CN114410637B - Screening and application of nucleic acid aptamer specifically binding to chlorpromazine - Google Patents

Abstract

The invention discloses screening and application of a nucleic acid aptamer specifically combined with chlorpromazine, and belongs to the technical field of detection. The invention screens out the aptamer combined with chlorpromazine based on Capture-SELEX method, and has the characteristics of high specificity and high specificity. The invention uses the aptamer to prepare the kit for detecting chlorpromazine and quantitatively detect chlorpromazine, and has excellent performance.

Description

Screening and application of nucleic acid aptamer specifically binding to chlorpromazine

Technical Field

The invention relates to screening and application of a nucleic acid aptamer specifically combined with chlorpromazine, and belongs to the technical field of detection.

Background

Chlorpromazine is a phenothiazine drug, is mainly used for enhancing hypnosis, anesthesia, sedation and the like, and can indirectly fattening animals by adding chlorpromazine into feed. GB 31650-2019 specifies that chlorpromazine is allowed for therapeutic use but is not detected in animal foods.

Currently, there are many methods for determining chlorpromazine residues. The detection method for chlorpromazine in animal-derived food mainly comprises enzyme-linked immunosorbent assay, gas chromatography, high performance liquid chromatography, gas chromatography tandem mass spectrometry, liquid chromatography tandem mass spectrometry, etc. Among them, gas chromatography tandem mass spectrometry and liquid chromatography tandem mass spectrometry are most commonly used, and chromatograph has high detection sensitivity and accurate detection results, but expensive instruments and equipment are required, sample pretreatment steps are complicated, and a large amount of environment-unfriendly organic reagents are required. The ELISA method is dependent on the antibody, and although some ELISA methods can achieve rapid and simple detection, the preparation process of the antibody is complex, and antibodies in different batches are different, which is a defect of the ELISA method.

Aptamer (Aptamer) refers to a DNA or RNA molecule isolated by exponential enrichment of ligand system evolution (SELEX) screening, which can bind with high affinity and specificity to other targets such as proteins, metal ions, small molecules, polypeptides and even whole cells. Therefore, the aptamer has wide application prospect in the aspects of biochemical analysis, environmental monitoring, basic medicine, new medicine synthesis and the like. Compared with the antibody used by the ELISA method, the aptamer has the advantages of small molecular weight, better stability, easy transformation and modification, no immunogenicity, short preparation period, capability of being synthesized manually and the like, and avoids a series of processes of animal immunization, feeding, protein extraction, purification and the like required by the preparation of the antibody. Thus, a nucleic acid aptamer is a very desirable molecular probe.

However, in order to exert many advantages of the nucleic acid aptamer, a precondition is to screen for a high affinity and high specificity aptamer corresponding to the target. In contrast, for a specific small molecule, screening for an appropriate aptamer is also difficult, such as selection of a screening method, and poor affinity and specificity of the resulting aptamer. CN110029110a discloses a kit for screening aptamer, and its use and detection method, the method is universal, the required reagent is easy to obtain, but the method disclosed in the patent document also needs to use traditional three-stage library, the time required for each round of screening is longer, and the reverse screening degree is weaker.

Disclosure of Invention

[ technical problem ]

The invention aims to solve the technical problem that the prior art lacks a nucleic acid aptamer suitable for chlorpromazine, a screening method of the nucleic acid aptamer and a method for detecting chlorpromazine by using the nucleic acid aptamer.

Technical scheme

The invention provides a nucleic acid aptamer for detecting chlorpromazine, the sequence of which is 5'-AATCAAACGCTAAGGTCGGAGGGAAGTGCACCCATTCTTGGAAACAGGAGCTCCTGAACCGCCCACACGCAAGCTTGGTACCCGTATCGT-3' (SEQ ID NO: 1).

The present invention provides single stranded DNA libraries for screening for nucleic acid aptamers for detecting chlorpromazine: 5'-AATCAAACGCTAAGG-N10-GTGCACCCATTCTTG-N30-AAGCTTGGTACCCGTATCGT-3'.

