a second aptamer, wherein: the first aptamer specifically binds to a first location on a target and comprises a first fluorescent label that excites at a first wavelength and emits at a second wavelength, the target comprising an S1 spike protein of SARS-CoV-2, the second aptamer specifically binds to a second location on the target and comprises a second fluorescent label that excites at the second wavelength and emits at a third wavelength, and upon binding of the first aptamer and the second aptamer simultaneously to the target and excitation at the first wavelength, the second fluorescent label emits at the third wavelength, wherein the first aptamer is an aptamer of any one of embodiments 19 to 38, or 98, and the second aptamer is an aptamer of any one of embodiments 19 to 38, or 98 but other than the first aptamer. [0403] Embodiment 42. An antisense nucleic acid comprising a sequence complementary to at least six consecutive nucleotides of any of the aptamer of any one of embodiments 19 to 38, or 98. [0404] Embodiment 43. The antisense nucleic acid according to embodiment 42, wherein the at least six nucleotides are complementary to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, or 25 consecutive nucleotides of the aptamer. [0405] Embodiment 44. The antisense nucleic acid according to embodiment 52, wherein the at least six nucleotides are complementary to 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, or 25 consecutive nucleotides of the aptamer. [0406] Embodiment 45. The antisense nucleic acid according to any one of embodiments 42 to 44, wherein the antisense nucleic acid is a DNA. [0407] Embodiment 46. The antisense nucleic acid according to any one of embodiments 42 to 44, wherein the antisense nucleic acid is an RNA. [0408] Embodiment 47. The antisense nucleic acid according to embodiments 42 to 46, wherein the antisense nucleic acid comprises, consists essentially of, or consists of one or more of a detectable label, modified nucleotides, modified sugars, or modified backbones. [0409] Embodiment 48. A composition comprising the aptamer(s) of any of embodiments 19 to 38, or 98 and the antisense nucleic acid of any one of embodiments 42 to 45. [0410] Embodiment 49. A method of using of the composition or aptamers of any of embodiments 1 to 18, 99, 40 to 41, and 48 for any one of the following: detecting SARS-CoV-2; detecting SARS-CoV-2 on a surface; detecting of SARS-CoV-2 infection in biological tissues and fluids on a surface; detecting of SARS-CoV-2 on inorganic surfaces; detecting SARS-CoV-2 in human and animal food production; delivering disinfection agents to selectively kill SARS-CoV-2 virus; inhibiting viral enzymes; interfering with viral coats; and disrupting steps of a viral life cycle. [0411] Embodiment 50. The method of embodiment 56, wherein detecting the presence of SARS-CoV-2 virus on a surface comprises: contacting the surface with an aptamer or composition herein; and detecting the presence, absence or amount of SARS-CoV-2 virus, wherein detecting occurs by visualizing the presence or absence of SARS-CoV-2 virus on the surface according to embodiments 52 to 75. [0412] Embodiment 51. A method according to embodiment 50, wherein the surface is an organic surface or an inorganic surface. [0413] Embodiment 52. A method of detecting the presence, absence and/or concentration of SARS-CoV-2 at a location, wherein the method comprises: a) contacting the location with an aptamer as embodied in any of embodiments 19 to 38, or 98; wherein the contact is direct or indirect contact; and b) determining the presence, absence and/or concentration of SARS-CoV-2 at the location. [0414] Embodiment 53. The method of embodiment 52, wherein the step (b) comprises: i) detecting the aptamer bound to a SARS-CoV-2 viral particle, wherein detection of the bound aptamer indicates the presence of a SARS-CoV-2 viral particle at the location. [0415] Embodiment 54. The method of embodiment 52, wherein step (a) comprises: i) contacting the location with the aptamer for a period of time sufficient for the aptamer to bind to the SARS-CoV-2 viral particle to form an aptamer-SARS-CoV-2 viral particle complex. [0416] Embodiment 55. The method of embodiment 52, wherein step (b) comprises detecting the aptamer-SARS-CoV-2 viral particle complex. [0417] Embodiment 56. The method of embodiment 52, wherein step (b) comprises providing a visual indication of the presence of SARS-CoV-2 viral particle. [0418] Embodiment 57. The method of embodiment 52, which is for detecting the presence, absence and/or concentration of a SARS-CoV-2 viral particle on a surface located at the location. [0419] Embodiment 58. The method of embodiment 52, wherein the location is selected from a location in a healthcare facility e.g. a hospital, a care home, a laboratory, an educational facility e.g. a school or a university, a community care facility, e.g. a nursing home and a care home. [0420] Embodiment 59. The method of embodiment 52, wherein the surface is selected from the group consisting a surface of a hospital bed, an operating table, surgical equipment, walls, ceilings, floors, tables, chairs and door handles. [0421] Embodiment 60. The method of embodiment 52 wherein step (a) comprises contacting the surface with a composition comprising the aptamer by liquid or aerosol spraying or wiping the surface with the composition comprising the aptamer. [0422] Embodiment 61. The method of embodiment 52 which comprises electrostatically spraying the composition onto the surface. [0423] Embodiment 62. The method of embodiment 52 which comprises filling a sprayer device with a composition comprising the aptamer prior to step (a). [0424] Embodiment 63. The method of embodiment 52, which comprises immersing the surface suspected of comprising the SARS-CoV-2 viral particle in a composition comprising the aptamer. [0425] Embodiment 64. The method of embodiment 52, which comprises flowing or pumping the composition comprising the aptamer over the surface suspected of comprising the SARS-CoV-2 viral particle. [0426] Embodiment 65. The method of embodiment 52, wherein step (a) comprises: i) contacting the location with a collecting element; and ii) contacting the collecting element with a composition comprising the aptamer. [0427] Embodiment 66. The method of embodiment 52, wherein the collecting element is selected from a swap or a wipe and step (ii) comprises locating the collecting element in a liquid composition comprising the aptamer. [0428] Embodiment 67. The method of any of embodiments 1 to 18, or 99, wherein the composition comprising a first aptamer and a second aptamer. [0429] Embodiment 68. The method of any of embodiments 52 to 67 wherein the step of detecting is performed in less than 15 minutes e.g. 