CN115838728A - In vitro screening method of full-length nucleocapsid protein DNA aptamer of novel coronavirus - Google Patents

Abstract

The invention provides an in vitro screening method of a novel coronavirus full-length nucleocapsid protein DNA aptamer, belonging to the technical field of biology. The invention screens out the aptamer which can be specifically combined with the novel coronavirus nucleocapsid protein and has high affinity through SELEX technology, has the characteristics of small molecular weight, better stability, easy modification, no immunogenicity, short preparation period and the like, and can be used for biochemical analysis, environmental monitoring, basic science, new drug synthesis and the like.

Description

In vitro screening method of full-length nucleocapsid protein DNA aptamer of novel coronavirus

Technical Field

The invention relates to the technical field of biology, in particular to in vitro screening of a novel coronavirus full-length nucleocapsid protein DNA aptamer.

Background

Aptamer (aptamer) refers to a DNA or RNA molecule obtained by screening and separating through a ligand system evolution technology (SELEX) of exponential enrichment, and can be combined with a plurality of targets such as proteins, metal ions, small molecules, polypeptides and even whole cells with high affinity and specificity, so that the aptamer has a wide prospect in the aspects of biochemical analysis, environmental monitoring, basic science, new drug synthesis and the like.

The aptamer can be folded to form various secondary structures after renaturation, such as a stem-loop structure, a hairpin structure and the like, and the secondary structures are complementary with partial space structures of a target, and then are specifically combined with the target under intermolecular forces such as hydrophobic interaction, hydrogen bond, electrostatic interaction, van der waals force and the like. The aptamer and the antibody have many commonalities, for example, the aptamer can specifically recognize and bind to a certain protein, and has good affinity and high specificity to a target thereof, but the aptamer has advantages over the antibody in many aspects, and mainly comprises the following points:

(1) The aptamer is easier to synthesize and chemically modify, can be artificially and chemically synthesized by a solid-phase synthesis method, has small batch difference and low synthesis cost, can modify certain chemical groups during synthesis, enhances the stability of the aptamer, and can facilitate subsequent drug coupling and the like. In contrast, synthesis of antibodies requires preparation of antigen, selection of immunized animals, cell fusion and expansion, etc., followed by a series of purification steps, the whole procedure is very complicated and time-consuming, and there are some differences between different batches of antibodies synthesized.

(2) The aptamer has better stability, can be stored only in a refrigerator at the temperature of-20 ℃, and has long storage time. The storage conditions of the antibody are severe, and the activity of the antibody is reduced after a few months, which affects the use of the antibody.

(3) Aptamers are less immunogenic than antibodies.

(4) The target range of the aptamer is wider, various small molecules, metal ions, polypeptides or proteins, nucleic acids, cells and the like can be used as the target for screening, and most of the targets of the antibody are proteins.

The basic principle of the in vitro exponential enrichment ligand system evolution (SELEX) technology is that the interaction between an oligonucleotide library and target molecules is utilized to screen and separate a nucleic acid sequence capable of specifically binding the target molecules from a constructed random single-stranded oligonucleotide library, and then the Polymerase Chain Reaction (PCR) in vitro amplification technology is utilized to exponentially enrich sequences with specificity in the library.

Disclosure of Invention

The invention aims to provide a method for efficiently screening aptamers and the aptamers screened according to the method, wherein the aptamers screened by the method have high affinity.

In order to achieve the purpose of the invention, the following technical scheme is adopted.

A composition for screening nucleic acid aptamers, comprising a solid support and a target molecule or a part of a target molecule bound to the solid support, the target molecule being a novel coronavirus nucleocapsid protein and/or DNA; the solid support comprises magnetic beads and/or sepharose beads. Both magnetic beads and sepharose beads can be directly, efficiently and quickly connected with target molecules.

Preferably, the magnetic beads comprise a carboxyl modification and/or a histone modification; the sepharose beads comprise streptavidin modifications.

More preferably, the method of preparing the above composition comprises the steps of:

taking carboxyl magnetic beads, activating surface carboxyl, and adding a novel coronavirus nucleocapsid protein for incubation; and after incubation, sealing unreacted sites on the surfaces of the magnetic beads, and washing to obtain the composition.