The invention provides a method for screening nucleic acid aptamer for detecting chlorpromazine, which comprises the following steps:

(1) Fixed library

Connecting random single-stranded DNA library 5'-AATCAAACGCTAAGG-N10-GTGCACCCATTCTTG-N30-AAGCTTGGTACCCGTATCGT-3' with capture-probe-biotin, and fixing to streptavidin magnetic beads with avidin by utilizing the specific binding action of avidin and biotin;

(2) Incubation

Adding chlorpromazine into a magnetic bead solution immobilized with the ssDNA library, and incubating to enable ssDNA specifically combined with the chlorpromazine to be dissociated from the magnetic beads to form ssDNA-target complex;

(3) PCR amplification

Collecting ssDNA-target complex as template for PCR;

(4) Preparation of single strands

Recovering and purifying the amplified product of the step (3) and preparing single-stranded DNA (deoxyribonucleic acid) to obtain a secondary library;

(5) Multiple round screening

Replacing the random single-stranded DNA library in the step (1) with the secondary library obtained in the step (4), and repeatedly screening for a plurality of rounds according to the steps (1) to (4);

(6) High throughput sequencing

After screening, carrying out high-throughput sequencing analysis on the latest secondary library, and detecting the affinity and specificity of the obtained sequence and chlorpromazine to obtain the nucleic acid aptamer for detecting chlorpromazine.

The invention provides a kit for detecting chlorpromazine by using nucleic acid aptamer detection, which comprises the following parts:

the coated 96-well ELISA plate is loaded with biotin-modified complementary short chains and HRP-streptavidin-aptamer solution; the formula of the PBST buffer solution is as follows: 1.4mM KH ₂ PO ₄ 、4.3mM Na ₂ HPO ₄ 137mM NaCl,2.7mM KCl, 0.05% tween 20, pH7.4; chlorpromazine standardSolution, TMB single component color development solution, 2% H ₂ SO ₄ Solution, sample diluent (for diluting the sample).

The invention provides a method for detecting chlorpromazine by using the nucleic acid aptamer, which comprises the following steps:

(1) Incubating chlorpromazine standard solutions with different concentrations with HRP-streptavidin-aptamer,

(2) Adding HRP-streptavidin-aptamer-chlorpromazine into plate holes for incubation, cleaning,

(3) Adding substrate for color development, reading by an enzyme-labeled instrument, preparing a standard curve,

(4) Diluting the pretreated sample to be detected with sample diluent, incubating with HRP-streptavidin-aptamer to obtain HRP-streptavidin-aptamer-sample solution,

(5) Adding HRP-streptavidin-aptamer-sample solution into the plate hole for incubation, cleaning,

(6) Adding a substrate for color development, reading by an enzyme-labeled instrument, and obtaining the chlorpromazine content in the sample according to the standard curve.

[ advantageous effects ]

The aptamer for detecting chlorpromazine obtained by screening is high in specificity and high in specificity. The aptamer can be prepared directly by chemical synthesis without depending on animal or cellular immunity. The aptamer has high accuracy and stability, good tolerance to solvents, pH values, ionic strength and the like, is easy to modify, has small batch difference and has wide application range.

Compared with the traditional method for screening the aptamer by using a three-stage library, the five-stage library adopted by the invention has more advantages. The random single-stranded DNA library 5'-AATCAAACGCTAAGG-N10-GTGCACCCATTCTTG-N30-AAGCTTGGTACCCGTATCGT-3' synthesized by the method uses a five-segment library, the middle part of the library (namely, a spacer sequence between N10 and N30) is fixed on streptavidin magnetic beads through capture-probe-biotin instead of being fixed on the streptavidin magnetic beads at positions close to two ends of the library, so that a larger space can be obtained for a binding site, after a target is added, the library which is combined with the target and has conformational change is not complementary with the capture-probe-biotin any more, the library falls off from the magnetic beads, and the single-stranded library obtained by elution has stronger specificity, thereby being beneficial to screening specific aptamers with conformational change.