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 minute. [0430] Embodiment 69. The method of embodiment 52, wherein the binding of aptamer to the SARS-CoV-2 viral particle can be observed without instrumentation. [0431] Embodiment 70. The method of embodiment 52, wherein binding of aptamer to the SARS-CoV-2 viral particle results in the appearance or disappearance of fluorescence and/ or a qualitative or quantitative color change. [0432] Embodiment 71. The method of any of embodiments 52 to 70 wherein step (b) comprises measuring a FRET signal between the quencher molecule and the fluorophore. [0433] Embodiment 72. The method of embodiment 52, which comprises contacting the surface with a plurality of aptamers, each aptamer being capable of specifically binding to a different epitope of the SARS-CoV-2 viral particle. [0434] Embodiment 73. The method of embodiment 52 comprising detecting the loss of quenching as a result of the aptamer binding to the SARS-CoV-2 viral particle. [0435] Embodiment 74. The method of embodiment 52, wherein the step of detecting comprises illuminating the location. [0436] Embodiment 75. The method of embodiment 52 which further comprises comparing the FRET signal measured in step (b) against a control in which SARS- CoV-2 is absent. [0437] Embodiment 76. The method of any of embodiments 52 to 75 (to include direct and non-direct contact), wherein the composition comprises a first aptamer and a second aptamer, wherein the first aptamer is capable of specifically binding to a first epitope of a SARS-CoV-2 and the second aptamer is capable of specifically binding to a second epitope of SARS-CoV-2, wherein the first epitope and the second epitope are different. [0438] Embodiment 77. The method of embodiment 76, wherein one of the first aptamer or the second aptamer is associated with a first member of a FRET pair and one of the first or the second aptamer is associated with a second member of a first FRET pair, wherein preferably one of the first member and the second member of the FRET pair is a donor molecule and the other of the first member and the second member is an acceptor molecule. [0439] Embodiment 78. The method of embodiment 77, wherein one of the first member and the second member of the FRET pair is a fluorophore molecule and the other of the first member and the second member is a quencher molecule. [0440] Embodiment 79. The method of embodiment 77, wherein, in the absence of a SARS-CoV-2 viral particle, the fluorophore molecule is quenched by the quencher molecule. [0441] Embodiment 80. The method of any of embodiments 77 to 79, which comprises a step of: detecting binding of the first aptamer and the second aptamer to a SARS-CoV-2 viral particle, wherein said detection comprises detecting a first fluorescence signal. [0442] Embodiment 81. The method of any of embodiments 77 to 79, comprising detecting the loss of quenching as a result of the first aptamer and the second aptamer binding to the SARS-CoV-2 viral particle. [0443] Embodiment 82. The method of any of embodiments 76 to 81, wherein one of the first aptamer and the second aptamer is capable of specifically binding to a VSGTNGT epitope of a S1 subunit of the spike protein of SARS-CoV-2. [0444] Embodiment 83. The method of any of embodiments 76 to 83, wherein one of the first aptamer and the second aptamer is capable of specifically binding to capable of binding to RSYLTP epitope of a S1 subunit of the spike protein of SARS- CoV-2. [0445] Embodiment 84. The method of any of embodiments 76 to 83, wherein the composition comprises a third aptamer which is capable of specifically binding to a third epitope of SARS-CoV-2 and a fourth aptamer which is capable of specifically binding to a fourth epitope of SARS-CoV-2, wherein preferably the third epitope and the fourth epitope are different from the first epitope and the second epitope and from each other. [0446] Embodiment 85. The method of embodiment 84, wherein the one of the third aptamer or the fourth aptamer is associated with a first member of a second FRET pair and one of the third aptamer or the fourth aptamer is associated with a second member of a second FRET pair, wherein one of the first member and the second member of the second FRET pair is a donor molecule and the other of the first member and the second member is an acceptor molecule and further wherein the second FRET pair is different from the first FRET pair. [0447] Embodiment 86. The method of embodiment 85, which comprises a step of: detecting binding of the third aptamer and the fourth aptamer to a SARS-CoV-2 viral particle, wherein said detection comprises detecting a second fluorescence signal. [0448] Embodiment 87. The method of embodiment 85 comprising detecting the loss of quenching as a result of the third aptamer and the fourth aptamer binding to the SARS-CoV-2 viral particle. [0449] Embodiment 88. The method of any of embodiments 84 to 87, wherein one or more of the third aptamer or fourth aptamer is capable of specifically binding to a VSGTNGT epitope of a S1 subunit of the spike protein of SARS-CoV-2. [0450] Embodiment 89. The method of any of embodiments 84 to 88, wherein one or more of the third aptamer or the fourth aptamer is capable of specifically binding to capable of binding to SYLTPQ epitope of a S1 subunit of the spike protein of SARS- CoV-2. [0451] Embodiment 90. The method of any of embodiments 52 to 89, which comprises: a. contacting the surface with a plurality of aptamers, each aptamer being capable of specifically binding to a different epitope of the SARS-CoV-2 viral particle and b. detecting binding or absence of binding of the plurality of aptamers to SARS- CoV-2. [0452] Embodiment 91. The method of any of embodiments 52 to 90, which comprises a step of: c) contacting the location with an anti-viral agent. [0453] Embodiment 92. The method of any of embodiments 52 to 91, which comprises a step of: c) contacting the surface with an anti-viral agent. [0454] Embodiment 93. The method of any of embodiments 52 to 92, which comprises a step of: c) contacting the location with an anti-viral agent for a period of time sufficient to reduce the concentration of SARS-CoV-2 at the location. [0455] Embodiment 94. The method of embodiment 93, which comprises performing step (c) if SARS-CoV-2 is determined to be present. [0456] Embodiment 95. The method of any of embodiments 91 to 94, wherein the anti-viral agent is selected from the group consisting of hydrogen peroxide, Peroxyacetic acid; Hydrogen Peroxide, Quaternary ammonium, Sodium hypochlorite, Sodium chlorite, Hypochlorous acid. [0457] Embodiment 96. A method of reducing the concentration of SARS-CoV-2 at a location, wherein the method comprises: a) contacting the location with an aptamer as embodied in any of embodiments 19 to 38, or 98, wherein the aptamer is conjugated to an anti-viral agent. [0458] Embodiment 97. The method of embodiment 96, which comprises spraying or wiping a surface at the location with a composition comprising the aptamer conjugated to an anti-viral agent. [0459] Embodiment 98. The aptamer of embodiments 19 to 38 further comprising a conjugated antiviral agent or radioisotope. [0460] Embodiment 99. The composition of embodiments 1 to 18, wherein the aptamer comprises a conjugated antiviral agent or radioisotope. [0461] Embodiment 100. In an aspect, the disclosure relates to an aptamer that binds to SARS-CoV-2. In an aspect, the aptamer binds to a SARS-CoV-2 spike (S) protein on a surface of a SARS-CoV-2 virus. In an aspect, the aptamer binds to the SH1 (S1) domain of the spike protein. In an aspect, the aptamer comprises, consists essentially of, or consists of a detectable label. The detectable label may be a fluorescent label. The detectable label may be bound to an oligonucleotide that binds the aptamer. In an aspect, the disclosure relates to an oligonucleotide the binds to an aptamer herein. In an aspect, the disclosure relates to a composition comprising one or more aptamers herein. In an aspect, the disclosure relates