More preferably, the method of preparing the above composition comprises the steps of:

taking agarose gel beads, adding the novel coronavirus nucleocapsid protein for incubation, and washing after incubation to obtain the composition.

Still more preferably, the activation of the carboxyl group is performed using N-hydroxysuccinimide (NHS) and 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC).

The invention also discloses a reaction system for screening the aptamer, which comprises:

a single-stranded DNA library comprising at least one nucleotide strand capable of specifically recognizing the target molecule or a part of the target molecule;

the primer is used for amplifying the aptamer library, and the sequences of the primer are shown as SEQ ID NO.6 and SEQ ID NO. 7:

SEQ ID NO.6：CTTCTGCACGCCTCCTTCC；

SEQ ID NO.7：AGTGTCCGCCGATCTCGTCTCC；

the composition for screening for an aptamer described above;

and (4) a buffer solution.

Preferably, the buffer comprises a DPBS buffer.

Preferably, the single-stranded DNA library is represented by SEQ ID NO. 8:

SEQ ID NO.8：CTTCTGCACGCCTCCTTCC（N35）GGAGACGAGATCGGCGGACACT。

the invention also discloses a method for screening the aptamer, which comprises the following steps:

synthesizing a primer and a single-stranded DNA library;

screening by a magnetic bead method; which comprises preparing the reaction system, positive and negative sieves, PCR amplification as described in claim 3 or 4.

Preferably, the reaction system for screening for aptamers is formulated comprising the steps of:

synthesizing a single-stranded DNA library and a primer;

preparing a composition for screening for aptamers.

Preferably, the positive screening comprises positive screening with magnetic beads of the novel coronavirus nucleocapsid protein; the reverse screening comprises reverse screening with His magnetic beads.

Preferably, the number of screening rounds of the magnetic bead method is at least 9.

Preferably, the affinity Kd of the aptamer screened by the method can reach below 5 nM.

The aptamer screened by the invention has high specificity, small molecular weight, stable chemical property and easy storage and marking.

The invention also discloses a compound, which is characterized by comprising the following components:

a composition for screening for an aptamer, and

the aptamer screened by the method.

Preferably, the nucleic acid aptamer comprises:

N2-62：

CGCCTCCTTCCACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.1）；

N10：

CGCCTCCTTCCTCTCGGGGTGTGTAGGGTCAGGGAGTGTGAGAGGAGGAGACGAGATCGGCG（SEQ ID NO.2）；

N35：

CACGTCGGGGGGGTCACACATGAACCGTGCGGATACGGAGACGAG（SEQ ID NO.3）；

N1-53：

CCGCCACGATCGGATTCGTCTCGGCTCTATCGGATTGGAGACGAGATCGGCGG

（SEQ ID NO.4）;

N2-56:

CGCCTACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.5）。

preferably, the nucleic acid aptamer further comprises: the nucleic acid aptamers also comprise nucleic acid aptamers obtained by modifying nucleic acid aptamers with sequences shown as SEQ ID NO. 1-5.

More preferably, the modification comprises:

(1) Phosphorylation;

(2) Methylation;

(3) Amination;

(4) Sulfhydrylation;

(5) Isotopic ization;

(6) Replacing oxygen with sulfur;

(7) Substituting selenium for oxygen;

(8) Coupling biotin;

(9) Coupling a chemiluminescent group;

(10) Coupling a chemiluminescent group;

(11) A conjugated polypeptide;

(12) Coupling a ligand;

(13) Coupling siRNA;

(14) Coupling a therapeutic group;

(15) Coupling latex microspheres.

The invention also discloses a reagent for detecting the novel coronavirus in the environment, which comprises the following components in part by weight:

FAM fluorescent dye labeled nucleic acid aptamer screened by the method.

