KR101258600B1 - DNA aptamer binding to ampicillin with specificity - Google Patents

Abstract

The present invention relates to DNA aptamers that specifically bind to ampicillin, and more particularly, to DNA aptamers that specifically bind to ampicillin selected from a random ssDNA library and their use. DNA aptamers specifically binding to ampicillin according to the present invention were selected from a random ssDNA library using SELEX (Systematic Evolution of Ligands by Exponential enrichment) technology using magnetic beads, and the base of the selected DNA aptamers Sequence, properties and avidity were analyzed. Therefore, the DNA aptamer of the present invention can be usefully used to effectively detect ampicillin.

Description

DNA aptamer binding to ampicillin with specificity

The present invention relates to antibiotic detection aptamers, and more particularly, to DNA aptamers that specifically bind to ampicillin.

Antibiotics have been widely used to kill or inhibit microorganisms. However, the abuse of antibiotics has caused a variety of side effects in humans, leading to the emergence of antibiotic-resistant superbacteria. Therefore, the proper use of the appropriate amount of antibiotics is of great importance and it should be checked whether the food contains residues of antibiotics exceeding the Maximum Residue Limits (MRL) before distribution or sale on the market. Since the excess of antibiotic residue in food creates serious problems, a more reliable, accurate and easy detection system is required.

Ampicillin is a beta-lactam antibiotic and has been used extensively to treat bacterial infections since 1961. Until ampicillin was introduced by the British company Beecham, only penicillin treatments were effective against Gram-positive bacteria such as staphylococci and streptococci. However, ampicillin (original name: Penbritin) is a representative oral drug of broad-penicillin having a broad antibacterial spectrum effective not only in Gram-positive bacteria but also in Gram-negative bacteria such as H. influenzae , coliform and proteus spp.

Aptamers are single-stranded DNA (ssDNA) or RNA that have high specificity and affinity for specific targets. Aptamers are superior in cost to detection materials used in the field of sensors because of their high affinity for their targets, their excellent thermal stability and their ability to be synthesized in vitro . In addition, there is no restriction in the target material, aptamers for various targets such as proteins, biomolecules such as amino acids, small organic chemicals such as environmental hormones or antibiotics, and bacteria can be synthesized. Due to the properties of aptamers that specifically bind to target materials, a lot of research has recently been conducted to use aptamers in new drug development, drug delivery systems, and biosense.

Among the various sensing materials used in the existing biosense field, the superiority in sensitivity is the detection of the target material using the antibody. The first problem is that the injection of the target substance (antigen) to be detected into the body of the animal to secure the antibody made through the immune system of the living body and then undergo a purification process is time-consuming and expensive. In addition, the target material that can be used as an antigen is limited compared to the aptamer which has little restrictions on the target material, which makes it difficult to prepare antibodies to low molecular weight compounds such as toxic substances. In general, since antibodies are very large proteins having a size of 150 KDa or more, there are limitations in signal detection when applied to biosensors such as electrochemicals, and thermal stability is significantly lower than that of DNA or other chemicals. . Therefore, the existing technology using antibodies in the diagnosis of blood biomarkers is not cost and time efficient, the range of application is limited, there are limited problems in the application as a biosensor. As a new sensing material for improving these problems, a lot of researches using aptamers that show high affinity and safety specifically for various target materials and are easier to chemically synthesize and change than antibodies. In addition, since the Systematic Evolution of Ligands by EXponential enrichment (SELEX) was developed in 1990 by the Gold's and Ellington's groups, large macromolecules, such as proteins, have been the main experimental targets, but affinity chromatography, capillary Advances in evolved SELEX technology using capillary electrophoresis and magnetic beads have made it possible to diversify target molecules, including small molecules, such as hormones or organic molecules, which are small in size, making antibodies difficult to make. . Therefore, a lot of research is being conducted to select aptamers for small molecules and use them in various fields.

Accordingly, the present inventors have made efforts to develop a new aptamer for ampicillin, and as a result, DNA aptamers showing high affinity for ampicillin from chemically synthesized ssDNA libraries using SELEX (Systematic Evolution of Ligands by Exponential enrichment) technology The invention was completed by establishing the sequence and structure of the DNA aptamers.

It is an object of the present invention to provide a novel DNA aptamer specifically binding to ampicillin (ampicillin), a method for preparing the same, and a composition and kit for detecting ampicillin using the DNA aptamer.