to a composition comprising an aptamer that binds to SARS-CoV-2. In an aspect, the disclosure relates to a composition comprising an aptamer that binds to the SH1 (S1) domain of the spike protein of SARS-CoV-2. In an aspect, the composition comprises an aptamer having a fluorescent label. In an aspect, the aptamer further comprises a quencher molecule on at least one of the aptamers or an oligonucleotide with a sequence complimentary to a portion of the aptamer. In an aspect, the aptamer is made by selecting for aptamers that bind to SARS-CoV-2 from a naïve DNA aptamer library. In an aspect, the aptamer is made by selecting for aptamers that bind to the S1 domain of the SARS-CoV-2 spike protein from a naïve DNA aptamer library. Selecting the aptamer may comprise selecting for aptamers that bind to a recombinant SARS-CoV-2 protein. Selecting the aptamer may comprise selecting for aptamers that bind to an isolated or reconstituted portion of SARS-CoV-2. Selecting the aptamer may comprise selecting for aptamers that bind to recombinant S1-SARS- CoV-2. Embodiments disclosed herein provide methods and products which have utility in the detection of SARS-CoV-2 on surfaces. Embodiments disclosed herein provide the ability to detect the presence of SARS-CoV-2 on such surfaces. In an aspect of the disclosure, there is provided a method of detecting the presence, absence and/or concentration of a plurality of viral particles on a surface, wherein the viral particle comprises a target molecule and wherein the method comprises: a) contacting a surface suspected having viral particles located thereon with an aptamer which is capable of specifically binding the target molecule; and b) determining the presence, absence and/or concentration of viral particles on the surface. In certain aspects of the present disclosure, the aptamers as described herein are for use in a method of detecting the presence, absence and/or concentration of SARS-CoV-2 viral particles. In some embodiments, the aptamers are for use in detecting the presence, absence and/or concentration of SARS-CoV-2 viral particles located on a surface. The method may involve the direct or indirect contact of a composition comprising the aptamer described herein with the surface. Indirect contact may be via a collecting element which is brought into contact with the surface and subsequently brought into contact with the aptamer. In an aspect of the present disclosure, there is provided a method of determining the presence, absence and/or concentration of SARS-CoV-2 viral particles in a sample, the method comprising: a) contacting the sample with an aptamer as described herein; wherein the contact is direct or indirect contact; and b) determining the presence, absence and/or concentration of SARS-CoV-2 viral particles in the sample. In some embodiments, the step of determining comprises determining whether the aptamer is bound a SARS-CoV-2 viral particle. [0462] Embodiment 101. An aptamer having a specific binding affinity for a SARS- CoV-2 protein or fragment thereof. [0463] Embodiment 102. The aptamer of embodiment 101, wherein the aptamer has a specific binding affinity for a spike protein or fragment thereof, wherein the spike protein is on a surface of SARS-CoV-2. [0464] Embodiment 103. The aptamer of embodiment 102, wherein the aptamer has a specific binding affinity for the S1 domain of the spike protein or fragment thereof. [0465] Embodiment 104. The aptamer of embodiment 101, wherein the aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. [0466] Embodiment 105. The aptamer of embodiment 101, wherein the aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. [0467] Embodiment 106. The aptamer of embodiment 101, wherein the aptamer comprises a single-stranded DNA aptamer. [0468] Embodiment 107. The aptamer of embodiment 101, wherein the aptamer comprises a detectable label. [0469] Embodiment 108. The aptamer of embodiment 107, wherein the detectable label comprises a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non-metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, a liposome, or combination thereof. [0470] Embodiment 109. The aptamer of embodiment 103, wherein the aptamer has a specific binding affinity for insert region 1 (VSGTNGT, SEQ ID NO: 16), insert region 2 (KSWM, SEQ ID NO: 17), insert region 3 (RSYLTP, SEQ ID NO: 18), or insert region 4 (SPRR SEQ ID NO: 19) of the S1 domain of spike protein. [0471] Embodiment 110. A composition comprising at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein or fragment thereof. [0472] Embodiment 111. The composition of embodiment 110, wherein the at least one aptamer has a specific binding affinity for a spike protein or fragment thereof, wherein the spike protein is on a surface of SARS-CoV-2. [0473] Embodiment 112. The composition of embodiment 111, wherein at least one aptamer has a specific binding affinity for the S1 domain of the spike protein or fragment thereof. [0474] Embodiment 113. The composition of embodiment 110, wherein the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. [0475] Embodiment 114. The composition of embodiment 110, wherein the at least one aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. [0476] Embodiment 115. The composition of embodiment 110, wherein the at least one aptamer comprises a single-stranded DNA aptamer. [0477] Embodiment 116. The composition of embodiment 110, wherein the at least one aptamer comprises a detectable label. [0478] Embodiment 117. The composition of embodiment 110 or embodiment 16, further comprising graphene oxide (GO). [0479] Embodiment 118. The composition of embodiment 117, wherein the detectable label comprises a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non-metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, a liposome, or combination thereof. [0480] Embodiment 119. The composition of embodiment 112, wherein the aptamer has a specific binding affinity for insert region 1 (VSGTNGT , SEQ ID NO: 16), insert region 2 (KSWM, SEQ ID NO: 17), insert region 3 (RSYLTP SEQ ID NO: 18), or insert region 4 (SPRR SEQ ID NO: 19) of the S1 domain of spike protein. [0481] Embodiment 120. The composition of embodiment 110 comprising two or more aptamers having a specific binding affinity for two or more different epitopes of a S1 subunit of the spike protein of SARS-CoV-2, wherein the two or more aptamers have a different nucleotide sequence. [0482] Embodiment 121. A method of visualizing SARS-CoV-2 on a surface, comprising: [0483] contacting a surface with at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein, wherein the SARS-CoV-2 protein comprises an S1 domain of the spike protein on a surface of SARS-CoV-2 or fragment thereof; and [0484] visualizing the presence or absence of SARS-CoV-2 on the surface. [0485] Embodiment 122. The method of embodiment 121, wherein the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15 [0486] Embodiment 123. The method of embodiment 121, wherein the aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. [0487] Embodiment 124. The method of embodiment 121, wherein the aptamer is conjugated to a detectable moiety thereby forming an aptamer conjugate. [0488] Embodiment 125. The method of embodiment 124, wherein the detectable moiety is a fluorophore. [0489] Embodiment 126. The method of embodiment 125, wherein the fluorophore emits at a wavelength of between about 500 nm