Preferably, the nucleic acid aptamer comprises:

N2-62：

CGCCTCCTTCCACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.1）；

N10：

CGCCTCCTTCCTCTCGGGGTGTGTAGGGTCAGGGAGTGTGAGAGGAGGAGACGAGATCGGCG（SEQ ID NO.2）；

N35：

CACGTCGGGGGGGTCACACATGAACCGTGCGGATACGGAGACGAG（SEQ ID NO.3）；

N1-53：

CCGCCACGATCGGATTCGTCTCGGCTCTATCGGATTGGAGACGAGATCGGCGG

（SEQ ID NO.4）;

N2-56:

CGCCTACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.5）。

preferably, the present invention also discloses a method for detecting a novel coronavirus in an environment, comprising:

sampling an area to be detected in an environment;

mixing and incubating the sample with the reagent for detecting the novel coronavirus in the environment;

and (4) measuring the fluorescence intensity in the mixture after mixed incubation, and judging the result.

The invention also discloses a method for detecting SARS-CoV and/or SARS-CoV-2 in the environment, which comprises:

sampling an area to be detected in an environment;

mixing a sample with the aptamer screened by the method to obtain a mixture;

detecting whether the mixture contains SARS-CoV-aptamer complex or SARS-CoV-aptamer complex.

Preferably, the nucleic acid aptamer comprises:

N2-62：

CGCCTCCTTCCACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.1）；

N10：

CGCCTCCTTCCTCTCGGGGTGTGTAGGGTCAGGGAGTGTGAGAGGAGGAGACGAGATCGGCG（SEQ ID NO.2）；

N35：

CACGTCGGGGGGGTCACACATGAACCGTGCGGATACGGAGACGAG（SEQ ID NO.3）；

N1-53：

CCGCCACGATCGGATTCGTCTCGGCTCTATCGGATTGGAGACGAGATCGGCGG

（SEQ ID NO.4）;

N2-56:

CGCCTACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG（SEQ ID NO.5）。

preferably, the method for detecting SARS-CoV and/or SARS-CoV-2 in an environment further comprises detecting whether the mixture contains SARS-CoV-aptamer complex and/or SARS-CoV-2-aptamer complex using a test strip.

More preferably, the test strip comprises:

a nitrocellulose membrane, a conjugate pad, a sample pad and absorbent paper; the nitrocellulose membrane comprises a detection line and a quality control line, wherein the antibody used by the detection line comprises a SARS-CoV antibody, and the antibody used by the quality control line comprises an anti-streptavidin antibody; the binding pad contains the aptamer screened by the method.

The invention also discloses the application of the aptamer N2-62, N10, N35, N1-53 and N2-56 in detecting novel coronavirus and/or SARS-CoV in the environment.

The invention also discloses the application of the aptamer screened by the method, which comprises at least one of the following steps:

specific recognition of SARS-CoV-2;

specifically binds to SARS-CoV-2;

preparing reagents for detecting or identifying SARS-CoV-2;

loading a medicine for treating the novel coronavirus pneumonia;

targeted delivery of drugs for the treatment of novel coronavirus pneumonias;

an imaging agent or tracer which binds to the novel coronavirus.

Compared with the prior art, the invention has the beneficial effects that:

the invention screens out the aptamer which can specifically bind with the novel coronavirus nucleocapsid protein by using SELEX technology, and has high affinity, and the Kd of the affinity can reach below 5 nM. In addition, the single-stranded DNA library designed by the invention can improve the screening efficiency, and the aptamer with high affinity can be obtained only by 9 rounds of screening. The aptamer has the characteristics of small molecular weight, better stability, easy modification, no immunogenicity, short preparation period and the like, and can be used for biochemical analysis, environmental monitoring, basic science, new drug synthesis and the like.

Drawings

FIG. 1 is a graph of the binding of an enriched library to a target protein and a control protein;

FIG. 2 shows data of affinity detection of aptamer N2-62;

FIG. 3 shows data of affinity detection of aptamer N10;

FIG. 4 shows data of affinity detection of aptamer N35;

FIG. 5 shows aptamer affinity N1-53 and force detection data;

FIG. 6 shows data of aptamer affinity N2-56 and force detection.

Detailed Description

The exemplary embodiments will be described herein in detail, and the embodiments described in the following exemplary embodiments do not represent all embodiments consistent with the present disclosure. Rather, they are merely examples of methods consistent with certain aspects of the present disclosure.

