WO2009027507A2 - Aptamers which bind to a target molecule involved in haemostasis - Google Patents

Abstract

The invention relates to an aptamer which binds to a target molecule involved in haemostasis, where the aptamer is an aptamer which binds to activated protein C, where the aptamer binds to activated protein C with a dissociation constant KD in the range from ≥ 0.001 nM to ≤ 80 nM, and where the aptamer has a length in the range from ≥ 20 nucleotides to ≤ 160 nucleotides, or where the aptamer is a thrombin-binding fusion aptamer comprising at least two aptamers which bind to thrombin and at least one linker, where the at least one linker connects the at least two aptamers which bind to thrombin.

Description

 RHEINISCHE FRIEDRICH-WILHELMS UNIVERSITY

Dusseldorf, August 29, 2008 Our sign: UD 40090 / SAM

Rheinische Friedrich-Wilhelms University Regina-Pacis-Weg 3, 53113 Bonn, Germany

Aptamers that bind to a target molecule involved in hemostasis

The invention relates to aptamers which bind to a target molecule involved in hemostasis, wherein the aptamer is an aptamer which binds to activated protein C or is a thrombin-binding fusion aptamer.

Activated Protein C (APC) is a serine protease and the active form of the blood-circulating zymogen protein C. As a so-called "endogenous inhibitor", activated protein C inactivates the activated coagulation factors Va and Villa and thereby controls plasmatic coagulation activation. Decreased production of activated protein C or disruption of activated protein C activity is associated with an increased risk of developing venous thrombosis and plays a crucial role in the pathogenesis of microcirculatory disorders, such as those associated with severe sepsis. A recombinantly produced concentrate of activated protein C is used, for example, in the treatment of severe sepsis.

Despite the central role played by activated protein C in the pathogenesis, pathophysiology, and therapy of various vascular and inflammatory diseases, there is no routine diagnostic test available to measure the level of activated protein C in plasma or whole blood.

The detection of activated protein C is hampered by its low plasma concentrations and a simultaneous 10,000-fold excess of protein C. UD 40090 / SAM: AL In addition, the amino acid sequence of activated protein C is identical to that of protein C except for a twelve amino acid propeptide.

Although methods for determining the activity of activated protein C, for example by determining the protein C-propeptide concentration, are known, they can not be used in the diagnosis because of numerous technical problems.

Furthermore, US Pat. No. 6,989,241 discloses a monoclonal antibody against activated protein C for differentiating between activated protein C and protein C. However, the affinity of this antibody for protein C is only one order of magnitude lower. Accordingly, a test procedure developed on the basis of this antibody is basically suitable for the determination of activated protein C, but requires incubation times of more than 19 hours due to the low affinity differences and shows a limited specificity. In addition, a complicated preanalytical sample processing is required.

The object of the invention was to provide a means which overcomes at least one of the aforementioned disadvantages of the prior art. In particular, the object of the present invention was to provide a means that allows detection of activated protein C.

Another object of the invention was to provide thrombin-inhibiting aptamers.

According to the invention, the object is achieved by an aptamer which binds to a target molecule involved in the hemostasis, wherein the aptamer: is an aptamer that binds to activated protein C, the aptamer having a dissociation constant K _D in the range of> 0.001 nM to ≤ 80 nM of activated protein C, and wherein the aptamer has a length in the range of> 20 nucleotides to ≤ 160 Nucleotides, or is a thrombin-binding fusion aptamer comprising at least two thrombin-binding aptamers and at least one linker, wherein the at least one linker connects the at least two thrombin-binding aptamers.

A further subject matter relates to a method for the determination of activated protein C in biological samples, wherein at least one aptamer binding to activated protein C is incubated with the biological sample, preferably a biological fluid, and a binding event between the aptamer and activated protein C is detected.

Further advantageous embodiments of the invention will become apparent from the dependent claims.

For the purposes of this invention, the term "aptamer" is to be understood as meaning oligonucleotides which bind specifically and with high affinity to a target molecule, in particular to a target protein involved in the hemostasis, such as activated protein C or thrombin.

The inventors have surprisingly been able to select aptamers capable of binding activated protein C with high affinity. A particular advantage of the activated protein C binding aptamers invention is provided by the fact that these activated protein C can bind with high affinity and high selectivity. In particular, the aptamers according to the invention can specifically bind to activated protein C in relation to the inactive zymogen protein C. In particular, the aptamers of the invention are characterized by a high affinity in the nanomolar and sub-nanomolar range and a pronounced specificity for activated protein C over the inactive zymogen protein C. These properties allow a reliable determination of activated protein C even in the presence of a large excess of inactive zymogen protein C, and a reproducible determination of activated protein C in biological samples. The affinity and specificity of the activated protein C binding aptamers according to the invention are preferably better or at least comparable to that of antibodies. A further advantage is that the aptamers provided according to the invention, in contrast to antibodies, are inexpensive to produce synthetically.

The selection of the aptamers according to the invention was carried out according to the known SELEX® (Systematic Evolution of Ligands by Exponential Enrichment) method, for example described in US Pat. Nos. 5,475,096, 5,270,163 and EP 0 533 838, to which reference is hereby made, in particular to the so-called counter- SELEX® process. First, the synthesis of a randomized DNA pool was carried out. Aptamers were generated schematically by the following steps. Aptamers from the DNA pool were enriched by binding the pool with activated protein C and separating the binding complex from unbound ssDNA. In order to suppress an accumulation of matrix binders, a pre-selection against streptavidin beads took place before the selected selection step. After incubation with activated protein C, the bound ssDNA was eluted, amplified, and the resulting dsDNA transferred to ssDNA before the procedure was repeated with these ssDNAs. This was repeated 11 times. After cloning the selected aptamer pool, the sequence of individual aptamers was determined by sequencing and sequence analysis, and the binding properties were characterized by binding studies. Selected aptamers of known structure can be prepared by conventional methods of nucleic acid synthesis and / or amplification. The binding ability of the selected aptamers is described by the affinity of the bond, usually expressed in terms of the dissociation constant.

In a preferred embodiment of the present invention, the activated protein C binding aptamer with a dissociation constant K _D in the range of> 0.002 nM to ≤ 8 nM, preferably in the range of> 0.005 nM to ≤ 5 nM, preferably in the range of

> 0.01 nM to ≤ 2 nM, more preferably in the range of> 0.05 nM to ≤ 1.5 nM, very particularly preferably in the range of> 0.1 nM to ≤ 1.3 nM, of activated protein C.

The dissociation constants K _D were determined by non-linear regression using a 4-parameter logistics function. The determination was carried out by nonlinear regression of the data points of radioactively labeled aptamers bound to activated protein C compared to the concentration of the activated protein C used, as described in Example 3. For the calculation, the function "Logistic Dose Response in Pharmacology / Chemistry" of the software Origin 7.5 (OriginLab, Northampton, MA, USA) was used.

In a further preferred embodiment of the present invention, the activated protein C-binding aptamer has a number of nucleotides in the range of> 20 nucleotides to ≤ 120 nucleotides, preferably in the range of> 40 nucleotides to ≤ 88 nucleotides. More preferably, the activated protein C-binding aptamer has a number of nucleotides in the range of> 44 nucleotides to ≤ 120 nucleotides, preferably in the range of> 44 nucleotides to ≤ 88 nucleotides, preferably in the range of

> 44 to ≤ 52 nucleotides. Unless otherwise stated below, the term "nucleotide" includes the terms "ribonucleotide" and "deoxyribonucleotide". Accordingly, the term "2'-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotide"2'-fluoro,2'-methoxy and / or 2'-amino-modified ribonucleotides and deoxyribonucleotides ,

Aptamers according to the invention may have a DNA or an RNA sequence. It is understood that in the case that aptamers according to the invention have an RNA sequence, thymidine is replaced by uridine in the specified sequence motifs and sequences.

The RNA sequences suitable according to the invention correspond to the DNA sequences according to the invention, T being replaced by U.

Preferably, aptamers have a DNA sequence. DNA-based aptamers advantageously have increased stability.

Also suitable are aptamers which have a sequence comprising 2'-modified nucleotides, for example 2'-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides. Also suitable are aptamers which have 2'-modified ribonucleotides, for example 2'-fluoro, 2'-methoxy and / or 2'-amino-modified ribonucleotides. Furthermore, aptamers may have deoxyribonucleotides and 2'-modified ribonucleotides, for example 2'-fluoro, 2'-methoxy and / or 2'-amino-modified ribonucleotides.

In the context of the present invention, it was possible to select activating protein C-binding aptamers which could be assigned to three main groups, the sequences of the aptamers having a common sequence motif within one main group. This common sequence motif varies within a main group only in individual base positions.

In a preferred embodiment of the present invention, the activated protein C binding aptamer comprises a sequence motif selected from the group comprising:

5'-TATCCCGN _I ATGGG-S '(SEQ ID NO: 1)

wherein:

Ni is selected from the group comprising guanine, cytosine, adenine, thymine, uracil, 2'-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotide, in particular ribonucleotide, or a deletion;

5'-TCTN ₂ TCGGCGG-S '(SEQ ID NO: 2)

wherein:

N ₂ is selected from the group comprising guanine, cytosine, adenine, thymine, uracil, 2'-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotide, in particular ribonucleotide, or a deletion,

and or

5'-TATCACGTATGGG-S '(SEQ ID NO: 3),

wherein the sequence motifs selected from the group comprising SEQ ID NO: 1, SEQ ID NO: 2 and / or SEQ ID NO: 3 modified nucleotides, preferably selected from Group comprising Locked nucleic acids, 2'-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides.

"C" in this case corresponds to the usual one-letter code of the bases for cytosine used here, correspondingly "A" stands for adenine, "G" for guanine and "T" for thymine, "U" for uracil.

In particular, the positions Ni and N _{2 of} the sequence motifs SEQ ID NO: 1 and SEQ ID NO: 2 are highly variable. Thus, the positions Ni and N _{2 may} comprise different bases or nucleotides or a deletion. For example, at positions Ni and N _2, a ribonucleotide may be included in a DNA aptamer. Furthermore, in particular at the positions Ni and N ₂ modified nucleotides, in particular modified ribonucleotides may be included.

In preferred embodiments, the sequence motifs selected from the group comprising SEQ ID NO: 1, SEQ ID NO: 2 and / or SEQ ID NO: 3 of the activated protein C-binding aptamer have no modified nucleotides.

Without being bound to a particular theory, it is believed that the sequence motifs selected from the group comprising SEQ ID NOs: 1 to 3 have an essential meaning in the binding of the aptamers according to the invention to activated protein C.

Among the activated protein C-binding aptamers having a sequence motif 5'-TATCCCGNi ATGGG-3 '(SEQ ID NO: 1), four subgroups were identified, each having a common base Ni selected from the group comprising guanine, cytosine, adenine and / or thymine. In a preferred embodiment of the present invention, the activated protein C binding aptamer comprises a sequence motif selected from the group comprising:

5'-TATCCCGTATGGG-S '(SEQ ID NO: 4),

5'-TATCCCGGATGGG-S '(SEQ ID NO: 5),

5'-TATCCCGAATGGG-S '(SEQ ID NO: 6) and / or

5'-TATCCCGCATGGG-S '(SEQ ID NO: 7).

Here, the sequence motifs SEQ ID NOs: 4 to 7 may have modified nucleotides, preferably selected from the group consisting of locked nucleic acids, 2'-fluoro, T-methoxy and / or 2'-amino-modified nucleotides.

Without wishing to be bound by any particular theory, it is assumed that the sequence motifs selected from the group comprising SEQ ID NOs: 4 to 7 can mediate particularly good binding of the aptamers according to the invention to activated protein C.

The aptamer sequences SEQ ID NOs: 8 to 19 have a common consensus sequence 5'-TATCCCGTATGGG-S '(SEQ ID NO: 4) having the base thymine at position 8 within the group of SEQ ID NO: 1.

In preferred embodiments of the present invention, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-CATCCCGTGGCCGGTAACTTATCCCGTATGGGGGCCCTCAGGGATACTC-S '(SEQ ID NO: 8),

5'-GGTTCTTCATTGCGCACGCGACATTGCCAATCTATCCCGTATGGGGTCG-S '(SEQ ID NO: 9), 5'-GTCAATGTGGGTGTTACTTATCCCGTATGGGGCACTTGCCGTTTAGTT-S '(SEQ ID NO: 10),

5'-CGAGAATACCATCTATCCCGTATGGGGGAGTCCGCCTACATGTGAACTC-S '(SEQ ID NO: 11),

5'-AACCCAACGGCTGGACCACGATTTTAATCCTATCCCGTATGGGGTGGT-S '(SEQ ID NO: 12)

5'-GGTGAACCCCGCATCAGCCTATCCCGTATGGGGGGGTTCGCGAAGTGGT-S '(SEQ ID NO: 13),

5'-ATCGAAGTTGGTATATCCCGTATGGGCCCGCCTAGGTGGGGATTAACTT-S '(SEQ ID NO: 14),

5'-CAGCCAGTTTACTCTATCCCGTATGGGGGCTGTATAGGGGCCTGGCGGC-S '(SEQ ID NO: 15)

5'-AAAAGCAGTTGTGGCCTCCGTCTTCTGACCTATCCCGTATGGGGGAACA-S '(SEQ ID NO: 16)

5'-GCATATCCCGTATGGGGGTCGTCGTACGGCCGGCGTGGTCCTGAAGTGA-S '(SEQ ID NO: 17),

5'-GGCGCGGTGCTTATCCCGTATGGGGCCGTTATCTGCGCGCGTATCCACT-S '(SEQ ID NO: 18), and / or 5'-TATCCCGTATGGGGGACCGCCGTGCCTGGAGTTGTCCGTTATTTGGTGG-S '(SEQ ID NO: 19),

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have.

Portions of the aforementioned aptamer sequences include the sequence motif 5'-TATCCCGTATGGG-3 '(SEQ ID NO: 4).

Variants of the sequences according to the invention can be formed by modifications, such as alkylation, in particular methylation, arylation or acetylation of at least one nucleotide, incorporation of enantiomers and / or fusion of the aptamers with one or more nucleotides or a nucleic acid sequence. Mutants can be obtained, for example, by substitution, deletion, insertion, translocation, inversion and / or addition of at least one nucleotide.