and 510 nm. [0490] Embodiment 127. The method of embodiment 124, further comprising illuminating the surface with a light source. [0491] Embodiment 128. The method of embodiment 127, wherein light from the light source has a predetermined wavelength, and the predetermined wavelength corresponds to a wavelength of light emitted by the detectable moiety of the aptamer conjugate. [0492] Embodiment 129. The method of embodiment 127, wherein the light source is configured to produce light at a wavelength of between about 485 nm and 515 nm. [0493] Embodiment 130. The method of embodiment 127, further comprising filtering the light produced by the light source. [0494] Embodiment 131. The method of embodiment 127, comprising passing the light produced from the light source through a bandpass filter. [0495] Embodiment 132. The method of embodiment 130, further comprising photographing a location on the surface, and detecting the presence or absence of the conjugated aptamer bound to SARS-CoV-2. [0496] Embodiment 133. A method of visualizing SARS-CoV-2 on a surface, comprising: [0497] contacting a surface with a composition comprising at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein, wherein the SARS-CoV- 2 protein comprises an S1 domain of the spike protein on a surface of SARS-CoV-2 or fragment thereof; and [0498] visualizing the presence or absence of SARS-CoV-2 on the surface. [0499] Embodiment 134. The method of embodiment 133, wherein the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15, [0500] Embodiment 135. The method of embodiment 133, wherein the composition comprises two or more different aptamers. [0501] Embodiment 136. The method of embodiment 133, wherein the at least one aptamer comprises a detectable label. [0502] Embodiment 137. The method of embodiment 133, wherein the detectable label is a fluorescent label. [0503] Embodiment 138. The method of embodiment 133, wherein the fluorescent label is quenchable by a quencher. [0504] Embodiment 139. The method of embodiment 138, the composition further comprising an antisense nucleic acid comprising a quencher, wherein the an antisense nucleic acid is complementary to a sequence of the at least one aptamer, wherein the antisense nucleic acid is bound to the at least one aptamer when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof and wherein the antisense nucleic acid is not bound to the at least one aptamer when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof. [0505] Embodiment 140. The method of embodiment 138, wherein the at least one aptamer comprises the quencher, wherein the quencher is proximal to the fluorescent label such that fluorescence is quenched when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof, and wherein the quencher is distal to the fluorescent label such that fluorescence is not quenched when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof. [0506] Embodiment 141. The method of embodiment 138, wherein when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof, the fluorescent label is quenched, and wherein, when the aptamer the SARS-CoV-2 protein or fragment thereof, the fluorescent label is not quenched. [0507] Embodiment 142. The method of embodiment 138, further comprising measuring a FRET signal between the quencher molecule and the fluorescent label. [0508] Embodiment 143. The method of embodiment 137, wherein the composition further comprises graphene oxide. [0509] Embodiment 144. The method of embodiment 133, wherein the surface is an organic or inorganic surface. [0510] Embodiment 145. A method of detecting the presence or absence of SARS- CoV-2 comprising: providing one or more aptamers conjugated to a detectable moiety, wherein the one or more aptamers have a specific binding affinity for a SARS-CoV-2 protein or fragment thereof, combining the one or more aptamers with graphene oxide, contacting the aptamer-graphene oxide combination with a sample to be tested; and visualizing the detectable moiety of the aptamer conjugate bound to a SARS- CoV-2 protein. [0511] Embodiment 146. The method of embodiment 145, wherein the detectable moiety is a fluorescent label. [0512] Embodiment 147. The method of embodiment 145, wherein the one or more aptamers comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15. [0513] Embodiment 148. The method of embodiments 145-147, wherein the graphene oxide is in the form of nanoparticles. [0514] Embodiment 149. The method of embodiment 148, wherein the fluorescence of the fluorescent label is quenched by the association with the graphene oxide nanoparticle surface. [0515] The following Examples are offered by way of illustration and not by way of limitation. EXAMPLES Example 1: Aptamer Selection Process [0516] FIG. 7A shows the selection process used for selection rounds 1 to 6 and FIG. 7B shows the selection process used for selection rounds 6 to 8. Libraries from selection rounds 4 to 8 inclusive were prepared for next generation sequencing. The preparation process involved an amplification of an aliquot from each library first with primers that insert a unique hex code onto each library and subsequently with primers that reconstitute flanking universal primers for sequencing. [0517] The amplified libraries were purified on a 20% acrylamide gel and pooled in one tube such that each library was equally represented. The pool of libraries was submitted to The Centre for Applied Genomics (TCAG) at The Hospital for Sick Children (Toronto) for next generation sequencing (NGS) on an Illumina HiSeq instrument. Reads were 120 nucleotides, one way. [0518] The total number and distribution of sequence reads that passed a quality score of 13 at each nucleotide position, exhibited exactly 40 nucleotides of random region and conservation of six nucleotides of flanking sequence are provided in Table 4. Table 4: Sequence Reads Distribution
Figure imgf000091_0001
[0519] Thus, 79 million sequence reads across all the libraries were captured and analysed. This sequence data was analysed to identify the top sequences in terms of enrichment trajectories over the selection process, and specificity for the desired target. Enrichment trajectories were characterized as the frequency of individual aptamer sequences in a library (copy number/total number of reads per library). The sequences were named in order of their frequency in the last selection round against SARS-CoV-2 S1 protein. For example, CoV19-1 is the sequence with the highest copy number, while CoV19-2 is the next highest. [0520] FIG. 8 provides an overview of the enrichment trajectories of the top twenty-two sequences analysed. Most of the sequences observed in selection round 9 were not observed in the NGS analysis of previous selection rounds. The sequences were present but at a frequency that was missed by the sub-sampling implicit in the NGS analysis process. The sequences COV19-1 and COV19-3 were observed in selection rounds 6 and 7. These were joined by observation of COV19-2, COV19-5, COV-19-18, and COV-19-22 in selection round 7. The enrichment rates between the selection for SARS-CoV-2 S1 and SARS-CoV S1 proteins in selection round 8 were also compared. Only the sequences COV19-3, COV19-6 and COV19-20 were observed in selection round 8 (FIG. 9). Based on this analysis, sequences COV19-1, 2, 3, 4, 5, 6, 13, 18, and 22 were chosen as candidates for binding analysis. Example 2: Binding Analysis of Select