In order to achieve the above object, the present invention provides a DNA aptamer (aptamer) that specifically binds to ampicillin, characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 22.

In addition,

1) immobilizing ampicillin to the beads;

2) inducing binding by reacting the ampicillin-immobilized beads with an ssDNA library having 30-50 arbitrary bases in the center with a primer region for PCR preserved in the sock end;

3) isolating ssDNA bound to beads immobilized with ampicillin;

4) separating the ssDNA from the ssDNA bound to the isolated ampicillin immobilized beads; And

5) amplifying ssDNA that specifically binds to ampicillin by performing PCR using a primer pair complementary to the PCR primer region,

It provides a method for producing a DNA aptamer that specifically binds to ampicillin comprising a.

The present invention also provides a composition for detecting ampicillin comprising a DNA aptamer specifically binding to ampicillin, characterized in that it has a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 22.

In addition, the present invention provides a kit for detecting ampicillin comprising a DNA aptamer specifically binding to ampicillin, characterized in that it has a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 22.

The present invention has developed a DNA aptamer showing a specific high affinity for ampicillin (ampicillin) from a random ssDNA library using the SELEX (Systematic Evolution of Ligands by Exponential enrichment) technology using magnetic beads. According to the present invention, the use of DNA aptamers that can specifically bind to ampicillin is expected to measure ampicillin more sensitively and accurately than the antibody-based assays used in the prior art. Since it is small and easy to be immobilized on the surface, it is advantageous for producing a biosensor chip and can be effectively used for developing a composition and kit for detecting a trace amount of ampicillin remaining in human body, food, and water and sewage source.

1 is a diagram schematically illustrating a process of performing SELEX using magnetic beads.
Figure 2 is a graph showing the binding force of the aptamer (selectamer) selected for each step in the repeated screening process.
Figure 3 is a graph showing the result of confirming the degree of binding with ampicillin (ampicillin) by using the fluorescent apta-labeled DNA aptamer through the fluorescence intensity.

Hereinafter, the present invention will be described in detail.

The present invention provides a DNA aptamer (aptamer) that specifically binds to ampicillin, characterized in that it has a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 22.

The DNA aptamer more preferably has a nucleotide sequence of SEQ ID NO: 4, SEQ ID NO: 15 or SEQ ID NO: 16, but is not limited thereto.

The DNA aptamer is preferably prepared in the following steps, but is not limited thereto.

1) immobilizing ampicillin to the beads;

2) inducing binding by reacting an ampicillin-immobilized bead and an ssDNA library having 30-50 arbitrary bases in the center with the PCR primer region preserved in the sock end;

3) isolating ssDNA bound to beads immobilized with ampicillin;

4) separating the ssDNA from the ssDNA bound to the isolated ampicillin immobilized beads; And

5) Amplifying the ssDNA that specifically binds to ampicillin by performing PCR using a primer pair complementary to the PCR primer region.

In the above method, the beads of step 1) are preferably sepharose beads or magnetic beads, but are not limited thereto.

In the above method, the primer region for PCR in step 2) is preferably SEQ ID NO: 23 and SEQ ID NO: 24, but is not limited thereto.

In the above method, the steps 3) to 5) are preferably performed by additionally repeating 5 to 15 times, and more preferably 8 to 13 times, but not limited thereto.

In order to select DNA aptamers that specifically bind to ampicillin, the present inventors used SELEX (Systematic Evolution of Ligands by Exponential enrichment) using magnetic beads for antibiotic ampicillin from a chemically synthesized ssDNA library. Aptamer candidate ssDNA was selected using the technique (see FIGS. 1-2).

In addition, we analyzed DNA sequence and structure from selected aptamer candidate ssDNA, and then identified DNA aptamers that specifically bind to ampicillin having sequence and structural similarity (see Table 1).

In addition, the inventors of the present invention, in order to confirm the binding degree of each DNA aptamer, by analyzing the binding force using a magnetic bead immobilized with antibiotics and DNA aptamer immobilized with FAM fluorescent material, SEQ ID NO: 4, SEQ ID NO: 15 And it was confirmed that the binding degree of the DNA aptamer having the nucleotide sequence of SEQ ID NO: 16 is significantly high (see Figure 3).