The invention screens out the aptamer combined with chlorpromazine based on Capture-SELEX method, verifies the affinity and specificity conditions, uses the aptamer to prepare a kit for detecting chlorpromazine and quantitatively detects chlorpromazine, and fills the blank of the method.

Drawings

The simulated secondary structure of FIG. 1 CHL-3.

FIG. 2 shows ssDNA enrichment during each round of aptamer screening.

FIG. 3 variation of the heat of binding of aptamer CHL-3 and blank to chlorpromazine.

Fig. 4 sets up a linear curve for the kit.

FIG. 5 is a standard curve of a commercial kit.

Detailed Description

Example 1 screening for nucleic acid aptamers that specifically bind chlorpromazine

1. Random single stranded DNA libraries and primers shown in the following sequences were synthesized:

random single-stranded DNA library: the full length is guaranteed to be within 80nt-100nt, and the length of 90nt is selected as the library length. There are two random sequences (N10, N30) of 40 random bases in total to ensure the richness of the library, and 15nt and 20nt upstream and downstream primers for PCR amplification, and an intermediate sequence for immobilization of the library. In the design process, a secondary structure is rarely generated on the premise of ensuring reasonable base distribution. The random single-stranded DNA library designed was 5'-AATCAAACGCTAAGG-N10-GTGCACCCATTCTTG-N30-AAGCTTGGTACCCGTATCGT-3', wherein "N10" represents a sequence of 10 arbitrary nucleotide bases joined together and "N30" represents a sequence of 30 arbitrary nucleotide bases joined together, and the library was synthesized by Takara Bio-engineering (Dalian) Inc.; primers were synthesized by biological engineering (Shanghai) Inc., and the primer information is shown in Table 1.

Table 1 primers and sequences thereof

Primer name	Primer sequence (5 '-3')	Nucleotide sequence numbering
			F	AATCAAACGCTAAGG	SEQ ID NO:2
FAM-F	FAM-AATCAAACGCTAAGG	SEQ ID NO:3
			R	ACGATACGGGTACCAAGCTT	SEQ ID NO:4
Long-R	poly-dA20-HEGL-ACGATACGGGTACCAAGCTT	SEQ ID NO:5
			capture-probe-biotin	CAAGAATGGGTGCAC-(CH2)6-Biotin	SEQ ID NO:6

Remarks: (1) in the primer name, F is a forward primer, R is a reverse primer, FAM-F is a fluorescence labeled forward primer, long-R is a reverse primer connected with a polyA tail, polyA is a polyA tail consisting of 20 adenylates (A), and capture-probe-biotin is a complementary pairing sequence of a spacer sequence (the spacer sequence is a nucleic acid sequence between N10 and N30) in the library; (2) in the primer sequence, "HEGL" is a hexaethyleneglycol spacer arm of 18 atoms, and "Biotin" is Biotin.

Both the primers and the random single stranded DNA library dry powder were centrifuged at 12000rpm for 10min. The primer F, FAM-F, R, long-R, capture-probe-biotin is prepared into a storage solution with the primer concentration of 10 mu M, 10 mu M and 100 mu M by using sterilized 1 XTE buffer (10 mM Tris, 1mM EDTA and pH 7.4) respectively, and the storage solution is sequentially marked as F storage solution, FAM-F storage solution, R storage solution, long-R storage solution and capture-probe-biotin storage solution and is stored at the temperature of minus 20 ℃ for standby; random single stranded DNA library was prepared as a 100. Mu. Mol/L solution in sterilized 1 XDE buffer and stored at-20℃for use, and designated as library stock.