The aptamer sequences SEQ ID NOs: 20 to 31 have a common consensus sequence 5'-TATCCCGGATGGG-S '(SEQ ID NO: 5) which has the base guanine at position 8 within the group of sequences according to SEQ ID NO: 1 ,

In preferred embodiments of the present invention, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-TGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTATGAGGCGCGAC-S '(SEQ ID NO: 20), 5'-ACTGACGGAGTAGAGTATCCCGGATGGGCGTCTGTTTGGCCACCGTCCA-S '(SEQ ID NO: 21),

5'-TGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTATGAGGCGCGAC-S '(SEQ ID NO: 22),

5'-GTGTTCGGGCGTTAACTTATCCCGGATGGGGCACGAAGAGTTTGTC-S '(SEQ ID NO: 23),

5'-AGAGGACGTGCTATGCTTATCCCGGATGGGGTACTAGGGGCTAGGAGCT-S '(SEQ ID NO: 24),

5'-GAAGAGTGGCCATATCCCGGATGGGCTTGTAAAACGCTTTATAAGGGGC-S '(SEQ ID NO: 25),

5'-GATGGAGCATGGAGGGCGGCCACGTTGGCATATCCCGGATGGGGGCGTC-S '(SEQ ID NO: 26),

5'-ACCGCATACTGCCTATCCCGGATGGGGGTGTTCTCTGACTGGAAAACGA-S '(SEQ ID NO: 27)

5'-GCATCGAAGTGAAACGTGCAACTTATCCCGGATGGGGTTTCACGGTATCA TGCTTATTCTTGTCTCCCGACGTAGCGGAGCAGTGTTG-S '(SEQ ID NO: 28),

5'-GCATCGAAGTGAAACGTGCAACTTATCCCGGATGGGGTTTCACAGTAT-S '(SEQ ID NO: 29) 5'-ACCGCATGCTGCCTATCCCGGATGGGGGTGTTCTCTGACTGGAAAACGA-S '(SEQ ID NO: 30), and / or

5'-GATCAGTATTACATAAGCTTGATGGGGTCACTTATCCCGGATGGGGCAT-S '(SEQ ID NO: 31),

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have. Portions of the aptamer sequences include the sequence motif 5'-TATCCCGGATGGG-S '(SEQ ID NO: 5).

In preferred embodiments of the present invention, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-CAGCTTGCTCTATCCCGAATGGGGGTTACGGTTCTATTTAACTGTGTAA-S '(SEQ ID NO: 32),

5'-GACGTGTCCTATCCCGAATGGGGTTAGTTTAGGCGAGCTAAAGGTGTTG-S '(SEQ ID NO: 33)

5'-TGTTTCGCCGACTAAGTCCTATCCCGAATGGGGGCGGAAAGTACGTGTG-S '(SEQ ID NO: 34), and / or

and / or their variants, mutants and / or parts, wherein the activated protein C binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer-modified nucleotides, preferably selected from the group consisting of Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'- Amino-modified nucleotides may have. Portions of the aptamer sequences include the sequence motif 5'-TATCCCGAATGGG-S '(SEQ ID NO: 6).

The aptamer sequences SEQ ID NOs: 32-34 have a common consensus sequence 5'-TATCCCGAATGGG-S '(SEQ ID NO: 6) having the base adenine at position 8 within the group of SEQ ID NO: 1.

In preferred embodiments of the present invention, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-GTTAACTTATCCCGCATGGGGTTGGGAGCGCCACCCACCCTCACCTCGG-S '(SEQ ID NO: 35), and / or

5'-AGCGCCGTGAAGACGTGTCGCATGGCGAGAATCCTATCCCGCATGGGGC CATGCTTATTCTTGTCTCCCCAGTGGCT-3 '(SEQ ID NO: 36),

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have. Portions of the aptamer sequences include the sequence motif 5'-TATCCCGCATGGG-3 '(SEQ ID NO: 7). The aptamer sequences SEQ ID NOs: 35 and 36 have a common consensus sequence 5'-TATCCCGCATGGG-3 '(SEQ ID NO: 7) having the base cytosine at position 8 within the group of SEQ ID NO: 1.

In further preferred embodiments of the present invention, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-AGGACACATATCCCGTATGGGGGTGAAGCTTTTCCGTCGTCACCGGTGT-S '(SEQ ID NO: 103)

5'-TTGCGCCATATCCCGGATGGGGGCCGAAATCGTATTGGAGGGCGGGTG-S '(SEQ ID NO: 104)

5'-AGCGCCGTGAAGGCGTGTCGCATGGCGAGAATCTTATCCCGCATGGGGC-S '(SEQ ID NO: 105)

5'-AGATGCGGAGGGGCTGCCGGGCGGTTACTTATCCCGTATGGGGCACGGT-S '(SEQ ID NO: 106)

5'-ACTGACGGAGTAGAGTATCCCGGATGGGCGTCTGTTTGGCCACCGTCCA-S '(SEQ ID NO: 107),

5'-ATGGGCAGTGCGTTGGCGTGGGCCTAGCTCTTATCCCGGATGGGTGAC-S '(SEQ ID NO: 108)

5'-GACGTGTCCTATCCCGAATGGGGTTAGTTTAGGCGAGCTAAAGGTGTCG-S '(SEQ ID NO: 109) 5'-GATCTGGTCGCTACTAGCCTATCCCGAATGGGGGCGGAAAGTACGTGTG-S '(SEQ ID NO: 110),

5'-CATCCCGTGGCCGGTAACTTATCCCGTATGGGGGCCCTCAGGGATACTC-S '(SEQ ID NO: 111),

5'-CCACTGGTAGATCGGGGAATTCTTATCCCGTATGGGCCCGATCGGCCCTA-S '(SEQ ID NO: 112),

5'-GATCTGGTCGCTACTAGCCTATCCCGAATGGGGACCGAGAGTACACGGT-S '(SEQ ID NO: 113)

5'-CGAGAATATCATCTATCCCGTATGGGGGAGTCCGCCTACATGTGAACTC-S '(SEQ ID NO: 114),

5'-TGGTCAGCTTTGGCTTATCCCGTATGGGGACCTTGGGTAGCTTTGCACA-S '(SEQ ID NO: 115),

5'-AGGACACATATCCCGTATGGGGGTGAAGCTTTTCCGTCGTCACCGGTGT-S '(SEQ ID NO: 116),

5'-ACACCAGCCTGGAAAGTAATTCCTGCTCTATCCCGTATGGGGGTGTGTC-S '(SEQ ID NO: 117),

5'-ATATCCCGTATGGGGTCGATATGAATCTCATTGGTTGACGGTTAGGGAT-S '(SEQ ID NO: 118),

5'-GACCAAGGGTAACAATGTGTTATATATCCCGGATGGGCTTGGTCTTGAG-S ' (SEQ ID NO: 119),

5'-TGGCGTGAAGAGTTTCTGCTATCCCGTATGGGTTCACGCGTATGTTTTG-S '(SEQ ID NO: 120), and / or

5'-CTGGAAGCAAAACTTTCGATTCATCTATCCCGAATGGGCGAATTTTGGT-S '(SEQ ID NO: 121)

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have. The sequences SEQ ID NO: 103 to 121 and / or parts of these aptamer sequences include the sequence motif 5'-TATCCCGN _I ATGGG-S '(SEQ ID NO: 1), in particular the sequence motifs 5'-TATCCCGTATGGG-S' (SEQ ID NO: 4), 5'-TATCCCGGATGGG-S '(SEQ ID NO: 5), 5'-TATCCCGAATGGG-3' (SEQ ID NO: 6) or 5'-TATCCCGCATGGG-S '(SEQ ID NO: 7).

In also preferred embodiments of the present invention, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-GTTGGGAACCTTAGTTCCCTATCACGGATGGGCAACTTGGGAGGTGGTC-S '(SEQ ID NO: 122), and / or

5'-GTTGGGAACCTTAGTTCCCTATCACGGATGGGCAACTTGGGAGGTGATC-S '(SEQ ID NO: 123), and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have. The sequences SEQ ID NO: 122 and 123 and / or parts of these aptamer sequences comprise the sequence motif 5'-TATCACGGATGGGC-S '(SEQ ID NO: 124), which differs from the sequence motif SEQ ID NO: 1 in that adenine is contained at position 5.

In still preferred embodiments of the present invention, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-TAAGTCACGGCAGCAGCCGCTCTATCCCAAATGGGGCCGTGTACATTAC-S '(SEQ ID NO: 125), and / or

5'-CTATCCCGTATAGGGGGGCGTATGCTTAACACGCGCCGTAACGGAGGAC-S '(SEQ ID NO: 126)

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have. The sequences SEQ ID NO: 125 and 126 and / or parts of these aptamer sequences comprise the sequence motif 5'-TATCCCAAATGGGG-3 '(SEQ ID NO: 127), which differs from the sequence motif SEQ ID NO: 1 in that adenine at position 7, or the sequence motif 5'-TATCCCGTATAGGG-S '(SEQ ID NO: 128), which is different from the sequence motifs SEQ ID NO: 1 differs in that adenine is contained at the position 11.

Further, among the activated protein C-binding aptamers having a sequence motif 5'-TCTN ₂ TCGGCGG-S '(SEQ ID NO: 2), subgroups have been identified, each preferably a common base N ₂ selected from the group comprising guanine and / or have thymine.

In also preferred embodiments of the present invention, the activated protein C-binding aptamer comprises a sequence motif selected from the group comprising:

5'-TCTGTCGGCGG-3 '(SEQ ID NO: 37) and / or 5'-TCTTTCGGCGG-S' (SEQ ID NO: 38).

In preferred embodiments of the present invention, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-GTCTGTTGCGACGCGTATGGATCTGTCGGCGGTTTCGCGTCATTGAGTG-S '(SEQ ID NO: 39), and / or

5'-CGAGTAGTTGCGTGGTCTGTCGGTGGTCAGCAACTCTTCTTACCGGTCT-S '(SEQ ID NO: 40)

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, 2'- Fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have. Portions of the aptamer sequences include the sequence motif 5'-TCTGTCGGCGG-3 '(SEQ ID NO: 37).

The aptamer sequences SEQ ID NOs: 39 and 40 have a common consensus sequence 5'-TCTGTCGGCGG-3 '(SEQ ID NO: 37).

In still preferred embodiments of the present invention, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-GTGGATCGTACGCGGTTCTTTCGGTGGCAGGAGAGACATCGCGGAGGAT-S '(SEQ ID NO: 41)

5'-ATGCAGTTAAGGTGCTGGTCTTTCGGTGGATTCCTGCTGCAATTACGTT-S '(SEQ ID NO: 42), and / or

5'-ATGCAGTTAAGGTGCTGGTCTTTCGGTGGATTCCTGCTGCAATTACGTT-S '(SEQ ID NO: 43)

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have. Portions of the aptamer sequences include the sequence motif 5'-TCTTTCGGCGG-3 '(SEQ ID NO: 38).

The aptamer sequences SEQ ID NOs: 41 to 43 have a common consensus sequence 5'-TCTTTCGGCGG-3 '(SEQ ID NO: 38). In also preferred embodiments of the present invention, the activated protein C-binding aptamer comprises the sequence motif 5'-TATCACGTATGGG-S '(SEQ ID NO: 3).

In further embodiments of the present invention, the activated protein C binding aptamer comprises a sequence selected from the group comprising:

5'-TCGCACCTATCACGTATGGGCGTTGGTATGCCAACGGTGCGGTGTGTT-S '(SEQ ID NO: 44), and / or

5'-TCGCACCTATCACGTATGGGCGTTGGTATGCCAACGGTGCGGTGTGTT-S '(SEQ ID NO: 45),

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have. Portions of the aptamer sequences each comprise the sequence motif 5'-TATCACGTATGGG-S '(SEQ ID NO: 3).

In another embodiment of the present invention, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

S'-ATCGCTTCAGGGCCACAGTACCGGTTGAATTCCTCGCGATGTCTGGACA-S 'tSEQ ID NO: 46), 5'-ATCGCTTCAGGGCCACAGTACCGGTTGAATTCCTCGCGATGTCTGAACA ^ (SEQ ID NO: 129), and / or

S'-ATCGCTTCAGGGCCACAGTACCGGTTGAATTCCTCGCGATGTCTGGACA-S 'TSEQ ID NO: 130),

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have. The sequences SEQ ID NO: 46, 129 and 130 and / or parts of these aptamer sequences comprise the sequence motif 5'-ATCGCTTC AGGG-3 '(SEQ ID NO: 131).

In another embodiment of the present invention, the activated protein C binding aptamer has a sequence

5'-ACGTGAATGTCTGGCTGGTGTAGGTCTGGGCTGGACGTGGGGCTAGTGA-S '(SEQ ID NO: 47).

In another embodiment of the present invention, the activated protein C binding aptamer has a sequence

5'-ACGTGAATGTCTGGCTGGTGTAGGTCTGGGCTGGACGTGGGGCTAGTGA-S '(SEQ ID NO: 132).