Aptamers [0521] Each of the candidate sequences listed earlier were synthesized with a 12- nucleotide spacer on the 5’ end, AAACAAACAAAC (SEQ ID NO: 20) as well as a disulphide group. Each aptamer was spotted onto a gold surface at a concentration of 5 µM and a volume of 10 nL, the gold surface serving to reduce the disulphides to thiols, and then oxidize the thiols in a strong metal bond directly to the gold. The remainder of the surface was blocked with thiolylated PEG molecules. Two negative control aptamers were also applied to the surface, each in triplicate, in an identical manner. [0522] A solution containing the S1 proteins from SARS-CoV-2 and SARS-CoV were injected over the surface (also referred herein as chip) at various concentrations in a volume of 200 µL, and a flow rate of 50 µL/min. As the solution containing the proteins flowed over the chip, the total resonance observed was recorded every three seconds. The resonance due to binding was determined by subtracting the average resonance of the two negative sequence aptamers. [0523] The disassociation binding coefficient was determined by mapping the derivative of the resonance due to binding as a function of time to the negative kd value times the observed resonance due to binding. [0524] x’ ~ -kd*x [0525] These equations were solved in R with a non-linear least squares approach using the ‘nls’ function, which can be used to determine the nonlinear (weighted) least-squares estimates of the parameters of a nonlinear model. (See, for example, www.rdocumentation.org/packages/stats/versions/3.6.2/topics/nls). [0526] The estimated kd value was then used to solve the association rate value, ka through the use of the following formula: x’ ~ ka*Rmax*c-(ka*c+kd)*x where x and x’ refer to the observed and the derivative of the observed resonance due to binding values for the association curves. [0527] The aptamers exhibited strong initial binding to the SARS-CoV S1 protein but all the aptamers including the negative aptamers (aptamers of the same length that were not selected for binding to any SARS target) also released it rapidly. [0528] The subtraction of the negative aptamers was only possible for the SARS- CoV-2 S1 protein injection at this concentration (250 nM). The high level of resonance observed for SARS-CoV S1 protein made small differences in the time required for the protein to reach specific spots difficult to correct for. [0529] The analysis clearly shows that aptamers, CoV19-1, CoV19-5, CoV19-6, and CoV19-13 exhibited strong binding affinity for the SARS-CoV-2 S1 protein. [0530] The concentration of protein being injected was then reduced to 100 nM. The same general response as was observed at 250 nM was observed at these concentrations. There was some protein remaining bound to the negative aptamers with the SARS-CoV-2 S1 protein, but not with the SARS-CoV S1 protein. There was also more variation among the aptamers for their interaction with the SARS-CoV S1 protein than with the corresponding protein from SARS-CoV. [0531] At this lower concentration, the aptamers Cov19-1, Cov19-6 and Cov19-13 replicated the strong binding characteristics observed at 250 nM. In this case Cov19- 5 did not bind as strongly, while Cov19-18 exhibited binding. At this concentration, binding curves for the interaction of these aptamers with the SARS-CoV S1 protein could be generated, but no binding was observed, except for the aptamer sequence Cov19-2. As such, it was not possible to derive binding coefficients. [0532] The same aptamers, Cov19-1, Cov19-6 and Cov19-13 continued to exhibit strong binding behaviour to the SARS-CoV-2 S1 protein even at as low a concentration as 25 nM, while again no binding was observed against SARS-CoV S1 protein. The estimated binding coefficients for Cov19-1, Cov19-6, and Cov19-13 can be found in Table 5. For example, Cov19-1 displayed a Kd of 7.44 x 10-9 M, Cov19-6 displayed a Kd of 8.05 x 10-9 M, and Cov19-13 displayed a Kd of 8.39 x 10-9 M. Table 5: Estimated binding coefficients
Figure imgf000093_0001
Example 3: Binding Analysis of Select Aptamers [0533] Due to the higher resonance observed in Example 2 with the SARS-CoV S1 protein relative to the SARS-CoV-2 S1 protein, glycerol was removed from the SARS- CoV S1 protein solution with the use of 3 kDa spin columns. The resulting material was re-injected across the same aptamer/SPRi chip described in Example 2. Of note, the SARS-CoV-2 S1 protein did not contain any glycerol. As a result, almost all resonance was lost. To ensure that protein was not lost, the concentration of protein was examined at a wavelength of 280 nm with an extinction coefficient derived from the amino acid sequence for this protein. The estimated protein concentration was slightly higher than 250 nM for this injection. No binding was observed to the SARS- CoV S1 protein. The process was repeated at 500 nM SARS-CoV S1 protein resulting in the same result. Further, the analysis was repeated with SARS-CoV-2 S1 protein to ensure that this lack of observed binding was still relevant. The estimated binding coefficients for Cov19-1, Cov19-6, and Cov19-13 shown at Table 6, have similar values to the ones estimated previously with 100 nM SARS-CoV-2 S1 protein. For example, Cov19-1 displayed a Kd of 1.15 x 10-8 M, Cov19-6 displayed a Kd of 1.36 x 10-8 M, and Cov19-13 displayed a Kd of 9.50 x 10-9 M. Table 6: Estimated Binding Coefficients
Figure imgf000094_0001
Example 4: Optimization of Aptamers [0534] Several of the aptamers identified in Examples 2 and 3 that exhibited strong affinity for SARS-CoV-2 S1 protein and strong specificity over SARS-CoV S1 protein were selected for aptamer optimization. [0535] The original aptamer sequence for Cov19-1 having SEQ ID NO: 3 was used. The aptamer has the capacity to form many different shapes at room temperature with slight variations in free energy (ΔG) as shown, for example, in FIG.10. Aptamers were designed to reduce the variation in shape and to decrease the overall length of the aptamer. The predicted aptamer shapes for Cov19-1.1 and Cov19-1.2 (SEQ ID NO: 11), are shown in FIG.11. [0536] The original aptamer sequence for Cov19-5 having SEQ ID NO: 7 was used. The aptamer has the capacity to form many different shapes at room temperature with slight variations in free energy (ΔG) as shown, for example, in FIG.12. Aptamers were designed to reduce the variation in shape and to decrease the overall length of the aptamer. The predicted aptamer shape for Cov19-5.1 (SEQ ID NO: 13), is shown in FIG.12. [0537] The original aptamer sequence for Cov19-6 having SEQ ID NO: 8 was used. The aptamer has the capacity to form many different shapes at room temperature with slight variations in free energy (ΔG) as shown, for example, in FIG.13. Aptamers were designed to reduce the variation in shape and to decrease the overall length of the aptamer. The predicted aptamer shape for Cov19-6.1 (SEQ ID NO: 14), is shown in FIG.14. [0538] The original aptamer sequence for Cov19-13 having SEQ ID NO: 9 was used. The aptamer has the capacity to form many different shapes at room temperature with slight variations in free energy (ΔG) as shown, for example, in FIG. 15. Aptamers were designed to reduce the variation in shape and to decrease the overall length of the aptamer. The predicted aptamer shape for Cov19-13.1 (SEQ ID NO: 15), is shown in FIG.15. Example 5: Binding Analysis of Optimized Aptamers [0539] The binding affinity for the optimized aptamers were determined and compared to the original aptamer as shown in Table 7. For example, Cov19-1 displayed a Kd of 3.03 x 10-8 M, Cov19-5 displayed a Kd of 3.39 x 10-8 M, Cov19-6 displayed a Kd of 3.21 x 10-8 M, and Cov19-13 displayed a Kd of 3.40 x 10-8 M. For example, Cov19-1.2 displayed a Kd of 4.05 x 10-8 M, Cov19-5.1 displayed a Kd of 2.97 x 10-8 M, Cov19-6.1 displayed a Kd of 2.80 x 10-8 M, and Cov19-13.1 displayed a Kd of 3.85 x 10-8 M. The optimized aptamers CoV19-5.1 and CoV19-6.1 provided improved binding affinity over the aptamers CoV19-5 and CoV19-6, respectively. Table 7: Binding Affinity for Optimized Aptamers