Therefore, the DNA aptamer of the present invention was selected from the chemically synthesized ssDNA library using the SELEX technology to select a DNA aptamer that specifically binds to the antibiotic ampicillin, and sequence, properties and binding capacity of the selected DNA aptamer Through analysis, DNA aptamers specifically binding to ampicillin having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 22 was identified.

The present invention also provides a composition for detecting ampicillin comprising a DNA aptamer specifically binding to ampicillin, characterized in that it has a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 22.

The DNA aptamer more preferably has a nucleotide sequence of SEQ ID NO: 4, SEQ ID NO: 15 or SEQ ID NO: 16, but is not limited thereto.

The DNA aptamer of the present invention was selected from the chemically synthesized ssDNA library using a SELEX technology to select a DNA aptamer specifically binding to the antibiotic ampicillin, and analyzed the sequencing, characteristics and binding capacity of the selected DNA aptamer Through, it was confirmed that the DNA aptamer specifically binding to ampicillin having any one of SEQ ID NO: 1 to SEQ ID NO: 22, it can be usefully used as a composition for detecting or removing ampicillin containing the same.

 In addition, the present invention provides a kit for detecting ampicillin comprising a DNA aptamer specifically binding to ampicillin, characterized in that it has a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 22.

The DNA aptamer is more preferably one having a nucleotide sequence of SEQ ID NO: 4, SEQ ID NO: 15 or SEQ ID NO: 16, but is not limited thereto.

The DNA aptamer of the present invention was selected from the chemically synthesized ssDNA library using a SELEX technology to select a DNA aptamer specifically binding to the antibiotic ampicillin, and analyzed the sequencing, characteristics and binding capacity of the selected DNA aptamer Through the DNA aptamer specifically binding to the ampicillin having any one of SEQ ID NO: 1 to SEQ ID NO: 22, and thus can be usefully used as a kit for detecting ampicillin containing the same.

The kit of the present invention may include a buffer solution and containers for performing and analyzing the detection, if necessary, such as a bottle, a tub, a small sachet, an envelope, a tube or an ampoule. And the like, and they may be formed, in part or in whole, from plastic, glass, paper, foil or wax, and the like. The container may be equipped with a fully or partially separable stopper that may initially be part of the container or attached to the container by mechanical, adhesive or other means. The container may also be equipped with a stopper to access the contents by a needle. The kit may include an external package, and the external package may include instructions for use of the components.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

< Example  1> ssDNA ( single strand DNA ) Library Preparation

Synthetic ssDNA library [5'-CACCTAATACGACTCACTATAGCGGATCCGA (SEQ ID NO: 23) -N40-CTGGCTCGAACAAGCTTGC (SEQ ID NO: 23) having a binding sequence of conserved primers for PCR amplification and cloning at both ends and comprising a sequence of 40 random nucleotides in the middle) : 24) -3 ']. In addition, forward primer [5'-CACCTAATACGACTCACTATAGCGGA-3 '(SEQ ID NO: 25)], reverse primer [5'-GCAAGCTTGTTCGAGCCAG-3' (SEQ ID NO: 26) for PCR amplification and ssDNA generation. )] And biotin-bound reverse primer [5'-Biotin-GCAAGCTTGTTCGAGCCAG-3 '(SEQ ID NO: 27)] was used, and FAM-labeled forward primer [5'-FAM-CACCTAATACGACTCACTATAGCGGA-3' for binding analysis (SEQ ID NO: 28)]. In addition, all oligonucleotides were synthesized and PAGE-purified by Bionics (Korea).

< Example  2> Ampicillin ( ampicillin ) Fixed Bead  Produce

Ampicillin (Bio Basic INC. Canada) was immobilized on the beads using a reaction of a tosyl-activated magnetic bead (Invitrogen, USA) with ampicillin's primary amine group (-NH2).

Specifically, 20 μmole of ampicillin was mixed with 30 mg Tosyl-magnetic beads, followed by gentle stirring in 1 mL of coupling buffer (0.1 M borate, 0.67 M (NH ₄ ) ₂ SO ₄ , pH 9.5). Incubated at 37 ° C. for 20 hours, and then stopped with 1 mL of blocking buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ , 1.4 mM KH) to stop the reaction of tosyl groups on the surface of the beads that were not bound to ampicillin. ₂ PO ₄ , 0.05% tween 20, pH 7.4) at 37 ℃ for 1 hour. Then, using a magnet washed _twice with 1 mL of washing buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ , 1.4 mM KH ₂ PO ₄ , 0.01% tween 20, pH 7.4) and then ampicillin This immobilized magnetic beads were obtained.