The experimental procedures in the following examples are, unless otherwise specified, either conventional or according to the manufacturer's recommendations. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1

Screening of aptamers

1. Synthesizing a random single-stranded DNA library and primers shown in the following sequences:

random single-stranded DNA library:

SEQ ID NO.8：

5’-CTTCTGCACGCCTCCTTCC（N35）GGAGACGAGATCGGCGGACACT-3’；

wherein "N35" represents a sequence in which 35 arbitrary nucleotide bases are linked. The library was synthesized by Biotechnology engineering (Shanghai) GmbH.

The primer information is shown as SEQ ID NO.6 and SEQ ID NO.7, and is synthesized by Jinzhi Biotechnology GmbH.

SEQ ID NO.6：CTTCTGCACGCCTCCTTCC；

SEQ ID NO.7：AGTGTCCGCCGATCTCGTCTCC；

Primers were each primed with ddH ₂ Dissolving O to obtain 50 μ M stock solution, and storing at-40 deg.C.

2. Screening by magnetic bead method

Screening by adopting a magnetic bead method for 9 rounds in total, wherein the specific screening method comprises the following steps:

1. novel coronavirus nucleocapsid protein fixed by carboxyl magnetic beads

200 mu.L of carboxyl magnetic beads are taken, washed 4 times with 200 mu.L of ultrapure water, the magnetic beads are fished by a magnet, and the supernatant is removed. Respectively taking 100 mu L of prepared NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution), mixing in equal volume, adding into magnetic beads, incubating at room temperature for 20min to activate carboxyl on the surfaces of the magnetic beads, and then washing for 1 time by using DPBS buffer solution for later use;

80 μ L of the novel coronavirus nucleocapsid protein (purchased from 40588-V08B, chiyoja, concentration of 0.5 mg/mL) was added to 10mM,260 μ L of NaAC-HAc buffer solution (pH4.5), mixed well, and added to the above activated magnetic beads; placing the mixture on a vertical mixer to incubate for 2h at room temperature, and coupling the novel coronavirus nucleocapsid protein to the surface of the magnetic beads through amino on the surface of the protein;

after the coupling is finished, the coupling tube is placed on a magnetic frame, the supernatant is sucked away, the solution is washed for 1 time by DPBS buffer solution, 200 mu L of 1M ethanolamine with the pH value of 8.5 is added into the magnetic beads, the incubation is carried out for 15min at room temperature on a vertical mixer, and the unreacted activation sites on the surfaces of the magnetic beads are blocked. Then, the sample was placed on a magnetic holder, the blocking solution was aspirated, washed 3 times with 200. Mu.L of DPBS buffer solution, and finally dissolved in 200. Mu.L of DPBS buffer solution.

2. Reverse screening and sifting

Preparing magnetic beads through reverse screening:

the method comprises the steps of coupling small His peptide with magnetic beads, wherein the small His peptide is synthesized by Hangzhou Dangang biotechnology and Co., ltd and is 9 continuous histidines, and the coupling of the small His peptide is the same as the coupling of the novel coronavirus nucleocapsid protein. The concentration of the His small peptide is 20mg/mL, and the His small peptide is diluted by 10mM NaAC-HAc buffer solution with pH4.5, specifically, 4 mu L of the His small peptide is added with 396 mu L of 10mM NaAC-HAc buffer solution with pH4.5 to be mixed evenly, 500 mu L of ethanolamine is added for blocking, and finally the His small peptide is dissolved in 500 mu L of DPBS, and the steps are the same.

Library dissolution and renaturation treatment: taking 1OD random single-stranded nucleotide library, centrifuging at 13000 rpm for 2min, adding PBS buffer solution for dissolving, placing in a metal bath at 95 ℃ for denaturation for 10 min, then placing on ice for cooling for 5min, and placing at room temperature for 15min to form stable conformation.