In further embodiments of the present invention, the activated protein C binding aptamer comprises a sequence selected from the group comprising: 5'-GCCTGTTGTGAGCCTCCTAACCATCCCGTGGCCGGTAACTTATCCCGTATGGGGGCCCTCAGGGATACTCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 48),

5'-GCCTGTTGTGAGCCTCCTAACGGTTCTTCATTGCGCACGCGACATTGCCAATC TATCCCGTATGGGGTCGCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 49)

5'-GCCTGTTGTGAGCCTCCTAACGTCAATGTGGGTGTTACTTATCCCGTATGGGG CACTTGCCGTTTAGTTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 50)

5'-GCCTGTTGTGAGCCTCCTAACCGAGAATACCATCTATCCCGTATGGGGGAGT CCGCCTACATGTGAACTCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 51)

5'-GCCTGTTGTGAGCCTCCTAACAACCCAACGGCTGGACCACGATTTTAATCCTATCCCGTATGGGGTGGTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 52)

5'-GCCTGTTGTGAGCCTCCTAACGGTGAACCCCGCATCAGCCTATCCCGTATGGGGGGGTTCGCGAAGTGGTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 53)

5'-GCCTGTTGTGAGCCTCCTAACATCGAAGTTGGTATATCCCGTATGGGCCCGC CTAGGTGGGGATTAACTTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 54),

5'-GCCTGTTGTGAGCCTCCTAACCAGCCAGTTTACTCTATCCCGTATGGGGGCTG TATAGGGGCCTGGCGGCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 55)

5'-GCCTGTTGTGAGCCTCCTAACAAAAGCAGTTGTGGCCTCCGTCTTCTGACCTA TCCCGTATGGGGGAACACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 56) 5'-GCCTGTTGTGAGCCTCCTAACGCATATCCCGTATGGGGGTCGTCGTACGGCC GGCGTGGTCCTGAAGTGACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 57)

5'-GCCTGTTGTGAGCCTCCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGC TCTTATGAGGCGCGACCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 58),

5'-GCCTGTTGTGAGCCTCCTAACACTGACGGAGTAGAGTATCCCGGATGGGCGT CTGTTTGGCCACCGTCCACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 59)

5'-GCCTGTTGTGAGCCTCCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCT CTTATGAGGCGCGACCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 60)

5'-GCCTGTTGTGAGCCTCCTAACGTGTTCGGGCGTTAACTTATCCCGGATGGGG CACGAAGAGTTTGTCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 61)

5'-GCCTGTTGTGAGCCTCCTAACAGAGGACGTGCTATGCTTATCCCGGATGGGG TACTAGGGGCTAGGAGCTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 62)

5'-GCCTGTTGTGAGCCTCCTAACGAAGAGTGGCCATATCCCGGATGGGCTTGTA AAACGCTTTATAAGGGGCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 63)

5'-GCCTGTTGTGAGCCTCCTAACGATGGAGCATGGAGGGCGGCCACGTTGGCAT ATCCCGGATGGGGGCGTCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 64),

5'-GCCTGTTGTGAGCCTCCTAACACCGCATACTGCCTATCCCGGATGGGGGTGTT CTCTGACTGGAAAACGACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 65), 5'-GCCTGTTGTGAGCCTCCTAACGCATCGAAGTGAAACGTGCAACTTATCCCGG ATGGGGTTTCACGGTATCATGCTTATTCTTGTCTCCCGACGTAGCGGAGCAGTGTT GCATGCTTATTCTTGTCTCCC-3 '(SEQ ID NO: 66)

5'-GCCTGTTGTGAGCCTCCTAACGCATCGAAGTGAAACGTGCAACTTATCCCGG ATGGGGTTTCACAGTATCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 67),

5'-GCCTGTTGTGAGCCTCCTAACACCGCATGCTGCCTATCCCGGATGGGGGTGTT CTCTGACTGGAAAACGACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 68)

5'-GCCTGTTGTGAGCCTCCTAACGATCAGTATTACATAAGCTTGATGGGGTCACT TATCCCGGATGGGGCATCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 69),

5'-GCCTGTTGTGAGCCTCCTAACCAGCTTGCTCTATCCCGAATGGGGGTTACGGT TCTATTTAACTGTGTAACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 70),

5'-GCCTGTTGTGAGCCTCCTAACGACGTGTCCTATCCCGAATGGGGTTAGTTTA GGCGAGCTAAAGGTGTTGCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 71),

5'-GCCTGTTGTGAGCCTCCTAACTGTTTCGCCGACTAAGTCCTATCCCGAATGGGGGCGGAAAGTACGTGTGCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 72)

5'-GCCTGTTGTGAGCCTCCTAACGTTAACTTATCCCGCATGGGGTTGGGAGCGC CACCCACCCTCACCTCGGCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 73),

5'-GCCTGTTGTGAGCCTCCTAACAGCGCCGTGAAGACGTGTCGCATGGCGAGAA TCCTATCCCGCATGGGGCCATGCTTATTCTTGTCTCCCCAGTGGCTCATGCTTATT CTTGTCTCCC-3 '(SEQ ID NO: 74) 5'-GCCTGTTGTGAGCCTCCTAACGTCTGTTGCGACGCGTATGGATCTGTCGGCGG TTTCGCGTCATTGAGTGCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 75)

5'-GCCTGTTGTGAGCCTCCTAACCGAGTAGTTGCGTGGTCTGTCGGTGGTCAGC AACTCTTCTTACCGGTCTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 76),

5'-GCCTGTTGTGAGCCTCCTAACGTGGATCGTACGCGGTTCTTTCGGTGGCAGG AGAGACATCGCGGAGGATCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 77)

5'-GCCTGTTGTGAGCCTCCTAACATGCAGTTAAGGTGCTGGTCTTTCGGTGGATT CCTGCTGCAATTACGTTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 78)

5'-GCCTGTTGTGAGCCTCCTAACATGCAGTTAAGGTGCTGGTCTTTCGGTGGATT CCTGCTGCAATTACGTTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 79)

5'-GCCTGTTGTGAGCCTCCTAACGGCGCGGTGCTTATCCCGTATGGGGCCGTTAT CTGCGCGCGTATCCACTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 80)

5'-GCCTGTTGTGAGCCTCCTAACTCGCACCTATCACGTATGGGCGTTGGTATGC CAACGGTGCGGTGTGTTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 81)

5'-GCCTGTTGTGAGCCTCCTAACTATCCCGTATGGGGGACCGCCGTGCCTGGAG TTGTCCGTTATTTGGTGGCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 82)

5'-GCCTGTTGTGAGCCTCCTAACTCGCACCTATCACGTATGGGCGTTGGTATGC CAACGGTGCGGTGTGTTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 83) 5'-GCCTGTTGTGAGCCTCCTAACATCGCTTCAGGGCCACAGTACCGGTTGAATTC CTCGCGATGTCTGGACACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 84), and / or

5'-GCCTGTTGTGAGCCTCCTAACACGTGAATGTCTGGCTGGTGTAGGTCTGGGC TGGACGTGGGCCTAGTGACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 85)

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have.

Here, the sequences SEQ ID NOs: 48 to 85 include the aforementioned SEQ ID NOs: 8 to 36 and 39 to 47, these in each case of two sequences 5'-GCCTGTTGTGAGCCTCCTAAC-3 '(SEQ ID NO: 86) and 5'-

CATGCTTATTCTTGTCTCCC-3 '(SEQ ID NO: 87). These sequences SEQ ID NO: 86 and SEQ ID NO: 87 correspond to the primer binding sequences used in the selection of the aptamers of the present invention.

Surprisingly, it was found that in particular the aptamers according to the invention of the sequences SEQ ID NOs: 49, 58, 70 and 83 had a very good affinity for binding to activated protein C. In particular in filter binding experiments it could be determined that the determined dissociation constant K _{D was} in the range of> 0.1 nM to ≤ 0.4 nM.

In further embodiments of the present invention, the activated protein C binding aptamer comprises a sequence selected from the group comprising: 5'-GCCTGTTGTGAGCCTCCTAACAGGACACATATCCCGTATGGGGGTGAAGCTTT TCCGTCGTCACCGGTGTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 133)

5'-GCCTGTTGTGAGCCTCCTAACTTGCGCCATATCCCGGATGGGGGCCGAAATCGTATTGGAGGGCGGGTGCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 134)

5'-GCCTGTTGTGAGCCTCCTAACAGCGCCGTGAAGGCGTGTCGCATGGCGAGAAT CTTATCCCGCATGGGGCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 135)

5'-GCCTGTTGTGAGCCTCCTAACAGATGCGGAGGGGCTGCCGGGCGGTTACTTAT CCCGTATGGGGCACGGTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 136)

5'-GCCTGTTGTGAGCCTCCTAACACTGACGGAGTAGAGTATCCCGGATGGGCGTC TGTTTGGCCACCGTCCACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 137)

5'-GCCTGTTGTGAGCCTCCTAACATGGGCAGTGCGTTGGCGTGGGCCTAGCTCTTATCCCGGATGGGTGACCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 138)

5'-GCCTGTTGTGAGCCTCCTAACGACGTGTCCTATCCCGAATGGGGTTAGTTTAG GCGAGCTAAAGGTGTCG CATGCTTATTCTTGTCTCCC-3 '(SEQ ID NO: 139)

5'-GCCTGTTGTGAGCCTCCTAACGATCTGGTCGCTACTAGCCTATCCCGAATGGGGGCGGAAAGTACGTGTGCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 140)

5'-GCCTGTTGTGAGCCTCCTAACCATCCCGTGGCCGGTAACTTATCCCGTATGGGGGCCCTCAGGGATACTCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 141), 5'-GCCTGTTGTGAGCCTCCTAACCCACTGGTAGATCGGGGAATTCTTATCCCGTA TGGGCCCGATCGGCCCTACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 142),

5'-GCCTGTTGTGAGCCTCCTAACGATCTGGTCGCTACTAGCCTATCCCGAATGGG GACCGAGAGTACACGGTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 143)

5'-GCCTGTTGTGAGCCTCCTAACCGAGAATATCATCTATCCCGTATGGGGGAGTC CGCCTACATGTGAACTCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 144)

5'-GCCTGTTGTGAGCCTCCTAACTGGTCAGCTTTGGCTTATCCCGTATGGGGACCT TGGGTAGCTTTGCACACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 145)

5'-GCCTGTTGTGAGCCTCCTAACAGGACACATATCCCGTATGGGGGTGAAGCTTT TCCGTCGTCACCGGTGTCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 146),

5'-GCCTGTTGTGAGCCTCCTAACACACCAGCCTGGAAAGTAATTCCTGCTCTATCCCGTATGGGGGTGTGTCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 147),

5'-GCCTGTTGTGAGCCTCCTAACATATCCCGTATGGGGTCGATATGAATCTCATTGGTTGACGGTTAGGGATCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 148),

5'-GCCTGTTGTGAGCCTCCTAACGACCAAGGGTAACAATGTGTTATATATCCCGGATGGGCTTGGTCTTGAGCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 149),

5'-GCCTGTTGTGAGCCTCCTAACTGGCGTGAAGAGTTTCTGCTATCCCGTATGGGT TCACGCGTATGTTTTGCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 150) 5'-GCCTGTTGTGAGCCTCCTAACCTGGAAGCAAAACTTTCGATTCATCTATCCCGA ATGGGCGAATTTTGGT CATGCTTATTCTTGTCTCCC-3 '(SEQ ID NO: 151)

5'-GCCTGTTGTGAGCCTCCTAACGTTGGGAACCTTAGTTCCCTATCACGGATGGG CAACTTGGGAGGTGGTCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 152)

5'-GCCTGTTGTGAGCCTCCTAACGTTGGGAACCTTAGTTCCCTATCACGGATGGG CAACTTGGGAGGTGATCCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 153)

5'-GCCTGTTGTGAGCCTCCTAACTAAGTCACGGCAGCAGCCGCTCTATCCCAAAT GGGGCCGTGTACATTACCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 154)

5'-GCCTGTTGTGAGCCTCCTAACCTATCCCGTATAGGGGGGCGTATGCTTAACAC GCGCCGTAACGGAGGACCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 155)

5'-GCCTGTTGTGAGCCTCCTAACATCGCTTCAGGGCCACAGTACCGGTTGAATTCC TCGCGATGTCTGAACACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 156),

5'-GCCTGTTGTGAGCCTCCTAACATCGCTTCAGGGCCACAGTACCGGTTGAATTCC TCGCGATGTCTGGACACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 157), and / or

5'-GCCTGTTGTGAGCCTCCTAACACGTGAATGTCTGGCTGGTGTAGGTCTGGGCTG GACGTGGGCCTAGTGACATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 158)

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified Nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have.

Here, the sequences SEQ ID NOs: 133 to 158 include the aforementioned SEQ ID NOs: 103 to 123, 125, 126, 129, 130 and 132, each of which comprises two sequences 5'-GCCTGTTGTGAGCCTCCTAAC-3 '(SEQ ID NO: 86 ) and 5'-

CATGCTTATTCTTGTCTCCC-3 '(SEQ ID NO: 87). These sequences SEQ ID NO: 86 and SEQ ID NO: 87 correspond to the primer binding sequences used in the selection of the aptamers of the present invention.

Aptamers can fold under defined conditions in a specific three-dimensional structure, for example, so-called hairpin structures. Preferably, the activated protein C-binding aptamer has at least one first hairpin structure comprising a stem and a loop.

For the purposes of the present invention, the term "hairpin structure" or "hairpin" is to be understood as meaning a special form of secondary structure in the case of nucleic acid sequences, in particular aptamers, which consists of two mutually complementary sequence segments in the so-called stem and a further sequence segment in the US Pat so-called loop (loop) composed, to understand. Here, one or more bases in the trunk can form single-stranded areas called bulges.

It is preferred that the strain of the first hairpin structure in the range of> 4 base pairs to ≤ 15 base pairs, preferably in the range of> 9 base pairs to ≤ 13 base pairs, preferably in the range of> 11 base pairs to ≤ 12 base pairs. It is further preferred that the loop of the first hairpin structure in the range of> 5 nucleotides to ≤ 30 nucleotides, preferably in the range of> 6 nucleotides to ≤ 18 nucleotides. Advantageously, a number of paired nucleotides in the range of> 4 base pairs to ≤ 15 base pairs, in particular in the range of> 9 base pairs to ≤ 13 base pairs, preferably in the range of> 11 base pairs to ≤ 12 base pairs, in the trunk of the first hairpin structure contribute to the formation of a high-affinity binding of the aptamer to activated protein C.

Without being bound by any particular theory, it is believed that a number of paired nucleotides, particularly in the range of> 9 base pairs to ≤ 13 base pairs, may contribute to enabling stable formation of the stem of the first hairpin structure.

In preferred embodiments, the activated protein C-binding aptamer has a second hairpin structure comprising a stem and a loop. Preferably, the second hairpin structure is disposed in the loop of the first hairpin structure.

In further preferred embodiments, the activated protein C-binding aptamer comprises a second hairpin structure comprising a stem and a loop, wherein the second hairpin structure is disposed in the loop of the first hairpin structure.

In particularly preferred embodiments, the activated protein C-binding aptamer has the sequence motif SEQ ID NO: 1, wherein the sequence motif SEQ ID NO: 1 comprises the second hairpin structure. In further preferred embodiments, the stem of the first hairpin structure has a nucleotide sequence cytidine-thymidine (CT) that forms a single-stranded region, a bulge. It has been found that in particular a nucleotide sequence cytidine-thymidine (CT) in the stem of the first hairpin structure, which forms a single-stranded region, a so-called bulge, can contribute to an improvement in the binding of the aptamer to activated protein C.

In preferred embodiments, the activated protein C-binding aptamer of the invention has a sequence selected from the group comprising SEQ ID NOs: 58, 88 to 92. In particularly preferred embodiments, activated protein C-binding aptamers of the invention have a sequence selected from the group comprising SEQ ID NOs: 58, 88 to 92, which have a secondary structure comprising a first hairpin structure comprising a stem and a loop and a second hairpin structure comprising a trunk and a loop is formed, wherein the second hairpin structure is arranged in the loop of the first hairpin structure.

In particularly preferred embodiments, inventive activated protein C-binding aptamer comprising sequences selected from the group comprising SEQ ID NOs: 58, 88 to 92 have a secondary structure comprising a first hairpin structure comprising a stem and a loop and a second hairpin. A structure comprising a stem and a loop, wherein the second hairpin structure is disposed in the loop of the first hairpin structure, and wherein the sequence motif SEQ ID NO: 1 comprises the second hairpin structure.