2. Magnetic bead method screening

2.1 hybridization of library to complementary short strands: mu.L of library stock solution was taken in a 1.5mL centrifuge tube, 15. Mu.L of capture-probe-biotin stock solution was added, and the volume was made up to 1000mL with STE buffer (10 mM Tris-HCl, 100mM NaCl, 1mM EDTA, pH 8.0), and vortexed and mixed to give a mixed solution A. The mixed solution A is heated and denatured for 10min at 95 ℃, and is cooled for more than 10min at room temperature.

2.2 washing of magnetic beads: 1mL of streptavidin magnetic beads (Thermofiser, dynabeads were pipetted ^TM M-270 strepitavidins, cat: 65305 With 1X bind and wash buffer (B)&W,5mM Tris-HCl,0.5mM EDTA,1M NaCl,pH 7.5) was washed 3 times with a volume of 1mL each (the beads were temporarily stored in a small amount of B in the last wash)&And (3) in the W buffer solution, preventing the magnetic beads from drying, and recovering the magnetic beads by using a strong magnet to obtain the washed magnetic beads.

Wherein the amount of magnetic beads used was 300. Mu.L each time from the second round of screening.

2.3 fixed library: and (2) reacting the complementary ssDNA library obtained in the step (2.1) with 1mL of the washed magnetic beads obtained in the step (2.2) for 1h at 37 ℃ and 200rpm, and fixing the ssDNA library on the streptavidin magnetic beads by utilizing the specific combination of the avidin of the streptavidin magnetic beads and the biotin in the capture-probe-biotin.

2.4 washing of magnetic beads of the fixed library: with BB buffer (50 mmol/L Tris-HCl,5mmol/L KCl,100mmol/L NaCI,1mmol/L MgCl) ₂ pH 7.4) the ssDNA library-immobilized magnetic beads were washed 10 more times to remove non-specifically bound ssDNA and left for one hour to reach dissociation equilibrium of the DNA.

Wherein the amount of BB buffer used was 300. Mu.L each time since the second round of screening.

2.5 target elution: mixing the magnetic bead solution with the immobilized ssDNA library obtained in the step 2.4 with chlorpromazine (initial concentration of chlorpromazine in the mixture is 0.1mmol/L, and in BB buffer solution), and incubating for 2 hours at 25 ℃, wherein ssDNA specifically bound with the chlorpromazine is dissociated from the magnetic beads to form ssDNA-target complex. Under the action of an externally applied magnetic field, ssDNA-target complexes are left in the supernatant, and the supernatant is collected and used as a template for subsequent PCR amplification.

3. Secondary library preparation

3.1PCR amplification: and (3) performing PCR amplification by taking the supernatant obtained by separating the step (2.5) under the action of an external magnetic field as a template. The PCR reaction system is shown in Table 2, and the amplification conditions are: pre-denaturation at 95℃for 5min, denaturation at 95℃for 30s, annealing at 50℃for 30s, extension at 72℃for 2min, 18 cycles total, and preservation at 4 ℃. The PCR products were separated by 8% non-denaturing polyacrylamide gel electrophoresis (PAGE) at 250V for 15min, gelred stained for 5min, and visualized under a gel electrophoresis imager to verify if the band position was correct (if the band was at 90 bp) and if the PCR amplification was successful.

TABLE 2 PCR System (Single tube total System 50. Mu.L)

Reagent (concentration)	System (mu L)
		FAM-F(10μM)	0.5
Long-R(10μM)	0.5
		Taq DNA polymerase (5U/. Mu.L)	0.5
dNTP Mix(5mM)	1.0
		10x PCR buffer	5.0
Template	5.0
		ddH 2 O	37.5

3.2 preparation of single strands: all PCR products were collected in 10ml centrifuge tubes at a volume ratio of 1:1 was added to a 2 XTBE-Urea loading buffer (Biotechnology (Shanghai) Co., ltd., cat# C506046) and the DNA was denatured in a water bath at 70℃for 5min, followed by 10min at room temperature, all samples were subjected to Urea-denatured polyacrylamide gel electrophoresis (formula see Table 3), at 250V until bromophenol blue reached the bottom of the gel, and FAM-labeled single-stranded DNA was separated from single-stranded DNA with PolyA, and the 7M Urea-denatured polyacrylamide gel formulation was as shown in Table 3.