Library and magnetic bead incubation:

washing a certain amount of His magnetic beads with PBS buffer solution, adding the treated library into the His magnetic beads, simultaneously adding a certain amount of herring sperm DNA, BSA and sodium chloride solution, uniformly mixing, and then incubating for a period of time at room temperature on a vertical mixer; placing on a magnetic frame, collecting the supernatant, and performing positive screening with novel coronavirus nucleocapsid protein magnetic beads; the first round only has a positive screen, from the second round, before the positive screen which takes the novel coronavirus nucleocapsid protein as a target, the His magnetic beads are used for carrying out reverse screening, the supernatant of the reverse screening is used as a single-chain nucleotide library, 2 mu L of His protein with the concentration of 20mg/mL and the novel coronavirus nucleocapsid protein magnetic beads are added for carrying out the positive screening; adding 100 mu L ddH into the magnetic beads subjected to positive and reverse screening ₂ Carrying out metal bath at 95 ℃ for 10 min, placing on ice for cooling for a period of time, and then magnetically sucking the supernatant as an eluation; to further increase the screening pressure, viral lysates were added as well as human serum from the fifth round.

qPCR monitoring reaction progress:

amplifying by using qPCR (quantitative polymerase chain reaction) by using nucleic acid molecules in the elusion as templates; the method comprises the following steps: respectively adding 2 mu L of positive sieve and reverse sieve solution into 18 mu L of qPCR mix, mixing uniformly, carrying out qPCR amplification for 30 cycles, and analyzing data.

3. PCR Mass amplification

And determining the number of amplification cycles according to the qPCR data, and adding the remaining positive screen fraction to the PCR mix to amplify the corresponding number of cycles.

4. Preparation of Single chain

Because one strand of the double-stranded DNA obtained after PCR amplification is modified with biotin, the double-stranded DNA is captured by agarose gel beads with streptavidin markers through the action of streptavidin and biotin in the experiment, and then the target single-stranded DNA is dissociated through the denaturation of NaOH, and the specific experimental steps are as follows:

1) Incubation with agarose gel beads: a200. Mu.L pipette tip with a filter element was placed in a 1.5 mL EP tube, 60. Mu.L of streptavidin-coated Sepharose beads was added, the pipette tip was washed twice with 100. Mu.L each time with DPBS, the double-stranded DNA product resulting from PCR3 amplification was added to the pipette tip containing Sepharose beads 100. Mu.L each time, the liquid was pipetted into a waste liquid cup with a 200. Mu.L pipette tip, and the product was washed twice with DPBS after the addition.

2) Adding 100 μ L of 40 mM sodium hydroxide solution, collecting in a new EP tube, adding 4 μ L of 1M HCl solution for neutralization, and adding 104 μ L of 2 XDPBS solution to obtain the library for the next round of screening.

3) And (3) concentration determination: the ssDNA concentration was obtained by measuring the a260 value multiplied by the OD value by NanoDrop and multiplied by the volume to obtain the final yield.

3. Repeat the screening

Repeatedly screening for 9 rounds by using a magnetic bead method, taking a secondary library obtained in the previous operation as an initial nucleic acid library in each operation, adding herring sperm DNA and BSA (bovine serum albumin) with corresponding volumes after the library is subjected to renaturation treatment, adjusting the concentration of sodium chloride, and then incubating with protein-coupled magnetic beads; after screening, SPR is used for detecting the change of the recognition capability of the DNA single-chain library on SARS-CoV-2 nucleocapsid protein, when the recognition capability of the DNA single-chain library on SARS-CoV-2 nucleocapsid protein meets the requirement, namely the binding capability of the screened DNA single-chain library and the target protein is higher than that of the library (figure 1) which is put into the screening at the beginning, wherein pool1, pool3, pool5, pool7 and pool9 respectively represent the libraries obtained by screening in the 1 st round, the 3 rd round, the 5 th round, the 7 th round and the 9 th round, and the library obtained in the 9 th round has much higher affinity with the target than that of the first round, meets the sequencing requirement, and is subjected to high-throughput sequencing analysis.

4. Analysis and identification

After high-throughput sequencing analysis is carried out on the obtained enrichment library products, a plurality of sequences are selected for general biosynthesis, and the affinity is detected;

in subsequent detection, 4-6 sequences are determined to have strong binding capacity, and the aptamers shown in SEQ ID NO 1-5 are obtained after the 3 sequences are truncated and are named as N2-62, N10, N35, N1-53 and N2-56 respectively. The affinity characterization is shown in FIGS. 2-6.