In further particularly preferred embodiments, inventive activated protein C binding aptamers of the sequences selected from the group comprising SEQ ID NOs: 58, 88 to 92 have a strain of the first hairpin structure with in the range of> 9 base pairs to ≤ 13 base pairs, preferably in the range of> 11 base pairs to ≤ 12 base pairs and / or a nucleotide sequence cytidine-thymidine (CT) in the stem of the first hairpin structure, a single-stranded region, a so-called bulge formed. In very particularly preferred embodiments, inventive activated protein C-binding aptamers comprising sequences selected from the group comprising SEQ ID NOs: 58, 88 to 92 have a loop of the first hairpin structure with a number of nucleotides in the range of> 6 nucleotides to ≤ 18 Nucleotides on.

In particularly preferred embodiments, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-GCCTGTTGTGAGCCTCCTAACTGAGCTGTACTCGACTTATCCCGGATG

GGGCTCTTATGAGGCGCGACCATGCTTATTCTTGTCTCCC-S '

(SEQ ID NO: 58),

5'-GCCTCCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTATG AGGCGCGACCATGC-3 '(SEQ ID NO: 88)

5'-GCCTCCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTATG AGGC-3 '(SEQ ID NO: 89)

5'-GCCTCCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTAGG AGGC-3 '(SEQ ID NO: 90)

5'-CTCCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTAGGAG-S '(SEQ ID NO: 91), and / or

5'-CCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTAGG-S '(SEQ ID NO: 92), and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have.

In other embodiments, the activated protein C-binding aptamer comprises a sequence selected from the group comprising:

5'-CCTAAGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTAGG-S '(SEQ ID NO: 93), and / or

5'-TAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTA-S '(SEQ ID NO: 94).

Surprisingly, it was found that in particular the aptamers according to the invention of the sequences SEQ ID NOs: 58, 88 to 92 had a very good affinity for binding to activated protein C, the dissociation constant K _D determined by filter binding experiments in the range of> 0.1 nM to ≤ 1.3 nM.

Locked nucleic acids (LNA, Locked Nucleic Acid) correspond to a conformationally fixed analogue of DNA. The oligonucleotides of the Locked nucleic acids contain one or more bicyclic ribonucleosides in which the 2'OH group is connected to the C4 carbon atom via a methylene group. Advantageously, locked nucleic acids show higher stability towards nucleases as compared to unmodified DNA and better hybridization properties, whereby an improvement in the affinity and / or specificity of the binding of the aptamer can be achieved. A further preferred chemical modification is, for example, the addition of a so-called "3'-CAP" or "5'-CAP" structure, of a modified guanosine nucleotide (7-methyl-guanosine) to the 3'-end or 5 ' -The End. Modification of the 3'-end or 5'-end may advantageously protect the aptamer from rapid degradation by nucleases, particularly in an organism or biological sample.

In other embodiments, in particular, the 5'-end of the aptamer may be pegylated. For example, a 5'-PEG modification may comprise at least one polyethylene glycol unit, preferably in the range of 1 to 900 polyethylene glycol units, preferably in the range of 1 to 450 polyethylene glycol units. Preference is given to using linear polyethylene glycol (PEG) units HO- (CH ₂ CH ₂ O) _n -H, where n is an integer in the range from 1 to 900, preferably in the range from 1 to 450.

An advantage of a chemical modification, a change in the Phosphorzuckerrückgrates or a use of enzymatically unrecognizable altered nucleotide units is that the nucleic acids used are stabilized against enzymatic degradation, especially in an organism or a biological sample.

In another embodiment of the present invention, the aptamers according to the invention may be present as phosphorothioate DNA or peptide nucleic acid (PNA). These modifications allow the aptamers to be stabilized against nucleic acid-cleaving enzymes. Stabilization does not affect the affinity of the modified DNA aptamers, but may retard, diminish or even prevent the degradation of the aptamers in an organism or biological sample by degrading enzymes such as nucleases or DNases. Preferably, the nucleotides of the sequence motifs (SEQ ID NO: 1), (SEQ ID NO: 2) and / or (SEQ ID NO: 3) have no modifications. Preferably, nucleotides are modified in strain and / or loop of the aptamers.

A further subject relates to a method for the determination of activated protein C in biological samples, wherein at least one inventive activated protein C binding aptamer is incubated with the biological sample, preferably a biological fluid, and a binding event between the aptamer and activated protein C is detected ,

In preferred embodiments, the method is a method for the quantitative determination of activated protein C in biological samples. In particularly preferred embodiments, the method for determining activated protein C in biological samples is a diagnostic test procedure. The aptamers of the invention which bind to activated protein C are advantageously usable in particular in clinical analysis.

A particular advantage of the activated protein C binding aptamers invention is provided by the fact that these activated protein C can bind with high affinity and high selectivity. In particular, the aptamers according to the invention can specifically bind to activated protein C in relation to the inactive zymogen protein C. This makes it possible to use the activated protein C-binding aptamers according to the invention for the determination of activated protein C in biological samples, in particular in blood and other body fluids. In particular, the aptamers of the invention which bind to activated protein C can be used in a routine-suitable test procedure. A "biological sample" within the meaning of the invention is a biological material provided or obtained by sampling. Biological samples are, in particular, biological materials isolated from human individuals, in particular patients, for example biological tissues and fluids. Preferred biological samples are biological fluids, in particular body fluids, preferably blood or blood products, preferably selected from the group comprising blood plasma, serum and / or whole blood. The samples may be pretreated, for example by mixing, addition of enzymes or markers, or purified.

The sample is incubated with at least one aptamer binding to activated protein C according to the invention. An incubation within the meaning of the invention means contacting the sample, in particular the compounds, substances and proteins contained therein, with an aptamer.

For example, at least one inventive aptamer binding to activated protein C may be added to the biological sample, preferably a biological fluid. Furthermore, the sample may be incubated with previously immobilized aptamer, for example by adding the sample to an aptamer-coated well of an ELISA plate.

If an aptamer arrives at its target protein activated protein C, it binds to it. The binding event between aptamer and activated protein C is detected according to the invention. The binding event can be detected electrochemically, optically, microgravimetrically, calorimetrically or piezoelectrically.

The binding event can also be detected without labeling, the aptamer being fixed on a surface, for example, and the change in the layer thickness after Attachment of activated protein C is determined, for example optically via a change in the evanescent field.

Preferably, binding formation between aptamer and activated protein C is detected in an indicator reaction following direct or indirect coupling of a binding partner with a well-detectable label. For this purpose, the aptamer binding to activated protein C is preferably provided with a label.

The label can be detected by luminescence, color reactions, enzymatic, electrochemical or radioactive. Preferably, labels are detectable by fluorescence, chemiluminescence or bioluminescence. Preference is given to detection by means of fluorescence. Preferred fluorescent dyes are bisbenzimidazoles which can be covalently coupled to aptamers. Preferred fluorescent dyes are selected from the group comprising fluorescein, fluorescein-5-isothiocyanate (FITC), carbocyanine dyes, in particular indocarbocyanine dyes and indodicarbocyanine dyes, for example available under the trade name Cy3 and Cy5 from Amersham Biosciences Europe GmbH. Suitable are also N-hydroxy-succinimide esters of the fluorescent dyes, such as available under the designation Alexa Fluor ^® dyes at the company Invitrogen. Suitable dyes for staining of DNA, for example, which belongs to the Phenantrinen ethidium bromide, or belonging to the cyanine dyes SYBR (SYBR Green ^®.) Made by Molecular Probes. Also suitable for labeling double-stranded DNA or RNA are intercalating dyes, such as phenantrins, for example, propidium iodide.

Detection of aptamer-linked activated protein C can also be detected via the amidolytic activity of the activated protein C. For this chromogenic or fluorogenic peptide substrates can be used, which are cleaved by activated protein C. Furthermore, detection of aptamer-linked activated protein C may be by antibodies or labeled antibodies capable of binding to activated protein C. In particularly preferred embodiments, the detection of activated protein C can be carried out by the addition of the sample to immobilized aptamers and subsequent detection of the bound activated protein C by its amidolytic activity or by means of corresponding antibodies.

The evaluation can be carried out by means of appropriate measuring devices, for example in the fluorescence microscope, or by flow cytometry, for example in the cytofluorimeter. A preferred chemical label for chemiluminescence is luminol. Preferred bioluminescence involves the emission of visible light as a result of an enzyme-catalyzed redox reaction. Furthermore, the detection can be performed with enzymes as labeling substances that convert substrates to colored products, preferably peroxidase, luciferase, beta-galactosidase or alkaline phosphatase. Furthermore, the detection can be made radioactively via labeling by means of radioactive isotopes. Evidence can also be provided by means of a so-called ELISA (enzyme-linked immunosorbent assays). The aforementioned methods preferably include intensive washing steps to separate unbound and / or unspecifically bound aptamers and / or detection reagents.

In other embodiments of the method according to the invention, the aptamer binding to activated protein C can be immobilized on a solid phase, preferably via a spacer molecule. This may be, for example, a linker nucleic acid. Immobilization may be by means of covalent coupling or non-covalent coupling by means of suitable affinity pairs, for example biotin / streptavidin. Solid phases can be selected from plates, strips, membranes, films, gels, and / or beads. Suitable carrier materials are inorganic and organic polymers, in particular biodegradable Polymers or biopolymers, preferably selected from the group comprising cellulose, dextran, agar, agarose and / or Sephadex, or so-called magnetic beads.

In preferred embodiments, coupled to a solid phase, such as an enzyme-linked immunosorbent assay (ELISA) plate, coupled activated protein C-binding aptamers are useful to immobilize activated protein C (APC) present in a biological sample, for example, in plasma. Subsequently, the bound activated protein C can be quantified, for example via the hydrolysis rate of an APC-specific peptide substrate.

The advantage here is that the binding to activated protein C aptamers do not or only slightly affect the amidolytic activity of activated protein C.

The activated protein C present in the plasma is inactivated by the protein C inhibitor present in the plasma. Aprotinin is preferably added to a biological sample, for example a plasma sample, preferably in the preanalytical phase, in particular without delay after the recovery of the sample. This may prevent inactivation of activated protein C.

In preferred embodiments, the method according to the invention for the determination of activated protein C in biological samples comprises the following steps:

1. placing a biological sample, in particular a blood sample, with an anticoagulant containing aprotinin,

2. optionally obtaining plasma from the biological sample,

3. Incubation of the biological sample, for example a plasma sample, with at least one aptamer (s) which bind to activated protein C, preferably with aptamer (s) linked to activated protein C coupled to an ELISA plate,

4. optionally removing unbound plasma constituents and / or aprotinin, 5. detecting the binding event between activated protein C-binding aptamer (s) and activated protein C, for example by addition of an APC-specific peptide substrate and determination of the hydrolysis rate, preferably by determination of a dye reaction,

6. Evaluation and / or quantification of the binding event, for example on the basis of an entrained standard, preferably for a dye reaction.

The invention furthermore relates to the use of the activated protein C-binding aptamers according to the invention for the purification of activated protein C. The aptamers which bind to activated protein C are suitable, for example, for affinity purification and / or affinity chromatography.

The invention furthermore relates to a kit comprising at least one aptamer which binds to activated protein C according to the invention. In a preferred embodiment of the kit, it may contain signaling substances or devices, preferably fluorescent dyes, chemiluminescent cofactors, enzyme substrates or labeled antibodies.

Use of the activated protein C-binding aptamers according to the invention advantageously makes it possible in particular to use diagnostic methods for determining the concentration of activated protein C in hemostasis diagnostics and in extended sepsis diagnostics. Furthermore, use of the activated protein C-binding aptamers according to the invention in diagnosis makes it possible to determine a disturbed concentration of activated protein C and thus to diagnose diseases which are associated with a disruption of the protein C / activated protein C system.

Another object of the invention relates to the use of the inventive binding to activated protein C aptamers for the diagnosis, therapeutic and / or Prophylactic treatment of disorders associated with impaired blood clotting, bleeding disorders, preferably hemorrhagic diatheses, preferably selected from the group comprising hemophilia, in particular hemophilia A, and / or von Willebrand syndrome, and / or bleeding complications caused by an increased concentration be activated on activated protein C.

The invention further relates to the use of an inventive activated protein C binding aptamer, its pharmacologically acceptable salts, derivatives and / or conjugates, for the manufacture of a medicament.

The activated protein C binding aptamers according to the invention are suitable to bind with high affinity to activated protein C and to modulate its activity, in particular to inhibit. In particular, the activated protein C-binding aptamers of the invention of SEQ ID NOs: 58, 88 to 92, are capable of blocking the activated protein C anticoagulant enzyme activity.

In addition, it has been found that, in particular, the activated protein C-binding aptamers according to the invention of the sequences SEQ ID NOs: 58, 88 to 92 are suitable for inducing an allosteric conformational change in the molecule of the activated protein C. Without being bound to a particular theory, it is believed that this allosteric conformational change may enhance the inactivation of activated protein C by the physiological inhibitor protein C inhibitor. Furthermore, without being bound by any particular theory, it is assumed that the allosteric conformational change of activated protein C induced by the aptamers according to the invention leads to the formation of complexes of the activated protein C with protein C inhibitor. Administration of the activated protein C-binding aptamers according to the invention, their pharmacologically acceptable salts, derivatives and / or conjugates advantageously makes it possible to therapeutically influence the activity of activated protein C.

More particularly, the invention relates to the use of an activated protein C-binding aptamer of the invention, its pharmacologically acceptable salts, derivatives and / or conjugates, for the manufacture of a medicament for the diagnosis, therapeutic and / or prophylactic treatment of disorders associated with impaired blood clotting Bleeding disorders, preferably hemorrhagic diatheses, preferably selected from the group comprising hemophilia, in particular hemophilia A, and / or von Willebrand's syndrome, and / or bleeding complications, which are triggered by an increased concentration of activated protein C.

Bleeding complications that are triggered by an increased concentration of activated protein C are, in particular, bleeding that occurs as a result of overactivation with activated protein C, or bleeding that occurs as a result of increased production of activated protein C as a result of secondary thrombinemia.

Recombinant-produced activated protein C is used, for example, in the treatment of severe sepsis. In particular, aptamers according to the invention which bind to activated protein C are suitable for acting as an antidote for recombinant activated protein C in the case of absolute or relative overdosage and thereby triggered bleeding. Furthermore, aptamers according to the invention which bind to activated protein C are particularly suitable as surrogate therapeutics in the substitution with factor VIII concentrate in patients with hemophilia A. In particular, the aptamers which bind to activated protein C according to the invention may have the half-life and / or effectiveness of the factor VIII. Concentrate can be improved. Furthermore, aptamers according to the invention which bind to activated protein C are particularly suitable for the treatment of acquired hemorrhagic diatheses, which can arise as a result of excessive formation of activated protein C as a consequence of generalized thrombin formation. Such a constellation can be present for example in patients after cardiac surgery.