< Example  3> Ampicillin on  Specific Aptamer  Selection

SELEX using magnetic beads was performed to select aptamers specific for ampicillin (FIG. 1).

Specifically, in order to remove ssDNA that non-specifically binds to magnetic beads, it is first dissolved in a binding buffer (20 mM Tris-HCL, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2, pH 8.0). The ssDNA library (500 pmole) was reacted with magnetic beads, and only the unbound supernatant was separated using a magnet. The isolated ssDNA library was allowed to react with ampicillin-immobilized magnetic beads at room temperature for 1 hour. After the reaction, the washed ssDNA was removed twice and the bound ssDNA was eluted with 20 mM NaOH. The eluted ssDNA was amplified by PCR using the biotin primer of <Example 1>. I was. Then, the magnetic beads immobilized with streptavidin were separated from dsDNA to ssDNA, and the separated ssDNA was reacted with the ampicillin immobilized magnetic beads, and the selection process was repeated. In the next screening process, the amount of ssDNA and the incubation time of ssDNA in the ampicillin-immobilized beads were further reduced for strict screening. The concentration of ssDNA was measured by UV spectrophotometer (UV spectrometer, Biochrom Libra S22 spectrometer) to check the degree of ampicillin binding of the remaining ssDNA and proceed with the screening process.

As a result, as shown in FIG. 2, the binding force (%) was calculated through the following <Equation 1> for each stage of the selection process, and the binding force for each stage of the selection process was confirmed (FIG. 2).

< Example  4> Cloning  And sequencing

The 13th reselected ssDNA was amplified by PCR using unmodified forward and reverse primers, cloned into a pENTR / TOPO vector (TOPO TA Cloning kit, Invitrogen, USA), and the vector was then transferred to Escherichia. coli ( E. coli ) TOP10 cells (Invitrogen, USA) were transformed. Clones into which ssDNA was inserted were purified using a miniprep kit (GeneAll, Korea), and then sequenced (COSMO Genetech, Korea). As a result of the sequencing analysis, as shown in Table 1, the nucleotide sequence of DNA specifically binding to ampicillin with high affinity was confirmed.

SEQ ID NO: Base sequence SEQ ID NO: 1  ATAGCACACTTCACCTCATTACACTCTAGATTGGTTTTCT SEQ ID NO: 2  TCAACTGCGGTCGATACGTTACTTACTCACTGGTTACACA SEQ ID NO: 3  ATATAACTGCAGCCTTACGCACTGGCCCCCTCCTGCTCCA SEQ ID NO: 4  CACGGCATGGTGGGCGTCGTGTGTGTGGGGTGGGGGGGTC SEQ ID NO: 5  CCCGACCACGTCCCTGCCCTTTCCTAACCTGTTTGTTGAT SEQ ID NO: 6  GATCAGCCTGTTATATCTTGTTTCTATTTTGTTTAGTAAC SEQ ID NO: 7  CCAACTACCTGACTCACGTATGTCGTTCCCGTACTTCTGC SEQ ID NO: 8  TGGGGTCACGCGTTAGCTGTTTTGACCGTCGCTCGGCGTG SEQ ID NO: 9  AGAGCACTCGACGTCGTGACTGAAGGCTATTCCTGATGTA  SEQ ID NO: 10  CCCCGCCCACATCCTGCCTCGCCGTCCCGTACCCC  SEQ ID NO: 11  CACGCCCCCACCAATATCTCACTATTGTCGCCCACCATGA  SEQ ID NO: 12  ACAAGCTTGCAGCACACCTAATACGACTCACTATAGCGGAACT SEQ ID NO: 13  TGAGGCCATCGCTCCTAAATACCGCATACACATTCTGATT SEQ ID NO: 14  TGGGCGCTGGCGTTCGCGTGATCTGCGTTGTGAATCATGC SEQ ID NO: 15  CGAGTTTGGGGGAATTGGGCGGGCGGTTGTATAGCGGTGT SEQ ID NO: 16  GGTTGAGCGATTGGTAAGTTTAGTTGGGGTTCAGTTGGTC SEQ ID NO: 17  GGAAGGAGGCGCGATAACAGTGTTCTTGACGATTGGTAA SEQ ID NO: 18  CAAGGCATCTGATTGGTGGGTAAAAACTACTAGTGTAGGG SEQ ID NO: 19  CGCGCACTGCCCCACATTACACGCAACTCTAGTCGCCATG SEQ ID NO: 20  GGCACTACCGGACACGTCTTCAACTATACTTTTCGGGTTG SEQ ID NO: 21  TACAACATCACATGCATCTCTTGCCTCATTCATACTCATC SEQ ID NO: 22  TAAGCCTAGTTCTGTGCCTTGCCGGGCATTTCCTCGGGTG