Example 2

Preparation of SARS-CoV test paper

1. Aptamer-coupled latex particles

Diluting Streptavidin (SA) -modified latex particles (with the mass fraction of 1 percent, provided by Hangzhou Youda) by using ultrapure water for one time until the mass fraction is 0.5 percent; then, adding a 4-time excess biotin-modified aptamer into the SA-modified latex particles with the mass fraction of 0.5% for crosslinking, wherein the crosslinking condition is room-temperature oscillation for 1 hour;

removing the aptamer sequence which is not bonded to the surface of the latex particles in the supernatant of the obtained cross-linked product by a centrifugation method, wherein the centrifugation condition is 4 ℃,10000 rpm and 10 min; then washing the cross-linked product twice by ultrapure water through a centrifugal method, and finally fixing the volume by using 50 mu L of dispensing liquid for standby;

according to the above-described operation method, the latex particle-aptamer conjugates are prepared, and when a plurality of pieces of aptamers are used in combination with the latex particles to prepare the latex particle-aptamer conjugates, there is the following labeling method:

1) Mixing and marking, namely marking different aptamer sequences on the surface of the same latex particle label;

2) Single marking, namely marking the same aptamer sequence on the surface of the same latex particle label, and then mixing different latex microspheres for use;

according to different labeling methods and different aptamers, different latex particle-aptamer conjugates are prepared, and the conjugates are shown in table 1.

2. Pretreatment of

The following treatment fluid is prepared according to the formula:

sample pad treatment solution: 1M Tris-HCl buffer, 1% PVP,1% PEG,5% BSA, pH 9.0;

bonding pad treatment liquid: 0.2 M Tris-HCl buffer, 5% BSA,1% PVP,2% PEG,20% sucrose, pH 8.0;

dialyzate: 0.008 mol/L NaCl, pH 7.0;

after the preparation is finished, carrying out pretreatment:

sample pad treatment: soaking the glass fiber in the sample pad treatment solution, standing for 30 min, taking out, draining, and naturally drying for later use;

and (3) bonding pad treatment: soaking the glass fiber in the bonding pad treatment solution, standing for 30 min, taking out, draining, and naturally drying for later use;

antibody dialysis: diluting the antibody, putting the diluted antibody into a dialysis bag, and sequentially putting the dialysis bag into dialysate and triple distilled water for dialysis for 12 hours;

3. spraying latex particles

Spraying the latex particle-aptamer conjugate on the pretreated bonding pad through a film cutting machine, wherein the mass fraction of the latex particle-aptamer conjugate is 0.5%, and the spraying amount is 6 mu L/cm;

4. scribing film

The membrane is drawn by using a membrane drawing machine, and the antibodies used in the detection line (T line) are as follows: SARS-CoV nucleocapsid protein antibody, the concentration is 2 mg/mL;

the antibodies used for the quality control line (line C) were: an anti-streptavidin antibody at a concentration of 1 mg/mL;

5. combination of

And sequentially assembling the sample pad, the combination pad, the nitrocellulose membrane and the absorbent paper on a PVC plate to obtain the test strip.

TABLE 1 latex particle-aptamer conjugates and test strips

Test paper number (homoconjugate number)	Aptamer combinations	Marking method
				1	N35	Single mark
2	N10	Single mark
				3	N2-62	Single mark
4	N35/N2-62	Single mark
			5	N35/N10	Single mark
6	N2-62/N10	Single mark
			7	N35/N2-62/N10	Single mark
8	N35/N2-62	Hybrid marking
			9	N35/N10	Hybrid marking
10	N2-62/N10	Hybrid marking
			11	N35/N2-62/N10	Hybrid marking

Test example 1

Aptamer affinity detection

Detection of affinity and specificity of SARS-CoV-2 nucleocapsid protein aptamer to SARS-CoV-2 nucleocapsid protein using Surface Plasmon Resonance (SPR).