TABLE 3 Urea denatured Polyacrylamide gel formulation

Composition of the components	Dosage of
		Urea	2.52g
30% polyacrylamide	1.6mL
		10x TBE	0.6mL
ddH 2 O	2mL
		10％APS	36μL
TEMED	9μL

3.3 gel cutting to recover FAM-labeled single-stranded DNA: the gel was taken out and placed on a plastic film, ex (nm): 495, em (nm): 517 detecting FAM-labeled single-stranded DNA; the target band was cut directly with a clean blade, the gel strip was transferred to a 2mL centrifuge tube and triturated, and single-stranded DNA was recovered by purification in steps using a polyacrylamide gel kit (product number D1250, beijing Soy Corp technology Co., ltd.).

4. Multiple rounds of screening:

repeating 2.1 rounds of screening with a secondary library (the secondary library is a continuously updated process, and is obtained by cutting and recovering in the previous round, for example, the library used in the second round is obtained by 3.3, the library used in the third round is obtained by cutting and recovering after completing the second round of screening, and the library in each round is collectively called as a secondary library from the second round) as the library screened in the next round; from the second round of screening, the library amount in 2.1 mixed solution A was 100pmol, 1.5. Mu.L of capture-probe-biotin stock solution was added, the volume was supplemented to 300mL with STE buffer, and the amount of streptavidin magnetic beads in 2.3 was 300. Mu.L. The seventh and ninth runs used chlorpromazine analogs instead of chlorpromazine for counter-screening.

After the 9 th round of screening is finished, the obtained secondary library is processed, a sample is sent, after high-throughput sequencing analysis, a plurality of sequences are selected and synthesized by the Jin Weizhi biological technology limited company of Suzhou, the affinity and the specificity of the sequences with chlorpromazine are detected, and finally 1 sequence with strong binding capacity with chlorpromazine, namely CHL-3 for short, is a nucleic acid aptamer specifically binding to chlorpromazine, and the sequence is:

5'-AATCAAACGCTAAGGTCGGAGGGAAGTGCACCCATTCTTGGAAACAGGAGCTCCTGAACCGCCCACACGCAAGCTTGGTACCCGTATCGT-3' its simulated secondary structure is shown in FIG. 1, ΔG= -6.19kcal/mol.

In the multi-round screening method, the screening pressure can be increased round by round so as to improve the enrichment degree of the screening nucleic acid aptamer and shorten the screening process; the increasing screening pressure includes decreasing the amount of initial library input, the amount of chlorpromazine added. FIG. 2 is a calculation formula of enrichment rate of ssDNA in each round of aptamer screening:

enrichment ratio = Fb/(Ff-Fi),

where Ff is the initial fluorescence intensity value before each round of library fixation, fi is the fluorescence intensity value of the supernatant after fixation, fb is the fluorescence intensity value of the target elution supernatant.

Example 2 detection of affinity and specificity of aptamer and chlorpromazine Using isothermal titration microcalorimetry (ITC)

1. Detection of aptamer affinity to chlorpromazine using isothermal titration microcalorimetry (ITC)

Preparing a solution:

(1) test solution: the nucleic acid aptamer CHL-1-CHL-7 synthesized by Suzhou gold only was taken and each was buffered with citrate-phosphate buffer (20 mM Na pH adjusted to 7.0 with citric acid) ₂ HPO ₄ ) Diluted to 100 mu M concentration, and vortex mixed to obtain 7 kinds of aptamer test solution. The sequences of CHL-1 to CHL-7 are shown in the TableShown at 5.

(2) Control solution: citrate-phosphate buffer (20 mM Na pH adjusted to 7.0 with citric acid) was taken ₂ HPO ₄ ) As a control solution.