In particular, activated protein C-binding aptamers of the present invention are useful for the diagnostic and / or therapeutic treatment of patients treated with activated protein C concentrates, or who are prone to bleeding by the predominance of the anticoagulant activated protein C. Further, activated protein C-binding aptamers of the present invention are useful for treating patients with a congenital deficiency of blood coagulation factor VIII, and by administering the activated protein C-binding aptamers of the invention, the half-life and effectiveness of administered factor VIII concentrate can be improved.

The invention further relates to medicaments comprising aptamers according to the invention which bind to activated protein C. The medicament comprises inventive aptamers which bind to activated protein C, preferably as a pharmacologically acceptable salt, preferably as salts of inorganic acids, for example phosphoric acid, or as salts of organic acids, for example hydrochloric acid or sulfuric acid. Pharmaceuticals may further comprise pharmaceutically acceptable excipients and / or carriers.

Advantageously, the medicament is for the prophylactic or therapeutic treatment of disorders associated with impaired blood coagulation, bleeding disorders, preferably hemorrhagic diatheses, preferably selected from the group comprising hemophilia, in particular hemophilia A, and / or von Willebrand syndrome, and / or bleeding complications, which are triggered by an increased concentration of activated protein C.

The drug is orally, transmucosally, rectally, pulmonarily, enterally and / or parenterally administrable. Preference is given to administration by injection.

Another object of the invention relates to a thrombin-binding fusion aptamer comprising at least two thrombin-binding aptamers and at least one linker, wherein the at least one linker connects the at least two thrombin-binding aptamers.

For the purposes of this invention, the term "fusion aptamer" means aptamer constructs which have at least two identical or different aptamer sequences and at least one linker or spacer region connecting the aptamer sequences.

Surprisingly, it has been found that the thrombin-binding fusion aptamers according to the invention can show an unexpectedly strong inhibition of thrombin. In particular, it has been found that the thrombin-binding fusion aptamers of the invention have an unexpectedly high inhibitory effect on thrombin-mediated blood coagulation.

For example, it was possible to determine, for the thrombin-inhibiting action of the thrombin-binding fusion aptamers according to the invention, that blood clotting could be inhibited even with a 30-fold lower concentration compared to individual aptamers when using thrombin-binding fusion aptamers according to the invention. Thrombin is activated in the blood from an inactive precursor protein, prothrombin. This reaction is catalyzed by the prothrombinase complex.

Surprisingly, it was found that the thrombin-binding fusion aptamers according to the invention can inhibit prothrombinase. This can provide a significant advantage because the formation of thrombin can already be inhibited by the thrombin-binding fusion aptamers according to the invention. A significant advantage lies in particular in an improved anticoagulant effect, since a multifunctional inhibition of coagulation activation can take place. This may be particularly beneficial in the anticoagulant therapy required for use of extracorporeal circulation systems.

Another important advantage of the thrombin-binding fusion aptamers can be provided by the fact that the action of the aptamers can be canceled by the administration of aptamers with complementary sequence in the form of an antidote or antidote. This has the advantage that the effect of the thrombin-binding fusion aptamers according to the invention is also time-controllable. This is of great advantage, in particular when influencing the coagulation system.

Thrombin-binding fusion aptamers according to the invention may have a DNA or an RNA sequence. Preferably, thrombin-binding fusion aptamers have a DNA sequence. DNA-based aptamers advantageously have increased stability.

Also suitable are aptamers which have a sequence comprising 2'-modified nucleotides, for example 2'-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides. Also suitable are aptamers which have 2'-modified ribonucleotides, for example 2'-fluoro, 2'-methoxy and / or 2'-amino-modified ribonucleotides. Furthermore, aptamers may have deoxyribonucleotides and 2'-modified ribonucleotides, for example 2'-fluoro, 2'-methoxy and / or 2'-amino-modified ribonucleotides.

In preferred embodiments of the thrombin-binding fusion aptamer, the

Fusion aptamer: two to four thrombin-binding aptamers; and one to three linkers, each linker linking two to thrombin

Connect aptamers.

Preferably, the thrombin-binding aptamers have a sequence selected from the group comprising:

5'-GGTTGGTGTGGTTGG-3 '(SEQ ID NO: 95), 5'-N ₃ N ₄ N ₅ N ₆ CCGTGGTAGGGCAGGTTGGGGTGN ₇ N ₈ -S' (SEQ ID NO: 96)

wherein

N ₃ , N ₄ , N ₅ , N ₆ , N ₇ , N ₈ are the same or independently selected from the group comprising guanine, cytosine, adenine and / or thymine, or a deletion,

and or

5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-S '(SEQ ID NO: 97)

and / or their variants, mutants and / or parts. In this case, the thrombin-binding aptamers may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer may modified nucleotides, preferably selected from the group comprising Locked nucleic acids, 2'-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides have.

Preferably, thrombin-binding aptamers bind to exosites 1 and 2 of thrombin.

Other useful aptamers which bind to thrombin are disclosed, for example, in document WO 03/002592, to which reference is made in its entirety.

In preferred embodiments of the thrombin-binding fusion aptamer, the linker is selected from the group comprising nucleotidic linkers, polyethylene glycol (s), peptidic linkers and / or straight or branched, saturated or unsaturated C ₁ -C ₅₀ -alkyl.

Preferably, the nucleotide linker has a length in the range of> 1 nucleotide to ≤ 30 nucleotides, preferably in the range of> 2 nucleotides to ≤ 15 nucleotides, more preferably in the range of> 5 nucleotides to ≤ 15 nucleotides, particularly preferably in the range of> 10 Nucleotides to ≤ 15 nucleotides, wherein the nucleotides are selected from the group comprising guanosine, cytidine, adenosine and / or thymidine. A preferred nucleotide is adenosine. Particularly preferred linkers are so-called poly A-linkers.

It has surprisingly been found that the thrombin-binding fusion aptamers according to the invention can have a particularly good affinity for thrombin, whose linkers predominantly contain the nucleotide adenosine or are formed from the nucleotide adenosine. Preferably, a polyethylene glycol linker has 1 to 15 polyethylene glycol units, preferably in the range of 1 to 10 polyethylene glycol units, preferably in the range of 2 to 8 polyethylene glycol units.

Preference is given to using linear polyethylene glycol (PEG) units HO- (CH ₂ CH ₂ O) _n -H, where n is an integer in the range from 1 to 15, preferably in the range from 1 to 10, preferably in the range from 2 to 8 , is.

In preferred embodiments of the thrombin-binding fusion aptamer, linker is a peptidic linker, wherein the peptidic linker preferably comprises amino acids selected from the group comprising glycine, alanine and / or β-alanine. Preferably, the peptidic linker comprises in the range of 2 to 4 amino acids. Preferably, the peptidic linker comprises β-alanine units. Preferably, the peptidic linker comprises in the range of 2 to 4 β-alanine units.

In further preferred embodiments of the thrombin-binding fusion aptamer, the linker is an unbranched or branched, saturated or unsaturated C 1 -C ₄ -alkyl group, preferably a C ₁ -C ₃₀ -alkyl group, more preferably a C ₂ -C ₂ 0 -alkyl group , Preferably, the linker is an alkl group - (CH ₂ ) _n - wherein n is an integer in the range of 1 to 40, preferably in the range of 1 to 30, also preferably in the range of 2 to 20, more preferably n is in the range of 2 to 18, very particularly preferably n = 2, 6, 12 or 18.

In particularly preferred embodiments of the thrombin-binding fusion aptamer, the thrombin-binding fusion aptamer comprises a sequence selected from the group comprising: 5'-GGTTGGTGTGGTTGGAAAAAAAAAAAAAAAAGTCCGTGGTAGGGCAGG

TTGGGGTGACT-3 '(SEQ ID NO: 98),

5'-GGTTGGTGTGGTTGGAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT-S '

(SEQ ID NO: 99), and / or

5'-GGTTGGTGTGGTTGGAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT-S '

(SEQ ID NO: 100), and / or variants thereof, mutants and / or parts, wherein the thrombin-binding aptamers may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications , and / or the aptamers may have modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides.

A further preferred chemical modification is, for example, the addition of a so-called "3'-CAP" or "5'-CAP" structure, of a modified guanosine nucleotide (7-methyl-guanosine) to the 3'-end or 5 ' -The End. Modification of the 3'-end or 5'-end may advantageously protect the fusion aptamer from rapid degradation by nucleases, particularly in an organism or biological sample.

In other embodiments, in particular, the 5 'end of the fusion aptamer may be pegylated. For example, a 5'-PEG modification may comprise at least one polyethylene glycol unit, preferably in the range of 1 to 900 polyethylene glycol units, preferably in the range of 1 to 450 polyethylene glycol units. Preference is given to using linear polyethylene glycol (PEG) units HO- (CH ₂ CH ₂ O) _n -H, where n is an integer in the range from 1 to 900, preferably in the range from 1 to 450.

Administration of the thrombin-binding fusion aptamers according to the invention, their pharmacologically acceptable salts, derivatives and / or conjugates advantageously makes it possible to therapeutically influence the activity of thrombin. Another object of the invention relates to the use of the thrombin-binding fusion aptamers according to the invention for the diagnosis, therapeutic and / or prophylactic treatment of diseases that are associated with a disturbed blood coagulation or whose therapy requires an influence on the blood coagulation system.

In particular, the thrombin-binding fusion aptamers of the invention are useful as anticoagulants or anticoagulants.

Surprisingly, it has been found that the thrombin-binding fusion aptamers according to the invention are very effective anticoagulants. In particular, it has been found that the thrombin-binding fusion aptamer SEQ ID NO: 98 according to the invention has a significantly higher effect on thrombin-mediated blood coagulation than a combination of the single aptamers SEQ ID NO: 95 and SEQ ID NO: 97.

The invention furthermore relates to the use of a thrombin-binding fusion aptamer according to the invention, its pharmacologically acceptable salts, derivatives and / or conjugates, for the production of a medicament.

In particular, the invention relates to the use of thrombin-binding fusion aptamers of the invention, their pharmacologically acceptable salts, derivatives and / or conjugates, for the manufacture of a medicament for the diagnosis, therapeutic and / or prophylactic treatment of disorders associated with impaired blood coagulation or whose therapy requires an influence on the blood coagulation system, in particular as a blood coagulation inhibitor. Diseases associated with impaired blood coagulation or whose therapy requires interference with the blood coagulation system are, in particular, selected from the group comprising arterial or venous thromboses, in particular acute myocardial and cerebral infarcts or pulmonary embolisms, and / or thromboembolic complications.

Thrombin-binding fusion aptamers according to the invention are particularly suitable for the therapy of arterial thromboses, in particular acute myocardial and cerebral infarction and secondary prophylaxis of thromboembolic complications after vascular reconstruction procedures. Thrombin-binding fusion aptamers according to the invention are furthermore suitable for systemic anticoagulation for use in extracorporeal therapeutic methods, in particular heart-lung machines, hemodialysis and hemofiltration methods. Thrombin-binding fusion aptamers of the invention are also suitable for use in the acute therapy of venous thrombosis, especially acute pulmonary embolism.

A further subject of the invention are medicaments comprising at least one thrombin-binding fusion aptamer according to the invention. The medicament comprises thrombin-binding fusion aptamers according to the invention preferably as a pharmacologically acceptable salt, preferably as salts of inorganic acids, for example phosphoric acid, or as salts of organic acids, for example hydrochloric acid or sulfuric acid. The medicament may further comprise pharmaceutically acceptable excipients and / or carriers.

Advantageously, the medicament is suitable for the prophylactic or therapeutic treatment of diseases associated with impaired blood coagulation or whose therapy requires an influence on the blood coagulation system, in particular as a blood coagulation inhibitor. The drug is orally, transmucosally, rectally, pulmonarily, enterally and / or parenterally administrable. Preference is given to administration by injection.

Unless otherwise stated, the technical and scientific terms used are as commonly understood by one of ordinary skill in the art to which this invention belongs.

All publications, patent applications, patents, and other references cited herein are incorporated by reference in their entirety.

Examples and figures which serve to illustrate the present invention are given below.

In the figures shows:

FIG. 1 Sequences of DNA aptamers which bind to activated protein C. The sequence of FIG. 1a corresponds to the sequence SEQ ID NO: 58, the sequence of FIG. 1b corresponds to the sequence SEQ ID NO: 88. The sequences each have a consensus sequence SEQ ID NO. 1 on.

Figure 2 Sequences of DNA aptamers that bind to activated protein C. The sequence of FIG. 2a corresponds to the sequence SEQ ID NO: 89, the sequence of FIG. 2b corresponds to the sequence SEQ ID NO: 90, the sequence of FIG. 2c corresponds to the sequence SEQ ID NO: 91, and the sequence of FIG 2d corresponds to the sequence SEQ ID NO: 92. The sequences each have a consensus sequence SEQ ID NO. 1 on. The computation of the secondary structures was based on the folding program available on the Internet, mfold, M. Zuker, Mfold web server for nucleic acid folding and hybridization prediction, Nucleic Acid Res. 31 (13), 3406-15 (2003).

example 1

In vitro selection (SELEX® / Counter-SELEX®)

For the selection of DNA aptamers against activated protein C (APC), the drug used in severe sepsis was Drotrecogin Alpha (Xigris®, Eli Lilly, USA) as an APC source. For the immobilization of the target proteins necessary for the selection, 100 μg of the APC were biotinylated and coupled to streptavidin-coated magnetic beads (Dynabeads® M-280 streptavidin (Dynal, Invitrogen)). For biotinylation, a 3-fold molar excess of NHS-biotin was used with respect to the APC molecules used (Pierce, Rockford, USA). The incubation was carried out in PBS buffer (8.0 g / l NaCl, 0.2 g / l KCl, 1.44 g / l Na ₂ HPO ₄ , 0.24 g / l KH ₂ PO ₄ , pH 7.4 ) in a total volume of 100 μl for 30 minutes on ice and then for 10 minutes at room temperature (RT). Unbound NHS-biotin (Perbio Science) was subsequently removed by column chromatography (Micro Bio-Spin 6 Chromatography columns, Biorad, Munich, Germany). The biotinylated APC thus obtained was incubated with 5 mg of the magnetic beads in a total volume of 600 μl of PBS containing 0.1% bovine serum albumin (BSA, bovine serum albumin) for 30 minutes at RT under constant agitation. Subsequently, the beads were Ix washed with 500 .mu.l of PBS containing 0.1% bovine serum albumin (BSA, bovine serum albumin) and finally taken up in 1 ml of PBS containing 0.1% BSA.