1. The universal biosynthetic aptamers N2-62, N10, N35 were diluted to 200 nM with DPBS buffer, respectively.

2. Coupling of SARS-CoV-2 nucleocapsid protein to channel 2 on the surface of a CM5 chip: then mixing equal volumes of two reagents of EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution), and injecting a sample of 50 muL of the activated chip at a flow rate of 5 muL/min; diluting SARS-CoV-2 nucleocapsid protein with 10mM sodium acetate of pH4.5 to final concentration of 50 μ g/mL, injecting sample with volume of 50 μ L and flow rate of 5 μ L/min, wherein the SARS-CoV-2 nucleocapsid protein coupling amount is 2000 Ru; after the sample injection is finished, ethanolamine is added to seal the chip, the flow rate is 5 mu L/min, and the sample injection is 50 mu L; the 1 st channel was treated as described above except that the protein coupling step was not performed, and the activation and blocking steps were identical, as a control channel.

3. And (3) detection: kinetic detection parameters were set using a surface plasmon resonance (GE Healthcare, model: biacore T200), and 4 samples of the aptamers diluted in step 1 were flowed through channels 1, 2, 3, and 4 in sequence, and the procedure for each aptamer was as follows: injecting sample 30 μ L/min × 2min, dissociating 30 μ L/min × 3 min, regenerating 1M NaCl 30 μ L/min × 0.5 min, and sequentially injecting sample of diluted aptamer.

The data of the affinity assay are shown in FIGS. 2-6, each curve is a plot of channel 2 minus channel 1, illustrating the binding ability of the corresponding aptamer to the target protein N protein. These data indicate that the aptamers N2-62, N10, N35 all detected strong binding to SARS-CoV-2 nucleocapsid protein using SPR apparatus, and the KD values are shown in Table 1 below, respectively.

TABLE 1 affinity of SARS-CoV-2 nucleocapsid protein for aptamers

Name (R)	Affinity KD (nM)
		SEQ ID NO:1（N2-62）	3.24
SEQ ID NO:2（N10）	5.91
		SEQ ID NO:3（N35）	2.41
SEQ ID NO:4（N1-53）	4.01
		SEQ ID NO:5（N2-56）	5.96

As can be seen from Table 1, the affinity of the aptamer screened by the method disclosed by the invention with the novel coronavirus nucleocapsid protein is good, and can reach below 5 nM, even lower than 3 nM, which indicates that the aptamer disclosed by the invention can accurately and efficiently identify and bind the novel coronavirus.

Test example 2

Detection of SARS-CoV

And (3) dropwise adding buffer solutions containing SARS-CoV at different concentrations to observe the condition that the test strip has strips:

preparing standard solution with concentration of 100 pg/mL, 1 ng/mL, 10 ng/mL and 100 ng/mL by using DPBS buffer solution, sucking the standard solution by using a rubber head dropper, dripping 3 drops of the standard solution on a sample pad, standing for 15min after dripping, and judging results:

positive (+): two bands, detection line and quality control line, are appeared to indicate the existence of SARS-CoV or SARS-CoV in the sample;

negative (-): only one band appears in the quality control line, and no band appears in the detection line, which indicates that SARS-CoV or SARS-CoV does not exist in the sample;

and (4) invalidation: the control line did not appear as a red band, possibly due to improper handling or reagent failure, and should be retested.

The results are shown in Table 3. As can be seen from Table 3, the detection effect is good, which indicates that the aptamer screened by the invention can effectively detect SARS-CoV in the environment.

Test paper serial number	SARS-CoV（100ng/mL）	SARS-CoV（10ng/mL）	SARS-CoV（1ng/mL）	SARS-CoV（100pg/mL）	SARS-CoV（0）
						1	+	+	+	-	-
2	+	+	+	-	-
						3	+	+	+	-	-
4	+	+	+	-	-
						5	+	+	+	-	-
6	+	+	+	-	-
						7	+	+	+	-	-
8	+	+	+	-	-
						9	+	+	+	-	-
10	+	+	+	-	-
						11	+	+	+	-	-

Conventional operations in the operation steps of the present invention are well known to those skilled in the art and will not be described herein.

The embodiments described above are intended to illustrate the technical solutions of the present invention in detail, and it should be understood that the above-mentioned embodiments are only specific embodiments of the present invention, and are not intended to limit the present invention, and any modification, supplement or similar substitution made within the scope of the principles of the present invention should be included in the protection scope of the present invention.