Figure imgf000096_0001
Figure imgf000096_0002
Figure imgf000096_0003
Figure imgf000096_0004
Example 6: Application of Aptamer Cov19-5.1 to Live Virus [0540] The experiments used three virus concentrations: 1 x 105.8 TCID50 virus/mL, 0.1 x, 0.01 x, and no virus as negative control, targeting total volume in microtiter plate well of 80 µL (assays were performed in cell media). 4.1 µL of stock solution of CoV19-5.1 aptamer having a fluorescein amidite (Fam) fluorescent label at its 5’ end, was applied to live SARS-COV-2 virus such that final concentration of aptamer was 1 µM. Incubation was allowed at RT for 15 min, then the solutions were spun through 100 K spin columns, providing flow through and retained layers separately. 50 µL was recovered from the flow through, while 30 µL was recovered from the retained layer. Fluorescence was measured for both fractions. Both the flow through and the recovered layer had media added to bring their volumes to 80 µL. The FITC measurement settings were set. At this point, 1 µM aptamer concentration was measured to provide the initial fluorescence measurement. In addition, buffer without aptamer was measured (background). The amount of aptamer bound titrated as expected with reduction in live virus present (FIG.16). Example 7: Direct Detection on Surface [0541] Heat inactivated SARS-CoV-2 virus and vesicular stomatitis virus (VSV) were applied to a stainless-steel surface with a cell spreader. Full strength refers to 105.8 TCID50 for both viruses. As used herein TCID50 refers to median tissue culture infectious dose/mL. A 1 µM concentration of CoV19-5.1 aptamer having a Fam label was equilibrated with 25 ng/µL of graphene oxide (GO), overnight. This solution was sprayed onto the surface borne virus with a hand-held sprayer, such that a confluent surface was formed (film). The media used for the viruses exhibited an orange auto- fluorescence. [0542] Step 1: Adherence of virus particles to surface [0543] Liquid suspensions comprising the viral particles was used as the virus stock solutions. The surface of a stainless-steel bench was cleaned and disinfected. The virus stock solution was loaded onto the stainless-steel bench. Using a cell spreader, the solution was spread on the surface of the stainless-steel bench to ensure even drying of the solution. The solution was then allowed to dry on the surface of the stainless-steel bench, by incubating it overnight (~12 h) at RT. [0544] Step 2: Set up video recording equipment [0545] A camera as described below was used to capture images along with a special flashlight (505 nm) and protective goggles. Both the camera and special flashlight were mounted on tripods. The camera was focused as close to the surface as possible, while still retaining the capacity to observe all spots. FIG. 17 illustrates positioning of the camera and special flashlight relative to the spots on the surface. To operate the camera, the power switch was turned to “Record” and the Manual Focus switch on the lens was turned to “MF”. At this point, the small ring was used to focus the camera on the field, with the lens zoomed in fully (completely extended from the camera). Recording was started and ended by pressing the Record button. The camera was set for optimal video through the Menu settings, selecting “Movie rec. size” to “FHD 59.94P IP8”. A polarization filter (Filter ONE circular polarizing filter, Hoya) was installed in front of the camera lens. There were two filters stacked in front of the lens: BP590 bandpass filter (MidOpt). For example, the polarizing filter contained two rings, one to tighten the filter, and one to rotate the filter. [0546] The camera and light source were set up as follows. The maximum field of vision was 9 cm x 9 cm with the optimal area being no larger than 5 cm x 5 cm as indicated by the blue square in the picture. The orange safety eye shields were in place before turning on the light source, then the light was turned on by rotating the ring in the direction of the arrow and released. The light source was turned off by turning the ring in the same direction and released. The battery was returned to the camera as soon as possible after it finished charging so that the pre-set recording settings were not lost. [0547] Step 3: Visualization [0548] A mark was made on the surface with a sharpie and the camera was focused on that mark. Video recording began and then the solutions were applied to the spots. The room was not dark, but the lights were dimmed. [0549] The aptamer/graphene oxide (GO) formulation used was 1 µM aptamer + 25 ng/µL GO, in water, which was loaded onto the stainless-steel bench with a spray bottle/assembly. The sprayer was primed, with at least 3 full pumps by squeezing the trigger all the way in until the spray was complete, with no sputtering. At this point, the spray assembly was held approximately 40 cm away from the region on the intended surface. To start, the solution was sprayed by squeezing the trigger roughly “halfway” to allow the solution to come out as droplets and cover the intended region on the surface including the area where the virus-containing solution was dried. At this point, the goggles were employed and the flashlight was turned on (505 nm wavelength). Data acquisition was obtained by recording the video on the camera and capturing the subsequent images. The signal emanating from the region of the steel bench, where virus-containing solution was present was observed, and was compared to the region with no virus-containing solution. After five minutes, the flashlight was turned off, then switched back on when 20 minutes had elapsed since the aptamer + GO was applied onto the spots. The samples were then observed and then the flashlight was switched off. After 30 minutes had elapsed since the aptamer + GO was applied, the flashlight was turned on again and the samples were observed, and then the flashlight was switched off. [0550] As shown in FIG. 18, the virus spots on the stainless-steel surface were visualized with the camera and flashlight apparatus immediately prior to the application of the aptamer + GO formulation. The media used for the viruses exhibited an orange auto-fluorescence. [0551] Immediately after the application of the aptamer + GO formulation, the fluorescence changed to green (FIG.19). [0552] Over time the green fluorescence diminished with the VSV spots (FIG.20) but was retained with the SARS-CoV-2 virus spot, thus demonstrating that the aptamers described in this disclosure can be used to specifically detect SARS-CoV-2 virus on surfaces. INCORPORATION BY REFERENCE [0553] All publications, patents and sequence database entries mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference.