(3) Chlorpromazine solution: 5 mu L of chlorpromazine solution (mother solution prepared by dissolving citrate-phosphate buffer solution) with the concentration of 400 mu M is taken and added into 195 mu L of the citrate-phosphate buffer solution to be uniformly mixed.

The chlorpromazine solution is titrated by a test solution and a control solution respectively, and the change condition of heat in the titration process is detected, wherein the used instrument is PEAQ-ITC of Markov instruments limited company in UK, the experimental result is shown in fig. 3, fig. 3 is an isothermal titration micro-thermal detection result diagram of the affinity of the nucleic acid aptamer and the chlorpromazine, wherein fig. 3A is a nucleic acid aptamer CHL-3, and fig. 3B is a control solution.

As can be seen from fig. 3, the titration of the aptamer with chlorpromazine releases heat, and can bind with chlorpromazine. As shown in Table 4, the first three sequences with smaller KD values are CHL-2, CHL-6 and CHL-3, while the other sequences are also combined with chlorpromazine, with larger KD values. The control solution had no release of heat and no binding during titration with chlorpromazine.

Table 4 values of kd of each aptamer (from small to large)

Aptamer	KD(M)
		CHL-2	3.45E-06
CHL-6	4.45E-06
		CHL-3	9.93E-06
CHL-7	1.51E-05
		CHL-4	8.17E-06
CHL-5	1.07E-05
		CHL-1	3.20E-05

Table 5 7 candidate aptamer sequences

2. Detection of aptamer and chlorpromazine specificity using isothermal titration microcalorimetry (ITC)

Preparing a solution:

(1) test solution: the nucleic acid aptamers CHL-2, CHL-3, and CHL-6 synthesized by Suzhou gold only were prepared by using citrate-phosphate buffer (20 mM Na with pH adjusted to 7.0 with citric acid) ₂ HPO ₄ ) Diluted to 100 mu M concentration, and vortex mixed to obtain test solution of 3 kinds of nucleic acid aptamer.

(2) Control solution: citrate-phosphate buffer (20 mM Na pH adjusted to 7.0 with citric acid) was taken ₂ HPO ₄ ) As a control solution.

(3) Promethazine solution: adding 5 μl of promethazine solution (mother solution prepared by dissolving citrate-phosphate buffer) with concentration of 400 μM into 195 μl of citrate-phosphate buffer, and mixing.

(4) Haloperidol solution: taking 5 mu L of haloperidol solution (mother solution prepared by dissolving citrate-phosphate buffer) with the concentration of 400 mu M, adding the solution into 195 mu L of the citrate-phosphate buffer, and uniformly mixing to obtain the aqueous solution.

(5) Promethazine solution: taking 5 mu L of a promethazine solution (mother solution prepared by dissolving citrate-phosphate buffer) with the concentration of 400 mu M, adding the solution into 195 mu L of the citrate-phosphate buffer, and uniformly mixing to obtain the promethazine.

(6) Azapirone solution: adding 5 μl of azapirone solution (mother solution prepared by dissolving citrate-phosphate buffer) with concentration of 400 μM into 195 μl of citrate-phosphate buffer, and mixing.

(7) Chlorpromazine solution: 5 mu L of chlorpromazine solution (mother solution prepared by dissolving citrate-phosphate buffer solution) with the concentration of 400 mu M is taken and added into 195 mu L of the citrate-phosphate buffer solution to be uniformly mixed.

The promethazine solution, haloperidol solution, acetylpromethazine solution, and azapelon solution were titrated with the test solution and the control solution, respectively, and the heat change during the titration was detected using the equipment PEAQ-ITC of malvern instruments, inc.

As can be seen from Table 6, the aptamer CHL-3 has a better specificity, binds less to the chlorpromazine analog, and the remaining sequences bind more to the chlorpromazine analog.