As a DNA aptamer start library, the so-called Dl pool with a 49-base long, flanked by two primer binding sites, variable sequence region was used (5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3 'SEQ ID NO: 101). This was synthesized by the company Metabion (Martinsried, Germany) and obtained by HPLC purification.

Initially, 500 pmol of the Dl pool was incubated with 80 μl (8 μg) of immobilized APC in a total volume of final 160 μl in selection buffer (Ix PBS, pH 7.4, 0.1% BSA, 1 mM MgCl ₂ , ImM CaCl ₂ ). incubated. After incubation, the beads were washed Ix with 150 .mu.l selection buffer and elicited bound DNA at 8O ⁰ C in 55 .mu.l of double-distilled water. The pool selected in this way was subsequently separated by means of polymerase chain reaction (PCR) into 5 separate 100 μl reactions (90 μl master mix and 10 μl sample each) using the primers (HPLC-pure, Metabion) 5'-GCCTGTTGTGAGCCTCCTAAC-S '(forward, SEQ ID NO: 86) and 5'-GGGAGACAAGAATAAGCATG-S '(reverse, SEQ ID NO: 102), amplified with 5'-biotin modification), followed by single-strand separation. For this purpose, the PCR products were bound to the already described magnetic beads via the biotin molecules coupled to the 5 'end of the reverse primer. In this case, the beads (500 .mu.l (5 mg) per single-strand separation) were first washed 3 times with 1000 .mu.l BW buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1.0 M NaCl) and then taken up in 500 μl 2 x BW buffer (10 mM Tris-HCl, pH 7.5, 1.0 mM EDTA, 2.0 M NaCl). After addition of the PCR products (5 × 100 μl), these mixtures were incubated for 45 minutes at RT under constant agitation. After incubation, the beads were each washed twice with BW buffer and once with 2x BW buffer (1000 μl each) to remove unbound components of the PCR reaction mixes. Subsequently, the beads were taken up in 50 μl of 0.1 M NaOH and incubated for 3 minutes at RT. After immobilization of the beads, the aptamers in the NaOH solution were transferred to a new reaction vessel and the process was repeated with a further 50 μl of NaOH. To neutralize the pH, a previously optimized amount of a 0.1 molar HCl solution was pipetted to the aptamer solution. After carrying out the single-strand separation described above, 50 pmol of the aptamers thus obtained were used in the next selection cycle. To increase the specificity, a counter-selex was carried out against the streptavidin beads used from the third round and the number of washing steps after binding of the aptamers to the immobilized APC was increased stepwise. Because of the selection-related enrichment of APC-binding aptamer sequences, the number of PCR cycles performed for amplification was readjusted after each selection cycle. In total, 12 selection cycles were performed. An overview of the parameters varied during the selection can be found in Table 1.

Example 2

Cloning and sequencing To analyze the sequences of the selected aptamers, the aptamer pool (single-stranded DNA) obtained after 10 rounds of selection was re-amplified (5 cycles with primers 5'-GCCTGTTGTGAGCCTCCTAAC-3 '(forward, SEQ ID NO: 86) and 5'-GGGAGACAAGAATAAGCATG -3 '(Reverse, SEQ ID NO: 102), in 100 μl total reaction volume using 0.75 pmol single-stranded DNA and the PCR products thus produced by TA cloning in pCR II vectors (TA Cloning® Kit, Invitrogen ) were ligated. then, transformed chemically competent E. coli cells (XL-IO gold, Stratagene) with the vectors and plated on LB agar containing 100 ug / ml ampicillin. From the overnight incubation at 37 ⁰ C resulting colony forming Units (CFU) a selection in 5 ml suspension cultures (LB with 100 ug / ml ampicillin) with continuous movement overnight at 37 ⁰ C further propagated and the vectors after centrifugation of the cells at 5,000 rpm / min for 15 minutes using the QIAprep spin Mini Kit (Qiagen) aufg ereinigt. Sequencing of the vector inserts (Ap tamer sequences) was performed using M13 sequencing primers using an ABI 3130x1 Genetic Analyzer.

Example 3

Determination of the dissociation constant K _{D of} individual activating protein C binding

Aptamers (filter binding tests)

To test the APC binding properties, the aptamers to be tested were labeled with ³² p-ATP at the 5 'end using a polynucleotide kinase (PNK). For this purpose, 5 pmol of the aptamers were incubated with 10 .mu.Ci ³² p-ATP in the presence of 10 U PNK in a total volume of 10 .mu.l for 45 minutes at 37 ⁰ C. To remove unbound ³² p-ATP, the batches were then added to 40 ul bidistilled water and purified on G25 columns (Microspin G-25 Colums, Amersham). The radioactively-labeled aptamers were incubated in a final concentration of 0.4 nM in selection buffer with various concentrations of activated protein C (APC, Xigris®, Eli Lilly, USA), starting from 100 nM and subsequent, half-logarithmic dilution stages a total volume of 25 .mu.l for 30 minutes at 37 ⁰ C incubated. After the incubation, in each case 20 μl of the mixtures were filtered by means of a vacuum system over a nitrocellulose membrane (Schleicher and Schuell, 0.45 μM). Subsequently, several washing steps (4 × 200 μl) were carried out with washing buffer (IxPBS 8.0 g / l NaCl, 0.2 g / l KCl, 1.44 g / l Na ₂ HPO ₄ , 0.24 g / l KH ₂ PO ₄ , pH 7.4, 1mM MgCl ₂ , 1mM CaCl ₂ ) to remove excess non-protein bound radioactivity from the membrane. The recording of the respective radiation intensities took place by means of a phosphor screen. To evaluate the data, a FUJIFILM FLA-3000 with corresponding AIDA Imagequant software was used. By non-linear regression of the obtained data points, the bound radioactivity on APC concentration, the individual K _D S could be determined. For the calculation, the function "Logistic Dose Response in Pharmacology / Chemistry" of the software Origin 7.5 (OriginLab, Northampton, MA, USA) was used.

With regard to the binding of individual aptamers to the activated protein C used for the selection (APC, Xigris®, Eli Lilly), the following K _D s could be determined with the procedure described above:

Test series 1: testing of individual aptamer from that obtained after 10 rounds of selection

Aptamer pool

Aptamer SEQ ID NO:

HS02 (SEQ ID NO: 58): 0.12 + 0.02 nM

HS03 (SEQ ID NO: 70): 0.19 + 0.03 nM

HS04 (SEQ ID NO: 49): 0.21 + 0.02 nM

HS08 (SEQ ID NO: 83): 0.30 + 0.09 nM Test Series 2: Testing of aptamer variants based on (SEQ ID NO: 58)

Aptamer SEQ ID NO:

HS02-88 (SEQ ID NO: 58): 0.43 + 0.08 nM

HS02-62 (SEQ ID NO: 88): 0.56 + 0.13 nM

HS02-52 (SEQ ID NO: 89): 0.35 + 0.09 nM

HS02-52G (SEQ ID NO: 90): 0.47 + 0.11 nM

HS02-48G (SEQ ID NO: 91): 0.40 + 0.13 nM

HS02-44G (SEQ ID NO: 92): 0.17 + 0.06 nM

It was shown that the activated protein C binding aptamers had very good dissociation constants for binding to activated protein C.

Example 4

Determination of specificity of individual activated protein C binding aptamers

The determination of the APC specificity of the variants SEQ ID NO: 58 and 88 to 92 was carried out by incubation of different concentrations of native activated protein C (APC) in the form of plasma-purified protein C (PC) (Ceprotin®, Baxter), which with human alpha-thrombin (CellSystems Biotechnologie Vertrieb GmbH, St. Katharinen, Germany), protein C (Ceprotin®, Baxter), alpha-thrombin (CellSystems Biotechnologie Vertrieb GmbH), factor VIIa (NovoSeven®, Novo Nordisk), factor Xa (CellSystems Biotechnologie Vertrieb GmbH) and factor IXa (CellSystems Biotechnologie Vertrieb GmbH) with radioactively labeled aptamers of the sequences SEQ ID NO: 58, 88 to 92 and subsequent filter binding experiment as described in Example 3. Here, the native activated protein C (APC) was in a semilogarithmic dilution series starting from 100 nM and the zymogen protein C (PC) also used in a semilogarithmic dilution series but starting from 1000 nM. Alpha-thrombin, Factor VIIa, Factor Xa and Factor IXa were each tested at concentrations of 320 nM, 32 nM and 3.2 nM.

Up to a concentration of 320 nM, no binding of the aptamers could be observed with respect to alpha-thrombin, factor VIIa, factor Xa and factor IXa. Although binding of all aptamers to protein C (PC) was observed, the K _D s were not quantifiable, but were> 320 nM in all cases. Studies with a fluorogenic peptide substrate suggest that at least part of the observed binding of the aptamers is due to contamination of the protein C (PC) protein used (Ceprotin®, Baxter) with activated protein C (APC).

In addition to binding to activated protein C (APC) (Xigris®, Eli Lilly), the high affinity binding HS02 variants SEQ ID NO: 58 and 88 to 92 also demonstrated effective binding to native activated protein C (APC) (activated Ceprotin®). The determined K _D S were at:

Aptamer SEQ ID NO:

HS02-88 (SEQ ID NO: 58): 0.47 + 0.06 nM

HS02-62 (SEQ ID NO: 88): 1.06 + 0.23 nM

HS02-52 (SEQ ID NO: 89): 0.97 + 0.18 nM

HS02-52G (SEQ ID NO: 90): 0.74 + 0.26 nM

HS02-48G (SEQ ID NO: 91): 0.85 + 0.06 nM

HS02-44G: (SEQ ID NO: 92): 0.76 + 0.10 nM

It was found that the activated protein C binding aptamers had very good dissociation constants for binding to native activated protein C. Example 5

Attempts to Inhibit the Activated Protein C (APC) -mediated Factor Va

inactivation

To check the inhibition of anticoagulant APC activity by the various HS 02 variants SEQ ID NO: 58 and 88 to 92, these were each used in ascending concentrations in a purified system for determining the APC-mediated inhibition of factor Va cofactor activity.

Here, 625 pM factor Va (CellSystems Biotechnologie Vertrieb GmbH) with 18.3 pM APC (Xigris®, Eli Lilly) in assay buffer (20 mM Tris-HCl, pH 7.4, 0.1% BSA, 137 mM NaCl , 5 mM CaCl 2, 10 μg / ml phospholipids) in the presence of different aptamer concentrations (semilogarithmic dilution series starting from 180 nM) in a total volume of 50 μl for 20 minutes at RT. The determination of the remaining factor Va cofactor activity was carried out with the aid of a plate fluorometer (Ascent Fluoroscan, Thermo Fisher Scientific). In each case, 75 μl of a solution containing 42 pM of human factor Xa (CellSystems Biotechnologie Vertrieb GmbH) and 667 μM of a fluorogenic peptide substart (Z-Gly-Gly-Arg-AMC, Bachern, Weil am Rhein, Germany) were introduced into the wells of white C8 Fluoronunc modules (Nunc, Thermo Fisher Scientific) and added 25 ul of the test described above. Immediately before the beginning of the kinetic measurement of the substrate conversion (one measurement per minute for 20 minutes), 50 μl of a 25 nM prothrombin solution were added in assay buffer (CellSystems Biotechnologie Vertrieb GmbH).

By non-linear regression of the data points obtained (residual cofactor activity via aptamer concentration), the following IC 50 values were obtained: Aptamer SEQ ID NO:

HS02-88 (SEQ ID NO: 58): 0.58 + 0.04 nM

HS02-62 (SEQ ID NO: 88): 1.20 + 0.09 nM

HS02-52 (SEQ ID NO: 89): 0.70 + 0.17 nM

HS02-52G (SEQ ID NO: 90): 0.42 + 0.16 nM

HS02-48G (SEQ ID NO: 91): 0.36 + 0.17 nM

HS02-44G (SEQ ID NO: 92): 0.28 + 0.11 nM

In the experiments described above it was possible to show that the investigated aptamers are able to inhibit the activated protein C (APC) functional activity with respect to the inactivation of factor Va with low IC 50 values.

Example 6

Attempts to Inhibit APC-Mediated Factor Villa Inactivation

To further test the inhibition of anticoagulant APC activity by the various HS02 variants SEQ ID NOs: 58 and 88 to 92, these were also each used in ascending concentrations in a purified system to determine APC-mediated factorial cofactor activity inhibition. For this purpose, 1 U recombinant FVIII (Recombinate®, Baxter) by incubation with 0.025 NIH-units of human alpha-thrombin (CellSystems Biotechnologie Vertrieb GmbH) for 2 minutes in PBS buffer (8.0 g / l NaCl, 0.2 g / 1 KCl, 1.44 g / L Na ₂ HPO ₄ , 0.24 g / L KH ₂ PO ₄ , pH 7.4) containing 0.1% bovine serum albumin (BSA) in a total volume of 100 μl. To stop the activation reaction, 5 μl of a 1.4 nM hirudin solution (Refludan®, Bayer Healthcare) was added to the mixture. Subsequently, the so activated factor VIII (FVIIIa) was in a final concentration of 0.16 U / ml with 1.8 nM activated protein C (APC) (Xigris®, Eli Lilly) in assay buffer in the presence different Ap tamer- concentrations (semilogarithmic dilution series starting from 180 nM) in a total volume of 50 .mu.l incubated for 20 minutes at RT. The determination of the remaining FVIII cofactor activity was also carried out with the aid of a plate fluorometer (FLx-800, Bio-Tek). In each case, 75 μl of a solution of 3 nM human factor IXa (CellSystems Biotechnologie Vertrieb GmbH) and 333 μM of a fluorogenic peptide substart (Boc-Ile-Glu-Gly-Arg-AMC, Bachern) were introduced into the wells of black F16 fluoronunc modules (Nunc, Thermo Fisher Scientific) and 25 μl of the test mixture described above. Immediately before the start of the kinetic measurement of substrate conversion (one measurement per minute for 20 minutes), 50 μl of a 25 nM factor Xa solution were added to assay buffer (CellSystems Biotechnologie Vertrieb GmbH).