In addition, to analyze the structural similarity of the selected ssDNA, the secondary structure was investigated using the Mfold program ( http://mfold.bioinfo.rpi.edu/cgi-bin/dna-form1.cgi ).

As a result, it was confirmed that most DNA aptamers have a secondary structure in which the 'GC / CG' base pair in the stem part and the 'ACTG' sequence part in the loop part are similarly present, and also the '-TGG-' base. The presence of the sequence in the form of repetition was confirmed that the parts affect the binding.

< Example  5> ssDNA Force of adhesion

In order to confirm the binding capacity of the selected ssDNA to ampicillin, it was analyzed using fluorescence measurement.

Specifically, 20 μmole of ampicillin was mixed with 30 mg Tosyl-magnetic beads, followed by gentle stirring in 1 mL of coupling buffer (0.1 M borate, 0.67 M (NH ₄ ) ₂ SO ₄ , pH 9.5). Incubated at 37 ° C. for 20 hours, and then stopped with 1 mL of blocking buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ , 1.4 mM KH) to stop the reaction of tosyl groups on the surface of the beads that were not bound to ampicillin. ₂ PO ₄ , 0.05% tween 20, pH 7.4) at 37 ℃ for 1 hour. Then, using a magnet washed _twice with 1 mL of washing buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ , 1.4 mM KH ₂ PO ₄ , 0.01% tween 20, pH 7.4), 0.6 mg of the ampicillin-fixed magnetic beads were incubated with FAM-labeled ssDNA aptamer for 1 hour at room temperature with gentle stirring in 100 mL of binding buffer, and unbound aptamers were removed by washing. The amount of FAM-labeled ssDNA aptamer bound to ampicillin-fixed magnetic beads was measured by fluorescence measurement (1420 Victor multilabel counter, PerkinElmer, USA) by separating only AMP-labeled ssDNA bound to ampicillin using a magnet. .

As a result, as shown in Figure 3 as a result of comparing the binding degree of each DNA aptamer with ampicillin using the fluorescence intensity, the binding force of the DNA aptamer having the nucleotide sequence of SEQ ID NO: 4, SEQ ID NO: 15 and SEQ ID NO: 16 It was confirmed to be high compared to other aptamers (FIG. 3).

Attach an electronic file to a sequence list

Claims (7)

A DNA aptamer specifically binding to ampicillin, characterized in that it has a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 22.
1) immobilizing ampicillin to the beads;
2) inducing binding by reacting the ampicillin-immobilized beads with an ssDNA library having 30-50 arbitrary bases in the center with a primer region for PCR preserved in the sock end;
3) isolating ssDNA bound to beads immobilized with ampicillin;
4) separating the ssDNA from the ssDNA bound to the isolated ampicillin immobilized beads; And
5) amplifying ssDNA that specifically binds to ampicillin by performing PCR using a primer pair complementary to the PCR primer region,
Method for producing a DNA aptamer specifically binding to ampicillin of claim 1 comprising a.
The method of claim 2, wherein the bead is a sepharose bead or a magnetic bead.
The ampicillin according to claim 2, wherein the primer region for PCR in step 2) has a nucleotide sequence of SEQ ID NO: 23 at the 5 'end and a nucleotide sequence of SEQ ID NO: 24 at the 3' end. Method for producing DNA aptamers that specifically bind.
3. The method of claim 2, wherein the steps of 2) to 5) are repeated 13 or more times.
Ampicillin detection composition comprising a DNA aptamer specifically binding to ampicillin, characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 22.
Ampicillin detection kit comprising a DNA aptamer specifically binding to ampicillin, characterized in that having a nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 22.

Images