Table 6 binding of each aptamer to chlorpromazine analog

Example 3 kit for detecting chlorpromazine Using aptamer CHL-3 and application thereof

1. Streptavidin coats the transparent microwell plates: each well was coated with 200. Mu.L of streptavidin (0.01 mg/mL), and the mixture was allowed to react at 4℃for 24 hours, followed by drying. The PBST buffer was washed three times, one minute each time, and the swatter was dried.

2. Bovine Serum Albumin (BSA) blocked microplates: 200. Mu.L of 1% (mass fraction) BSA solution was added to each well, incubated for 30min at 37℃on a shaker, and dried. The PBST buffer was washed three times, one minute each time, and the swatter was dried.

Ligation of HRP-streptavidin with biotin-aptamer: HRP-streptavidin solution diluted 1/750 was subjected to 1 with 400nm biotin-aptamer: 1 (volume ratio) to give a homogeneous solution E (diluted with PBS buffer having a composition of 1.4mM KH) ₂ PO ₄ ，4.3mM Na ₂ HPO ₄ 137mM NaCl,2.7mM KCl,PH7.4), shaking table incubation at 37℃for 30min.

4. Incubation of target with HRP-streptavidin-aptamer: mixing the solution E with chlorpromazine with different concentrations, wherein the final concentration of the chlorpromazine is 1ppb, 6 ppb, 10 ppb, 30 ppb, 40 ppb and 50ppb respectively, and diluting with BB buffer solution, wherein the components are as follows: 50mmol/L Tris-HCl,5mmol/L KCl,100mmol/L NaCI,1mmol/L MgCl ₂ pH7.4, incubation at 37℃for 60min.

Ligation of biotin-short chain to streptavidin microwell plates: to the closed well plate of step 2, 100. Mu.L of biotin-short chain diluted to 250nM was added to each well and shaken by shaking at 37℃for 30min, and the wells were dried. The PBST buffer was washed three times, one minute each time, and the swatches were dried.

Complementation of biotin-short chain with HRP-streptavidin-aptamer-target: 200 mu L of the solution of the step 4 with each concentration is added to the plate treated in the step 5, and the plate is incubated for 30min at 37 ℃ by shaking, and then the plate is dried by shaking. The PBST buffer was washed three times, one minute each time, and the swatches were dried.

7. 100. Mu.L of commercial TMB single-component buffer is added into the plate holes for color development, the plates are incubated for 15min at 37 ℃ in a shaking table in a dark place, 100. Mu.L of 2% (mass fraction) sulfuric acid is added for stopping the reaction, and an enzyme-labeled instrument performs absorbance reading at 450 nm.

Comparison: commercial chlorpromazine ELISA kits (Shanghai enzyme-linked biotechnology Co., ltd.) were purchased, standard curves (0.1-8.1 ppb) were established according to the instruction procedure, and as shown in FIG. 5, B/B0 represents the ratio of absorbance at 450nm to blank absorbance corresponding to different concentration targets. Comparing the results of the present invention (FIG. 4) with these, it can be seen that the kit of the present invention is linearWider (0-50 ppb) and correlation coefficient (r ² ) Closer to 1.

Primers were synthesized by the Souzhou Jin Weizhi Biotechnology Co., ltd, and the primer information is shown in Table 7.