By non-linear regression of the data points obtained (residual cofactor activity via aptamer concentration), the following IC 50 values were obtained:

Aptamer SEQ ID NO:

HS02-88 (SEQ ID NO: 58): 1.27 + 0.41 nM

HS02-62 (SEQ ID NO: 88): 0.88 + 0.46 nM

HS02-52 (SEQ ID NO: 89): 2.46 + 0.08 nM

HS02-52G (SEQ ID NO: 90): 0.22 + 0.15 nM

HS02-48G (SEQ ID NO: 91): 1.06 + 0.43 nM

HS02-44G (SEQ ID NO: 92): 0.88 + 0.11 nM

In the experiments described above, it was shown that the investigated aptamers are able to inhibit the activated protein C (APC) functional activity with respect to the inactivation of factor VIIIa with low IC ₅₀ values.

Example 7 Attempts to Determine the Influence of Activated Protein C Binding Aptamers on the Inhibition of Activated Protein C (APC) by the Protein C Inhibitor (PCI)

To investigate the effect of the activated protein C binding aptamers on the kinetics of the inhibition of activated protein C (APC) by the protein C inhibitor (PCI), a test system in the microtiter plate format was used. The wells of white C8 Fluoronunc modules (Nunc, Thermo Fisher Scientific) were incubated with a polyclonal rabbit anti human PC antibody (Dako) in coating buffer (30 mM Na ₂ CO ₂ , 200 mM NaHCO ₃ , pH 9.0) at 4 ⁰ C coated overnight (100 μl / well). The wells were then washed 3 × with washing buffer (IxPBS 8.0 g / l NaCl, 0.2 g / l KCl, 1.44 g / l Na ₂ HPO ₄ , 0.24 g / l KH ₂ PO ₄ , pH 7 , 4, 0.05% Tween 20), according to the standard washing sequence used in this test procedure, carried out with an automatic microtiter plate washer (SLT, Tecan, Germany) and free binding sites with blocking buffer (IxPBS 8.0 g / l NaCl, 0.2 g / l KCl, 1.44 g / l Na ₂ HPO ₄ , 0.24 g / l KH ₂ PO ₄ , pH 7.4, 2% BSA, 0.05% Tween 20) for 2 hours RT blocked. After washing the wells, 100 μl / well of a 360 μM APC (Xigris®, Eli Lilly) solution in dilution buffer (IxPBS 8.0 g / l NaCl, 0.2 g / l KCl, 1.44 g / 1 Na ₂ HPO ₄ , 0.24 g / l KH ₂ PO ₄ , pH 7.4, 0.1% BSA, 0.05% Tween 20), which was incubated for 1 hour at RT and then removed by washing. Activated protein C (APC), which is now immobilized in the wells of the modules, was then followed by the addition of 100 μl / well of citrated pool plasma to which the aptamers to be tested had been added in advance in a final concentration of 100 nM. There was also a blank without aptamers carried. In order to stop the binding of the protein C inhibitor (PCI) contained in the pooled plasma to the activated protein C (APC) immobilized in the wells at defined times, the corresponding wells were incubated at different incubation times (5, 10, 20 and 30 minutes). washed by default and filled with 100 .mu.l / well dilution buffer. After completion of the series of experiments, all wells were washed again. For determination the amidolytic APC activity remaining in the wells was then added to a fluorogenic peptide substrate for APC (Pefa 3342, Pentapharm) at a concentration of 200 μM in dilution buffer (100 μl / well) and the kinetics of substrate hydrolysis using a plate fluorometer (Ascent Fluoroscan, Thermo Fisher Scientific). The apparent inhibition constants (k _app ) as a measure of the rate of inhibition of the immobilized activated protein C (APC) were calculated from the resulting data sets by exponential interpolation. To demonstrate the PCI specificity of the effect found, the wells were washed again after inhibition kinetics were recorded and then 100 μl / well of a POD-labeled polyclonal anti-PCI antibody (Affinity Biologicals) in a 1: 2000 dilution in dilution buffer was added. After an incubation period of 1 hour, the well was washed again and 100 μl / well of a chemiluminescent substrate (Roche) added. The intensity of chemiluminescence released was determined after an incubation period of 3 minutes with an automated fluorescence / luminescence device (Ascent Fluoroscan, Thermo Fisher Scientific).

The apparent inhibition constants (k _app ) of immobilized activated protein C (APC), determined by the immunoassay shown above, in the presence of the various aptamers of the sequences SEQ ID NO: 58 and 88 to 92 (100 nM) in the plasma matrix are shown below:

Aptamer SEQ ID NO:

HS02-88 (SEQ ID NO: 58): 0.143 + 0.012

HS02-62 (SEQ ID NO: 88): 0.095 + 0.002

HS02-52 (SEQ ID NO: 89): 0.085 + 0.006

HS02-52G (SEQ ID NO: 90): 0.080 + 0.002

HS02-48G (SEQ ID NO: 91): 0.053 + 0.000

HS02-44G (SEQ ID NO: 92): 0.047 + 0.000 without aptamer: 0.031 + 0.000

The experimental assays revealed the formation of activated protein C (APC) / protein C inhibitor (PCI) complexes as the cause of inhibition of activated protein C (APC). Here, the determined number of complexes formed was proportional to the found inhibition constants.

Example 8

Detection of APC by means of the activated protein C binding aptamer of the sequence

SEQ ID NO: 58

White Fluoronunc modules (FluoroNunc modules wight, Nunc, Thermo Fisher Scientific) were coated with streptavidin by overnight incubation with 100 μl per well of a solution of 10 μg / ml streptavidin (Sigma-Aldrich, St. Louis , USA) were incubated at 4 ^° C. The solution was then removed and the modules were washed with a 2% solution of bovine serum albumin (BSA, bovine serum albumin) in TBS buffer (20 mM Tris-HCl, 150 mM NaCl, pH 7.6, containing 0.1% BSA). incubated for one hour at room temperature (22 ⁰ C to 23 ⁰ C).

After removal of the bovine serum albumin solution, 100 μl of a 15 nM solution of 3'-biotinylated activated protein C-binding aptamer of the sequence 5'-GCCTGTTGTGAGCCTCCTAACTGAGCTGTACTCGACTTATCCCG GATGGGGCTCTTATGAGGCGCGACCATGCTTATTCTTGTCTCCC-S '(SEQ ID NO: 58) (Metabion, Planegg -Martinsried, Germany) in TBS buffer (20 mM Tris-HCl, 150 mM NaCl, pH 7.6) was added and incubated for one hour at room temperature (22 ⁰ C to 23 ⁰ C). After immobilization of the aptamer in the wells, they were washed twice each with 100 μl of TBS buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM CaCl ₂ , pH 8.0).

Platelet-rich plasma was recovered by centrifugation at 125 x g (Megafuge 1.0 R, Heraeus, Hanau, Germany) for 10 minutes from a healthy blood donor anticoagulated with citrate buffer (0.109 M citrate) in the ratio 1:10.

In each case, 100 μl of plasma sample were incubated with 50 μl of a tissue factor reagent diluted 1: 1000 with TBS buffer (20 mM Tris-HCl, 100 mM NaCl, pH 7.6) (Recombiplastin, IL, Milan, Italy) in the presence of 15 μM phospholipids (Siemens Healthcare, Marburg, Germany) and the fibrin polymerization inhibitor H-Gly-Pro-Arg-Pro-OH.AcOH (Gly-Pro Arg-Pro, Loxo, Dossenheim, Germany) to a final concentration of 10 mM , The phospholipids were presented as a 1 μg / μl (1.3 mM) stock solution of soy phospholipids prepared by dispersing dried soy phospholipids (Siemens Healthcare Diagnostics) in water. Although the addition of these reagents leads to the formation of thrombin during the course of coagulation, further fibrin polymerization is inhibited. Furthermore, 20 nM thrombomodulin (American Diagnostics, Pfungstadt, Germany) was added.

Coagulation was then activated by adding 10 mM CaCl ₂ to the plasma samples. This leads to an increase of thrombin which combines with the thrombomodulin and thereby can activate the endogenously present protein C of the plasma sample to activated protein C. The formation of activated protein C was in the respective plasma samples after 30 seconds, 1, 2, 3, 4, 5, 6, 8 or 10 minutes by the addition of hirudin (Refludan®, Pharmion, Hamburg, Germany) to a final concentration of 100 μg / ml stopped. Furthermore, apotrotinin (Trasylol®, Bayer, Germany) was added to a final concentration of 20 μM. Aprotinin protects the formed activated protein C from inactivation. In each case 100 μl of the plasma samples were applied per well containing immobilized activated protein C-binding aptamer of the sequence SEQ ID NO: 58 and incubated for 2 hours at room temperature. After incubation, the wells were washed 6 times with 150 μl each of a wash buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM CaCl ₂ , 1 mM MgCl ₂ , pH 8.0). In parallel, a standard concentration series of activated protein C (Xigris®, Eli Lilly, USA) in TBS buffer (20 mM Tris-HCl, 150 mM NaCl, pH 7.6) containing 2% BSA at concentrations in the range of 0 ng / ml to 10 ng / ml applied.

To determine the activated protein C bound in the wells to the aptamer, 100 μl per well of a fluorogenic peptide substrate for activated protein C (Pefa 3342, Pentapharm, Basel, Switzerland) in a concentration of 200 μM in TBS buffer (20 mM Tris HCl, 150 mM NaCl, pH 8.0). The fluorescence was determined by means of a plate fluorometer (Ascent Fluoroscan, Thermo Fisher Scientific).

It was found that in the plasma samples stopped after 30 seconds, 1, 2, 3, 4, 5, 6, 8 or 10 minutes, a time-increasing formation of activated protein C could be detected.

The results show that with the method using the activated protein C-binding aptamer of the sequence SEQ ID NO: 58, the formation of activated protein C in biological samples is detectable.

Example 9

Attempts to inhibit clotting by the thrombin-binding fusion aptamer of

Sequence SEQ ID NO: 98 The thrombin-inhibiting activity of the thrombin-binding fusion aptamer of the sequence 5'-GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT-3 '(SEQ ID NO: 98) was determined in a one-step thrombin-based coagulation assay using an Amelung Coagulometer AMAX CS 190 (Amelung, Lemgo ) certainly.

For this purpose, human α-thrombin (CellSystems Biotechnologie Vertrieb GmbH, St. Katharinen) in PBS (pH 7.4, 3 mM MgCl ₂ , 0.1% BSA) to a concentration of 2.5 NIH units / ml (NIH = National Institute of Health, USA) and diluted with different concentrations of the thrombin-binding fusion aptamer of the sequence SEQ ID NO: 98 and the aptamers of the sequences SEQ ID NO: 95 and SEQ ID NO: 97, wherein a semilogarithmic Dilution sserie starting from 1500 nM was used.

After incubation for 10 minutes at 37 ⁰ C. 25 .mu.l of the reaction mixture to 50 ul were added human citrate plasma pool (own production) and the time up to the coagulation of the test batches.

It was found that the coagulation was inhibited with the addition of the thrombin-binding fusion aptamer of the sequence SEQ ID NO: 98 even at a 30-fold lower concentrations compared to the aptamer of the sequence SEQ ID NO: 95.

Example 10

The effect of the thrombin-binding fusion aptamer of sequence SEQ ID NO: 98 on thrombin-induced aggregation of platelets was determined using human platelets. For this purpose plasma enriched with platelets was obtained by centrifugation at 125 × g (Megafuge 1.0 R, Heraeus, Hanau, Germany) for 10 minutes from a healthy blood donor anticoagulated with citrate buffer (0.109 M citrate, pH 6.4) in a ratio of 1:10. Subsequently, the platelet-enriched plasma was diluted in the ratio 1: 2 with a first washing buffer (140 mM NaCl, 13 mM EDTA, pH 4.2) and the mixture at 1400 × g (Megafuge 1.0 R, Heraeus, Hanau, Germany) for 10 minutes centrifuged. After removing the supernatant, the platelets were resuspended in a second wash buffer (140 mM NaCl, pH 6.5) and centrifuged again at 1400 xg for 10 minutes. Platelets were then transferred to HEPES-Tyrode's buffer (138mM NaCl, 2.8mM KCl, 12mM NaHCO ₃ , 0.5mM NaH ₂ PO ₄ , 10mM glucose, 1mM CaCl ₂ , 0.5mM MgCl ₂ , 10mM HEPES, pH 7.4) to a final concentration of 2 x 10 ⁶ cells / μl.

To determine the thrombin-induced aggregation of the platelets, aliquots of in each case 250 μl of the platelet suspension were incubated with different concentrations in the range of 0 to 1 μM, namely 1 nM, 10 nM, 100 nM, 1 μM and 1 mM, the aptamers 5'- GGTTGGTGTGGTTGG-3 '(SEQ ID NO: 95), 5'-

AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3 '(SEQ ID NO: 97), a 1: 1 mixture of aptamers SEQ ID NO: 95 and SEQ ID NO: 97, the thrombin-binding fusion aptamer of the sequence 5'-GGTTGGTGTGGTTGGAAAAAAAAAAAA GTCCGTGGTAGGGCAGGTTGGGGTGACT-3' ( SEQ ID NO: 98) and the thrombin inhibitors bivalirudin (Angiox ™, MW = 2.180, Nycomed, Switzerland) and argatroban (Argatra®, MW = 526.7 ', Mitsubishi Pharma).

The suspensions were incubated for two minutes at 37 ⁰ C without stirring and in platelet aggregation cuvettes (lab Biomedical Technologies, Ahrensburg, Germany) transferred. Aggregation of platelets was then monitored by addition of human α-thrombin (CellSystems Biotechnologie Vertrieb GmbH) to a final concentration of 0.7 nM (0.1 NIH U / ml) and photo-optically measured in a 2-channel system aggregometer (APACT, LAbor Biomedical Technologies).

It was observed that the aptamers and the thrombin inhibitors inhibited platelet aggregation in a concentration-dependent manner. It was found that the thrombin-binding fusion aptamer according to the invention of the sequence SEQ ID NO: 98 showed an inhibition of the platelet aggregation which was clearly higher than that of the mixture of the aptamers SEQ ID NO: 95 and SEQ ID NO: 97 and was twice or five times more effective compared to the inhibitors bivalirudin and argatroban.

This shows that the thrombin-binding fusion aptamer according to the invention can bring about a very good inhibition of thrombin-induced platelet aggregation.

Example 11

In a thrombin-forming assay, the influence of the thrombin-binding fusion aptamer of the sequence SEQ ID NO: 98 on the activity of the prothrombinase was determined.