Claims (10)

1. A composition for screening for nucleic acid aptamers, comprising a solid support and a target molecule or a portion of a target molecule bound to the solid support, wherein the target molecule is SARS-CoV-2 nucleocapsid protein and/or DNA; the solid support comprises magnetic beads and/or sepharose beads.

2. A reaction system for screening for a nucleic acid aptamer, comprising:

a single-stranded DNA library comprising at least one nucleotide strand capable of specifically recognizing the target molecule or a portion of the target molecule;

the primer is used for amplifying the aptamer library, and the sequences of the primer are shown as SEQ ID NO.4 and SEQ ID NO. 5:

SEQ ID NO.6：CTTCTGCACGCCTCCTTCC；

SEQ ID NO.7：AGTGTCCGCCGATCTCGTCTCC；

the composition of claim 1 or 2;

and (4) a buffer solution.

3. A method for screening for nucleic acid aptamers, comprising the steps of:

synthesizing a primer and a single-stranded DNA library;

screening by a magnetic bead method; which comprises the steps of preparing a reaction system, a positive screen and a negative screen, and PCR amplification as described in claim 2.

4. An aptamer, which is characterized by comprising the aptamer shown in SEQ ID NO. 1-5:

aptamer N2-62 shown as SEQ ID NO. 1:

CGCCTCCTTCCACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG；

aptamer N10 shown as SEQ ID No. 2:

CGCCTCCTTCCTCTCGGGGTGTGTAGGGTCAGGGAGTGTGAGAGGAGGAGACGAGATCGGCG；

aptamer N35 shown as SEQ ID No. 3:

CACGTCGGGGGGGTCACACATGAACCGTGCGGATACGGAGACGAG；

aptamer N1-53 as shown in SEQ ID NO. 4:

CCGCCACGATCGGATTCGTCTCGGCTCTATCGGATTGGAGACGAGATCGGCGG;

aptamer N2-56 as shown in SEQ ID NO. 5:

CGCCTACGGGATCGGATTCCCCACTCGGCTCTATCGGATTGGAGACGAGATCGGCG。

5. the nucleic acid aptamer of claim 4, wherein the nucleic acid aptamer further comprises a nucleic acid aptamer modified from a nucleic acid aptamer having a sequence shown in SEQ ID No. 1-5.

6. The nucleic acid aptamer of claim 5, wherein the modification comprises at least one of the following modification methods:

(1) Phosphorylation;

(2) Methylation;

(3) Amination;

(4) Sulfhydrylation;

(5) Isotopic ization;

(6) Replacing oxygen with sulfur;

(7) Substituting selenium for oxygen;

(8) Coupling biotin;

(9) Coupling a chemiluminescent group;

(10) Coupling a chemiluminescent group;

(11) A conjugated polypeptide;

(12) Coupling a ligand;

(13) Coupling siRNA;

(14) Coupling a therapeutic group;

(15) Coupling latex microspheres.

7. A reagent for detecting a novel coronavirus in an environment, comprising:

FAM fluorescent dye-labeled nucleic acid aptamer as claimed in any one of claims 4 to 6.

8. A method for detecting a novel coronavirus in an environment, comprising:

sampling an area to be detected in an environment;

incubating the sample in admixture with the reagent according to claim 7;

and (4) measuring the fluorescence intensity in the mixture after mixed incubation, and judging the result.

9. A method of detecting SARS-CoV and/or SARS-CoV-2 in an environment, comprising:

sampling an area to be detected in an environment;

mixing a sample with the nucleic acid aptamer as claimed in any one of claims 4 to 6 to obtain a mixture;

detecting whether the mixture contains SARS-CoV-aptamer complex and/or SARS-CoV-2-aptamer complex.

10. Use of a nucleic acid aptamer selected by the method of any one of claims 4 to 6, comprising at least one of:

specific recognition of SARS-CoV-2;

specifically binds to SARS-CoV-2;

preparing reagents for detecting or identifying SARS-CoV-2;

loading the medicine for treating the novel coronavirus pneumonia;

targeted delivery of drugs for the treatment of novel coronavirus pneumonias;

as an imaging agent or tracer for novel coronaviruses.

Images