Table 7 primer artificial sequence for use in kit

While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of Jiangnan

<120> screening and use of aptamer specifically binding to chlorpromazine

<130> BAA211870A

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 90

<212> DNA

<213> artificial sequence

<400> 1

aatcaaacgc taaggtcgga gggaagtgca cccattcttg gaaacaggag ctcctgaacc 60

gcccacacgc aagcttggta cccgtatcgt 90

<210> 2

<211> 15

<212> DNA

<213> artificial sequence

<400> 2

aatcaaacgc taagg 15

<210> 3

<211> 15

<212> DNA

<213> artificial sequence

<400> 3

aatcaaacgc taagg 15

<210> 4

<211> 20

<212> DNA

<213> artificial sequence

<400> 4

acgatacggg taccaagctt 20

<210> 5

<211> 20

<212> DNA

<213> artificial sequence

<400> 5

acgatacggg taccaagctt 20

<210> 6

<211> 15

<212> DNA

<213> artificial sequence

<400> 6

caagaatggg tgcac 15

<210> 7

<211> 90

<212> DNA

<213> artificial sequence

<400> 7

aatcaaacgc taaggtcgag aagtggtgca cccattcttg cggcacgacg cagagccagg 60

gatgatgacg aagcttggta cccgtatcgt 90

<210> 8

<211> 90

<212> DNA

<213> artificial sequence

<400> 8

aatcaaacgc taaggtcgga ggaaagtgca cccattcttg cgccacaaga cacactgatc 60

gaacgccgcc aagcttggta cccgtatcgt 90

<210> 9

<211> 90

<212> DNA

<213> artificial sequence

<400> 9

aatcaaacgc taaggtcgga gggaagtgca cccattcttg gaaacaggag ctcctgaacc 60

gcccacacgc aagcttggta cccgtatcgt 90

<210> 10

<211> 90

<212> DNA

<213> artificial sequence

<400> 10

aatcaaacgc taaggtccga agaaggtgca cccattcttg ctcacagaga acgtcaccgc 60

acgagtcccg aagcttggta cccgtatcgt 90

<210> 11

<211> 90

<212> DNA

<213> artificial sequence

<400> 11

aatcaaacgc taaggtcgga aggaggtgca cccattcttg aatcgcaggc aaccgcagaa 60

ccaccgaggc aagcttggta cccgtatcgt 90

<210> 12

<211> 90

<212> DNA

<213> artificial sequence

<400> 12

aatcaaacgc taaggtaagg acgaggtgca cccattcttg ggcacgcggc acgcgcgagg 60

acgaccaggc aagcttggta cccgtatcgt 90

<210> 13

<211> 90

<212> DNA

<213> artificial sequence

<400> 13

aatcaaacgc taaggtcgag agaaggtgca cccattcttg cccggcatcg agcactgcgc 60

ggacgatgta aagcttggta cccgtatcgt 90

<210> 14

<211> 15

<212> DNA

<213> artificial sequence

<400> 14

caagaatggg tgcac 15

<210> 15

<211> 90

<212> DNA

<213> artificial sequence

<400> 15

aatcaaacgc taaggtcgga gggaagtgca cccattcttg gaaacaggag ctcctgaacc 60

gcccacacgc aagcttggta cccgtatcgt 90

Claims (6)

1. The aptamer for detecting chlorpromazine is characterized by having a sequence shown in SEQ ID NO. 1.

2. A kit for detecting a nucleic acid aptamer of chlorpromazine, comprising the nucleic acid aptamer of claim 1.

3. The kit of claim 2, comprising the following parts:

the coated 96-well ELISA plate is loaded with biotin-modified complementary short chains and HRP-streptavidin-aptamer solution; PBST buffer solution, chlorpromazine standard solution, TMB single-component color development solution, 2% H ₂ SO ₄ A solution for diluting the sample.

4. Use of the aptamer of claim 1 for detecting chlorpromazine.

5. Use of a kit according to claim 2 or 3 for the detection of chlorpromazine.

6. The use according to claim 5, characterized by the steps of:

(1) Incubating chlorpromazine standard solutions with different concentrations with HRP-streptavidin-aptamer,

(2) Adding HRP-streptavidin-aptamer-chlorpromazine into plate holes for incubation, cleaning,

(3) Adding substrate for color development, reading by an enzyme-labeled instrument, preparing a standard curve,

(4) Diluting the pretreated sample to be detected with sample diluent, incubating with HRP-streptavidin-aptamer to obtain HRP-streptavidin-aptamer-sample solution,

(5) Adding HRP-streptavidin-aptamer-sample solution into the plate hole for incubation, cleaning,

(6) Adding a substrate for color development, reading by an enzyme-labeled instrument, and obtaining the chlorpromazine content in the sample according to the standard curve.