Claims

CLAIMS What is claimed is: 1. An aptamer having a specific binding affinity for a surface protein of a SARS- CoV-2 virus particle or fragment thereof.
2. The aptamer of claim 1, wherein the aptamer has a specific binding affinity for a spike protein or fragment thereof, wherein the spike protein is on a surface of a SARS-CoV-2 virus particle.
3. The aptamer of claim 2, wherein the aptamer has a specific binding affinity for the S1 domain of the spike protein or fragment thereof.
4. The aptamer of claim 1, wherein the aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
5. The aptamer of claim 1, wherein the aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
6. The aptamer of claim 1, wherein the aptamer comprises a single-stranded DNA aptamer.
7. The aptamer of claim 1, wherein the aptamer comprises a detectable label.
8. The aptamer of claim 7, wherein the detectable label comprises a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre-defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non-metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, a liposome, or combination thereof.
9. The aptamer of claim 3, wherein the aptamer has a specific binding affinity for insert region 1 (VSGTNGT, SEQ ID NO: 16), insert region 2 (KSWM, SEQ ID NO: 17), insert region 3 (RSYLTP, SEQ ID NO: 18), or insert region 4 (SPRR SEQ ID NO: 19) of the S1 domain of spike protein.
10. A composition comprising at least one aptamer having a specific binding affinity for a surface protein of a SARS-CoV-2 virus particle or fragment thereof.
11. The composition of claim 10, wherein the at least one aptamer has a specific binding affinity for a spike protein or fragment thereof, wherein the spike protein is on a surface of SARS-CoV-2.
12. The composition of claim 11, wherein at least one aptamer has a specific binding affinity for the S1 domain of the spike protein or fragment thereof.
13. The composition of claim 10, wherein the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
14. The composition of claim 10, wherein the at least one aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
15. The composition of claim 10, wherein the at least one aptamer comprises a single-stranded DNA aptamer.
16. The composition of claim 10, wherein the at least one aptamer comprises a detectable label.
17. The composition of claim 10 or claim 16, further comprising graphene oxide (GO).
18. The composition of claim 16, wherein the detectable label comprises a fluorophore, a nanoparticle, a quantum dot, an enzyme, a radioactive isotope, a pre- defined sequence portion, a biotin, a desthiobiotin, a thiol group, an amine group, an azide, an aminoallyl group, a digoxigenin, an antibody, a catalyst, a colloidal metallic particle, a colloidal non-metallic particle, an organic polymer, a latex particle, a nanofiber, a nanotube, a dendrimer, a protein, a liposome, or combination thereof.
19. The composition of claim 12, wherein the aptamer has a specific binding affinity for insert region 1 (VSGTNGT , SEQ ID NO: 16), insert region 2 (KSWM, SEQ ID NO: 17), insert region 3 (RSYLTP SEQ ID NO: 18), or insert region 4 (SPRR SEQ ID NO: 19) of the S1 domain of spike protein.
20. The composition of claim 10 comprising two or more aptamers having a specific binding affinity for two or more different epitopes of a S1 subunit of the spike protein of SARS-CoV-2, wherein the two or more aptamers have a different nucleotide sequence.
21. A method of visualizing a SARS-CoV-2 virus particle on a surface, comprising: contacting a surface with at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein, wherein the SARS-CoV-2 protein comprises an S1 domain of the spike protein on a surface of SARS-CoV-2 or fragment thereof; and visualizing presence or absence of the SARS-CoV-2 virus particle on the surface.
22. The method of claim 21, wherein the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
23. The method of claim 21, wherein the at least one aptamer comprises a nucleic acid sequence having at least about 10 consecutive nucleotides of a sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
24. The method of claim 21, wherein the at least one aptamer is conjugated to a detectable moiety thereby forming an aptamer conjugate.
25. The method of claim 24, wherein the detectable moiety is a fluorophore.
26. The method of claim 25, wherein the fluorophore emits at a wavelength of between about 500 nm and 510 nm.
27. The method of claim 24, further comprising illuminating the surface with a light source.
28. The method of claim 27, wherein light from the light source has a predetermined wavelength, and the predetermined wavelength corresponds to a wavelength of light emitted by the detectable moiety of the aptamer conjugate.
29. The method of claim 27, wherein the light source is configured to produce light at a wavelength of between about 485 nm and 515 nm.
30. The method of claim 27, further comprising filtering the light produced by the light source.
31. The method of claim 27, comprising passing the light produced from the light source through a bandpass filter.
32. The method of claim 30, further comprising photographing a location on the surface, and detecting the presence or absence of the conjugated aptamer bound to SARS-CoV-2.
33. A method of visualizing a SARS-CoV-2 virus particle on a surface, comprising: contacting a surface with a composition comprising at least one aptamer having a specific binding affinity for a SARS-CoV-2 protein, wherein the SARS-CoV- 2 protein comprises an S1 domain of the spike protein on a surface of SARS-CoV-2 or fragment thereof; and visualizing presence or absence of the SARS-CoV-2 virus particle on the surface.
34. The method of claim 33, wherein the at least one aptamer comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
35. The method of claim 33, wherein the composition comprises two or more different aptamers.
36. The method of claim 33, wherein the at least one aptamer comprises a detectable label.
37. The method of claim 36, wherein the detectable label is a fluorescent label.
38. The method of claim 36, wherein the fluorescent label is quenchable by a quencher molecule.
39. The method of claim 38, the composition further comprising an antisense nucleic acid comprising a quencher molecule, wherein the antisense nucleic acid is complementary to a sequence of the at least one aptamer, wherein the antisense nucleic acid is bound to the at least one aptamer when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof and wherein the antisense nucleic acid is not bound to the at least one aptamer when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof.
40. The method of claim 38, wherein the at least one aptamer comprises the quencher molecule, wherein the quencher molecule is proximal to the fluorescent label such that fluorescence is quenched when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof, and wherein the quencher molecule is distal to the fluorescent label such that fluorescence is not quenched when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof.
41. The method of claim 38, wherein when the at least one aptamer is not bound to the SARS-CoV-2 protein or fragment thereof, the fluorescent label is quenched, and wherein, when the at least one aptamer is bound to the SARS-CoV-2 protein or fragment thereof, the fluorescent label is not quenched.
42. The method of claim 38, further comprising measuring a FRET signal between the quencher molecule and the fluorescent label.
43. The method of claim 37, wherein the composition further comprises graphene oxide.
44. The method of claim 33, wherein the surface is an organic or inorganic surface.
45. A method of detecting the presence or absence of a SARS-CoV-2 virus particle comprising: providing one or more aptamers conjugated to a detectable moiety, wherein the one or more aptamers have a specific binding affinity for a SARS-CoV-2 protein or fragment thereof, combining the one or more aptamers with graphene oxide, contacting the aptamer-graphene oxide combination with a sample to be tested; and visualizing the detectable moiety of the aptamer conjugate bound to the SARS- CoV-2 protein.
46. The method of claim 45, wherein the detectable moiety is a fluorescent label.
47. The method of claim 45, wherein the one or more aptamers comprises a nucleic acid sequence having at least 90% identity with any one of SEQ ID Nos: 3-15.
48. The method of claims 45-47, wherein the graphene oxide is in the form of nanoparticles.
49. The method of claim 48, wherein the fluorescence of the fluorescent label is quenched by the association with the graphene oxide nanoparticle surface.
PCT/US2021/024766 2020-03-30 2021-03-30 Aptamers against sars-cov-2, compositions comprising aptamers against sars-cov-2 and methods of using the same WO2021202440A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063002270P 2020-03-30 2020-03-30
US63/002,270 2020-03-30
US202063120903P 2020-12-03 2020-12-03
US63/120,903 2020-12-03

Publications (1)

Publication Number Publication Date
WO2021202440A1 true WO2021202440A1 (en) 2021-10-07

Family

ID=77929747

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/024766 WO2021202440A1 (en) 2020-03-30 2021-03-30 Aptamers against sars-cov-2, compositions comprising aptamers against sars-cov-2 and methods of using the same

Country Status (1)

Country Link
WO (1) WO2021202440A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114814216A (en) * 2022-06-30 2022-07-29 中国科学院基础医学与肿瘤研究所(筹) Aptamer-antibody mixed sandwich method for identifying novel corona nucleocapsid protein
CN114814215A (en) * 2022-06-30 2022-07-29 中国科学院基础医学与肿瘤研究所(筹) Pathogenic microorganism detection test paper strip based on aptamer latex particles
CN114807151A (en) * 2022-06-30 2022-07-29 中国科学院基础医学与肿瘤研究所(筹) Polynucleotide aptamer for detecting pathogenic microorganisms and combination thereof
CN115838728A (en) * 2022-07-12 2023-03-24 中国科学院基础医学与肿瘤研究所(筹) In vitro screening method of full-length nucleocapsid protein DNA aptamer of novel coronavirus
WO2023089371A1 (en) * 2021-11-22 2023-05-25 Centro De Investigación Y De Estudios Avanzados Del Instituto Politécnico Nacional Methods for detecting sars-cov-2 coronavirus infection using dna aptamers
CN116286830A (en) * 2022-12-30 2023-06-23 中国人民解放军军事科学院军事医学研究院 Aptamer
WO2023141386A1 (en) * 2022-01-21 2023-07-27 Liv Process, Inc. System and process for visualizing target molecules
US11898146B2 (en) 2020-12-03 2024-02-13 Liv Process, Inc. Aptamers against Clostridium difficile, compositions comprising aptamers against Clostridium difficile and methods of using the same

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080020939A1 (en) * 1999-05-14 2008-01-24 Martin Stanton Nucleic acid-based detection
US20090304683A1 (en) * 2006-01-19 2009-12-10 Dimitrov Dimiter S Soluble Fragments of The Sars-Cov Spike Glycoprotein
US20110287557A1 (en) * 2008-10-21 2011-11-24 Research Foundation Of The City University Of New York Single quantum-dot based aptameric nanosensors
US20120308569A1 (en) * 2000-06-02 2012-12-06 Novartis Vaccines & Diagnostics, Inc. Gene products differentially expressed in cancerous cells
US20150346199A1 (en) * 2014-05-29 2015-12-03 The Board Of Regents Of The University Of Texas System Methods and compositions for hybrid microfluidic devices integrated with nano-biosensors
US20170362307A1 (en) * 2011-07-18 2017-12-21 President And Fellows Of Harvard College Engineered microbe-targeting molecules and uses thereof
US20180003712A1 (en) * 2015-01-08 2018-01-04 Huvet Bio, Inc. Kit for detecting virus
CN111849994A (en) * 2020-03-31 2020-10-30 厦门大学 Aptamer of SARS-CoV-2S protein or RBD protein and application thereof
CN112557349A (en) * 2020-11-17 2021-03-26 华东师范大学重庆研究院 SARS-CoV-2 real time in vitro fast detecting system based on graphene oxide coated microfiber sensor