Aliquots of 315 μl of a solution of 220 nM prothrombin (CellSystems Biotechnologie Vertrieb GmbH) in assay buffer (20 mM Tris-HCl, pH 7.6, 140 mM NaCl, 3 mM MgCl ₂ , 5 mM CaCl ₂ , 0.01 mg / ml phospholipids, 1 mg / ml bovine serum albumin (BSA, bovine serum albumin)). The phospholipids were presented as a 1 μg / μl (1.3 mM) stock solution of soy phospholipids prepared by dispersing dried soy phospholipids (Siemens Healthcare Diagnostics) in water. The pro-thrombin solutions were mixed with the aptamer of the sequence 5'- GGTTGGTGTGGTTGG-3 '(SEQ ID NO: 95) or the thrombin-binding fusion aptamer of the sequence 5'-GGTTGGTGTGGTTGGAAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT-3' (SEQ ID NO: 98) to a respective final concentration of 1 μM. The control was a solution of 220 nM prothrombin in assay buffer.

The formation of thrombin was started by adding 35 μl of prothrombinase, a solution of 1 mM factor Xa (CellSystems Biotechnologie Vertrieb GmbH) and 1 mM factor Va (CellSystems Biotechnologie Vertrieb GmbH) in assay buffer. To observe thrombin formation, 50 μl samples were taken from the batches every 2 minutes and transferred to white Fluoronunc modules (Nunc, Thermo Fisher Scientific) containing 25 μl of a 30 mM EDTA solution in TBS buffer (pH 7). 6, 1 mg / ml BSA), whereby thrombin formation was stopped. Subsequently, 25 μl of a 1 mM solution of the fluorogenic peptide substrate Z-Gly-Gly-Arg-AMC (Bachern, Weil am Rhein, Germany) in TBS / EDTA buffer (20 mM Tris-HCl, 150 mM NaCl, pH 7.6 , 10mM EDTA, 1mg / ml BSA) was added and the fluorescence determined by a plate fluorometer using a 360 nm excitation and 460 nm excitation filter (Ascent Fluoroscan, Thermo Fisher Scientific). The fluorescence was determined every 20 seconds for 90 minutes and the data obtained was automatically evaluated by the software Thrombinoscope (Synapse B.V., The Netherlands).

The concentration of thrombin formed was calculated from a parallel series of dilutions of α-thrombin.

It was found that the addition of the thrombin-binding fusion aptamer of the sequence SEQ ID NO: 98 showed a significantly stronger effect than the addition of the aptamer of the sequence SEQ ID NO: 95 and led to a 60% reduction in thrombin formation. This shows that the formation of thrombin can already be inhibited by the thrombin-binding fusion aptamer according to the invention.

Example 12

The effect of complementary aptamers on the thrombin-binding fusion aptamer of sequence SEQ ID NO: 98 was investigated by determining the activated partial thromboplastin time (aPTT).

The determination of the activated partial thromboplastin time (APTT) is a routine test of the plasmatic coagulation analysis. The analysis is basically carried out by adding a sample of the plasma with an activator. Subsequently, the coagulation reaction is started with calcium chloride. The period of time is measured until coagulation of the sample occurs.

Aptamer 3'-CCAACCACACACACACTTTTTTTTTTTTTTTTTCAGGCA CCATCCCGTCCAACCCC ACTGA-5 '(SEQ ID NO: 159) complementary to the sequence of the thrombin-binding fusion aptamer of sequence SEQ ID NO: 98 was synthesized (Micro synth).

Plasma was collected by centrifugation at 1250 x g (Megafuge 1.0 R, Heraeus, Hanau, Germany) for 10 minutes from a healthy blood donor anticoagulated with citrate buffer (0.109 M citrate, pH 6.4).

Aliquots of 50 μl each of the plasma samples were spiked with 1 μM of the thrombin-binding fusion aptamer of the sequence 5'-GGTTGGTGTGGTTGGAAAAAAAAAAAAA GTCCGTGGTAGGGCAGGTTGGGGTGACT-3 '(SEQ ID NO: 98) and with 1 μM of the thrombin-binding fusion aptamer of SEQ ID NO: 98 and 0.5 μM, 1 μM or 2 μM of the complementary aptamer 3'-CCAACCACACCAACCTTTTTTTTTTTTTTTTCAGG CACCATCCCGTCCAACCCCACTGA-5' (SEQ ID NO: 159). Controls contained no apatamer or 2 μM of the complementary aptamer of SEQ ID NO: 159. Subsequently, the samples were incubated with 50 μl Actin FS (Siemens Healthcare Diagnostics Marburg, Germany) at 37 ^° C. for 180 seconds. Thereafter, coagulation was initiated by adding 50 μl of a solution of 25 mM CaCl ₂ .

The determination of the activated partial thromboplastin time (APTT) was carried out automatically using the ACL Top® coagulation device (ACL Top®, Instrumentation Laboratory).

It could be stated that the addition of the thrombin-binding fusion aptamer of SEQ ID NO: 98 markedly slowed the clotting, while the addition of the complementary aptamer of SEQ ID NO: 159 reduced the slowing down of clotting in a concentration-dependent manner. The slowing down of coagulation by 1 μM of the thrombin-binding fusion aptamer of SEQ ID NO: 98 could be fully reversed by an equimolar addition of 1 μM of the complementary aptamer of SEQ ID NO: 159, so that the time to coagulate again Reached control level.

This demonstrates that the effect of the thrombin-binding fusion aptamer of SEQ ID NO: 98 on the clotting by the administration of aptamers with complementary sequence is reversible.

Claims

1. Aptamer that binds to a target molecule involved in hemostasis, wherein the aptamer:

is an aptamer that binds to activated protein C, the aptamer having a dissociation constant K _D in the range of> 0.001 nM to ≤ 80 nM of activated protein C, and wherein the aptamer has a length in the range of> 20 nucleotides to ≤ 160 Nucleotides, or is a thrombin-binding fusion aptamer comprising at least two thrombin-binding aptamers and at least one linker, wherein the at least one linker connects the at least two thrombin-binding aptamers.

2. Aptamer which binds to activated protein C, according to claim 1, characterized in that the activated protein C binding aptamer having a dissociation constant K _D in the range of> 0.002 nM to ≤ 8 nM, preferably in the range of> 0.005 nM to ≦ 5 nM, preferably in the range of> 0.01 nM to ≦ 2 nM, particularly preferably in the range of> 0.05 nM to ≦ 1.5 nM, very particularly preferably in the range of> 0.1 nM to ≦ 1, 3 nM, binds to activated protein C.

3. Aptamer which binds to activated protein C according to claim 1 or 2, characterized in that the activated protein C binding aptamer a number of nucleotides in the range of> 20 nucleotides to ≤ 120 nucleotides, preferably in the range of> 40 nucleotides to ≤ 88 nucleotides.

4. Aptamer which binds to activated protein C according to any one of the preceding claims, characterized in that the activated protein C binding aptamer comprises a sequence motif selected from the group comprising:

5'-TATCCCGN _I ATGGG-S '(SEQ ID NO: 1)

wherein:

Ni is selected from the group comprising guanine, cytosine, adenine, thymine, uracil, 2'-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotide, in particular ribonucleotide, or a deletion;

5'-TCTN ₂ TCGGCGG-S '(SEQ ID NO: 2)

wherein:

N ₂ is selected from the group comprising guanine, cytosine, adenine, thymine, uracil, 2'-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotide, in particular ribonucleotide, or a deletion,

and or

5'-TATCACGTATGGG-S '(SEQ ID NO: 3),

wherein the sequence motifs selected from the group comprising SEQ ID NO: 1, SEQ ID NO: 2 and / or SEQ ID NO: 3 modified nucleotides, preferably selected from the group comprising Locked nucleic acids, 2'-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides.

5. Aptamer which binds to activated protein C according to any one of the preceding claims, characterized in that the activated protein C binding aptamer at least a first hairpin structure comprising a stem and a loop, wherein the stem of the first hairpin structure Preferably, a nucleotide sequence cytidine-thymidine has, which forms a bulge.

Aptamer which binds to activated protein C according to any one of the preceding claims, characterized in that the activated protein C binding aptamer has a second hairpin structure comprising a stem and a loop, wherein the second hairpin structure in the loop the first hairpin structure is arranged, wherein preferably the sequence SEQ ID NO: 1 comprises the second hairpin structure.

7. Aptamer which binds to activated protein C according to one of the preceding claims, characterized in that the strain of the first hairpin structure in the range of> 4 base pairs to ≤ 15 base pairs, preferably in the range of> 9 base pairs to ≤ 13 base pairs , preferably in the range of> 11 base pairs to ≤ 12 base pairs and / or the loop of the first hairpin structure in the range of> 5 nucleotides to ≤ 30 nucleotides, preferably in the range of> 6 nucleotides to ≤ 18 nucleotides.

8. Aptamer which binds to activated protein C according to any one of the preceding claims, characterized in that the activated protein C binding aptamer has a sequence selected from the group comprising:

5'-GCCTGTTGTGAGCCTCCTAACTGAGCTGTACTCGACTTATCCCGGATG

GGGCTCTTATGAGGCGCGACCATGCTTATTCTTGTCTCCC-S '

(SEQ ID NO: 58), 5'-GCCTCCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTATG AGGCGCGACCATGC-3 '(SEQ ID NO: 88)

5'-GCCTCCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTATG AGGC-3 '(SEQ ID NO: 89)

5'-GCCTCCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTAGG AGGC-3 '(SEQ ID NO: 90)

5'-CTCCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTAGGAG-S '(SEQ ID NO: 91), and / or

5'-CCTAACTGAGCTGTACTCGACTTATCCCGGATGGGGCTCTTAGG-S '(SEQ ID NO: 92),

and / or their variants, mutants and / or parts, wherein the activated protein C-binding aptamer may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamer modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have.

9. A method for the determination of activated protein C in biological samples, characterized in that at least one binding to activated protein C aptamer according to one of the preceding claims with the biological sample, preferably a biological fluid, is incubated and a binding event between the aptamer and activated Protein C is detected.

10. The method according to claim 9, characterized in that the biological fluid is a body fluid, preferably blood or blood products, preferably selected from the group comprising blood plasma, serum and / or whole blood.

11. Kit comprising at least one activating protein C-binding aptamer according to one of the preceding claims.

12. Use of an activated protein C binding aptamer according to one of the preceding claims, the pharmacologically acceptable salts, derivatives and / or conjugates, for the manufacture of a medicament.

13. Use of an activated protein C-binding aptamer according to one of the preceding claims, its pharmacologically acceptable salts, derivatives and / or conjugates, for the manufacture of a medicament for the diagnosis, therapeutic and / or prophylactic treatment of diseases associated with a disturbed blood coagulation bleeding disorders, preferably hemorrhagic diatheses preferably selected from the group comprising hemophilia, in particular hemophilia A, and / or von Willebrand syndrome, and / or bleeding complications, which are triggered by an increased concentration of activated protein C.

14. A pharmaceutical composition comprising activated protein C-binding aptamers according to one of the preceding claims.

15. Thrombin-binding fusion aptamer according to claim 1, characterized in that the fusion aptamer comprises: two to four thrombin-binding aptamers; and one to three linkers, each linker linking two to thrombin

Connect aptamers.

16. Thrombin-binding fusion aptamer according to claim 1 or 15, characterized in that the thrombin-binding aptamers have a sequence selected from the group comprising:

5'-GGTTGGTGTGGTTGG-3 '(SEQ ID NO: 95), 5'-N ₃ N ₄ N ₅ N ₆ CCGTGGTAGGGCAGGTTGGGGTGN ₇ N ₈ -S' (SEQ ID NO: 96)

wherein

N ₃ , N ₄ , N ₅ , N ₆ , N ₇ , N ₈ are the same or independently selected from the

Group comprising guanine, cytosine, adenine and / or

Thymine, or a deletion, and / or

5'-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-S '(SEQ ID NO: 97)

and / or their variants, mutants and / or parts, wherein the thrombin-binding aptamers may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications, and / or the aptamers modified nucleotides , preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides may have.

17. Thrombin-binding fusion aptamer according to one of the preceding claims, characterized in that the linker is selected from the group comprising nucleotide linker, polyethylene glycol (s), peptidic linker and / or un-branched or branched, saturated or unsaturated Ci-Cso alkyl; wherein preferably the nucleotidic linker has a length in the range of> 1 nucleotide to ≤ 30 nucleotides, preferably in the range of> 2 nucleotides to ≤ 15 nucleotides, preferably in the range of > 10 nucleotides to ≤ 15 nucleotides selected from the group comprising guanosine, cytidine, adenosine and / or thymidine, preferably adenosine; or wherein preferably the linker linear polyethylene glycol (PEG) units HO- (CH ₂ CH ₂ O) _n -H, wherein n is an integer in the range of 1 to 15, preferably in the range of 1 to 10, preferably in the range of 2 to 8, is; or wherein preferably the peptidic linker comprises amino acids selected from the group comprising glycine, alanine and / or β-alanine, preferably comprising in the range of 2 to 4 amino acids; or wherein the linker is preferably a straight or branched, saturated or unsaturated Ci - C ₄ -alkyl group, preferably Ci - C ₃₀ alkyl, more preferably C ₂ - C ₂ o alkyl.

18. Thrombin-binding fusion aptamer according to one of the preceding claims, characterized in that the thrombin-binding fusion aptamers have a sequence selected from the group comprising:

5'-GGTTGGTGTGGTTGGAAAAAAAAAAAAAAAAGTCCGTGGTAGGGCAGG

TTGGGGTGACT-3 '(SEQ ID NO: 98),

5'-GGTTGGTGTGGTTGGAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT-S '

(SEQ ID NO: 99), and / or

5'-GGTTGGTGTGGTTGGAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT-S '

(SEQ ID NO: 100), and / or variants thereof, mutants and / or parts, wherein the thrombin-binding aptamers may have modifications, preferably selected from the group comprising 5'-PEG and / or 3'-CAP modifications , and / or the aptamers may have modified nucleotides, preferably selected from the group comprising Locked nucleic acids, T-fluoro, 2'-methoxy and / or 2'-amino-modified nucleotides.

19. Use of thrombin-binding fusion aptamer according to one of the preceding claims, their pharmacologically acceptable salts, derivatives and / or conjugates, for the manufacture of a medicament.

20. Use of thrombin-binding fusion aptamer according to any one of the preceding claims, their pharmacologically acceptable salts, derivatives and / or conjugates, for the manufacture of a medicament for the diagnosis, therapeutic and / or prophylactic treatment of diseases associated with impaired blood coagulation or whose therapy requires an influence on the blood coagulation system, in particular selected from the group comprising arterial or venous thromboses, in particular acute myocardial and cerebral infarcts or pulmonary embolisms and / or thromboembolic complications, in particular as anticoagulants.

21. A pharmaceutical composition comprising at least one thrombin-binding fusion aptamer according to one of the preceding claims.