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080020939A1 (en) * 1999-05-14 2008-01-24 Martin Stanton Nucleic acid-based detection
US20120308569A1 (en) * 2000-06-02 2012-12-06 Novartis Vaccines & Diagnostics, Inc. Gene products differentially expressed in cancerous cells
US20090304683A1 (en) * 2006-01-19 2009-12-10 Dimitrov Dimiter S Soluble Fragments of The Sars-Cov Spike Glycoprotein
US20110287557A1 (en) * 2008-10-21 2011-11-24 Research Foundation Of The City University Of New York Single quantum-dot based aptameric nanosensors
US20170362307A1 (en) * 2011-07-18 2017-12-21 President And Fellows Of Harvard College Engineered microbe-targeting molecules and uses thereof
US20150346199A1 (en) * 2014-05-29 2015-12-03 The Board Of Regents Of The University Of Texas System Methods and compositions for hybrid microfluidic devices integrated with nano-biosensors
US20180003712A1 (en) * 2015-01-08 2018-01-04 Huvet Bio, Inc. Kit for detecting virus
CN111849994A (en) * 2020-03-31 2020-10-30 厦门大学 Aptamer of SARS-CoV-2S protein or RBD protein and application thereof
CN112557349A (en) * 2020-11-17 2021-03-26 华东师范大学重庆研究院 SARS-CoV-2 real time in vitro fast detecting system based on graphene oxide coated microfiber sensor

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JANG SUNG KEY: "A ‘15-minute’ quick diagnostic testing for newly emerging viruses introduced.", POSTECH, POHANG UNIVERSITY OF SCIENCE AND TECHNOLOGY, 23 March 2020 (2020-03-23), pages 1 - 4, XP055930120, Retrieved from the Internet <URL:https://international.postech.ac.kr/a-15-minute-quick-diagnostic-testing-for-newly-emerging-viruses-introduced/> [retrieved on 20210623] *
MENG TONG, CAO HAO, ZHANG HAO, KANG ZIJIAN, XU DA, GONG HAIYI, WANG JING, LI ZIFU, CUI XINGANG, XU HUJI, WEI HAIFENG, PAN XIUWU, Z: "The insert sequence in SARS-CoV-2 enhances spike protein cleavage by TMPRSS", BIORXIV, pages 1 - 36, XP055830107, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/2020.02.08.926006v3> [retrieved on 20210804], DOI: 10.1101/2020.02.08.926006 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11898146B2 (en) 2020-12-03 2024-02-13 Liv Process, Inc. Aptamers against Clostridium difficile, compositions comprising aptamers against Clostridium difficile and methods of using the same
WO2023089371A1 (en) * 2021-11-22 2023-05-25 Centro De Investigación Y De Estudios Avanzados Del Instituto Politécnico Nacional Methods for detecting sars-cov-2 coronavirus infection using dna aptamers
WO2023141386A1 (en) * 2022-01-21 2023-07-27 Liv Process, Inc. System and process for visualizing target molecules
CN114814216A (en) * 2022-06-30 2022-07-29 中国科学院基础医学与肿瘤研究所(筹) Aptamer-antibody mixed sandwich method for identifying novel corona nucleocapsid protein
CN114814215A (en) * 2022-06-30 2022-07-29 中国科学院基础医学与肿瘤研究所(筹) Pathogenic microorganism detection test paper strip based on aptamer latex particles
CN114807151A (en) * 2022-06-30 2022-07-29 中国科学院基础医学与肿瘤研究所(筹) Polynucleotide aptamer for detecting pathogenic microorganisms and combination thereof
CN114807151B (en) * 2022-06-30 2022-10-14 中国科学院基础医学与肿瘤研究所(筹) Polynucleotide aptamer for detecting pathogenic microorganisms and combination thereof
CN114814215B (en) * 2022-06-30 2022-10-18 中国科学院基础医学与肿瘤研究所(筹) Pathogenic microorganism detection test paper strip based on aptamer latex particles
CN115838728A (en) * 2022-07-12 2023-03-24 中国科学院基础医学与肿瘤研究所(筹) In vitro screening method of full-length nucleocapsid protein DNA aptamer of novel coronavirus
CN115838728B (en) * 2022-07-12 2023-10-03 中国科学院基础医学与肿瘤研究所(筹) In vitro screening method for novel coronavirus full-length nucleocapsid protein DNA aptamer
CN116286830A (en) * 2022-12-30 2023-06-23 中国人民解放军军事科学院军事医学研究院 Aptamer

Similar Documents

Publication Publication Date Title
WO2021202440A1 (en) Aptamers against sars-cov-2, compositions comprising aptamers against sars-cov-2 and methods of using the same
Zhang et al. Reverse transcription recombinase polymerase amplification coupled with CRISPR-Cas12a for facile and highly sensitive colorimetric SARS-CoV-2 detection
Jiang et al. Graphene biosensors for bacterial and viral pathogens
Zhang et al. Advanced point‐of‐care testing technologies for human acute respiratory virus detection
JP3463098B2 (en) Modulated aptamer and method for detecting target protein using the same
Li et al. Development of general methods for detection of virus by engineering fluorescent silver nanoclusters
Zhang et al. Rapid detection of viruses: Based on silver nanoparticles modified with bromine ions and acetonitrile
Hass et al. Integrated micropillar polydimethylsiloxane accurate CRISPR detection system for viral DNA sensing
JP2012503780A5 (en)
US20230228751A1 (en) Aptamers against sars-cov-2
Chhikara et al. Viral infection mitigations using advanced nanomaterials and tools: lessons from SARS-CoV-2 for future prospective interventions
WO2022120004A1 (en) Aptamers against clostridium difficile, compositions comprising aptamers against clostridium difficile and methods of using the same
Zhu et al. Selection and applications of functional nucleic acids for infectious disease detection and prevention
Madurani et al. Recent development of detection methods for controlling COVID-19 outbreak
US20220307029A1 (en) Aptamers Against Clostridium Difficile
Chakraborty et al. Viral diagnostics and preventive techniques in the era of COVID-19: role of nanoparticles
Ahmadi et al. Carbon-based nanomaterials against SARS-CoV-2: Therapeutic and diagnostic applications
Dutta et al. Colorimetric cotton swab for viral protease detection
KR20230024888A (en) Methods for reducing or preventing Clostridioides difficile colonization
Stefano et al. Human monkeypox virus: Detection methods and perspectives for diagnostics
Derin et al. Development of nucleic acid based lateral flow assays for SARS-CoV-2 detection
Sivaraman et al. Use of flow cytometry for rapid, quantitative detection of poliovirus-infected cells via TAT peptide-delivered molecular beacons
WO2023141386A1 (en) System and process for visualizing target molecules
Napagoda et al. Nanotechnology in Virology
Chauhan Designer DNA-Based Materials for DNA and Virus Sensing

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21779323

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21779323

Country of ref document: EP

Kind code of ref document: A1