RU2410432C1 - Modified dna aptamers inhibiting thrombin activity - Google Patents

Abstract

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and medicine and specifically to direct thrombin inhibitors. The invention discloses a modified aptamer oligodeoxyribonucleotide of general formula d R-GTGACGTANGGTTGGTGTGGTTGGGGCGTCAC-R where d is deoxyribose (oligonucleotide contains deoxyribose in all positions), R denotes chemical substitutes. The substitute used is aminohexanol (NH₂ group), which esterifies the phosphate group on the 5' or 3' end and PEG which is bonded on the 5' and/or 3' end. At least one of the substitutes bonded on the 5' or 3' end is polyethylene glycol (PEG). The disclosed modified DNA aptamer inhibits thrombin activity in human blood plasma by prolonging thrombin clotting time, prothrombin time and activated partial thromboplastin time and inhibits thrombin-stimulated aggregation of thrombocytes. During intravenous administration to an experimental animal, the modified DNA aptamer circulates in the blood longer than the basic aptamer RE31.

EFFECT: said DNA aptamer can serve as the base for antithrombotic medicinal agents.

6 dwg, 3 ex

Description

The invention relates to the field of biotechnology and medicine, namely to modified DNA aptamers, which are oligodeoxyribonucleotides (basic aptamers) conjugated with chemical substituents and possessing anticoagulant properties, and more particularly, to direct thrombin inhibitors that can serve as the basis for antithrombotic drugs.

For the treatment and prevention of thrombosis, drugs are used that either dissolve an already formed thrombus or interfere with the process of thrombosis (Mashkovsky M.D. Medicines, M., Medicine, 2000, v.2, p. 73-76; Encyclopedia of drugs, ed 8, M., Radar, 2001, p. 1503, Reference VIDAL, M., AstraPharmService, 2001, p. 725).

According to the mechanism of action, all known drugs are divided into three groups.

- Thrombolytics, the action of which is aimed at activating the fibrinolytic system of the blood and dissolving the thrombus (streptokinase, urokinase, tissue plasminogen activator).

- Antiplatelet agents, the action of which is aimed at inhibiting platelet aggregation (aspirin, antagonists of P2Y12 ADP receptors clopidogrel, etc.), glycoprotein antagonists IIb-IIIa).

- Anticoagulants - drugs that act on the blood coagulation system and inhibit the formation of fibrin (heparin and its derivatives, indirect anticoagulants, direct thrombin inhibitors).

The fact that the drugs act on different systems of thrombus formation makes it possible to use them in combination, which increases the effectiveness and specificity of therapy.

Thrombin plays a key role in the processes of intravascular thrombosis. This proteinase is involved both in blood coagulation reactions and in platelet activation. The most famous thrombin reaction is the cleavage of fibrinopeptides A and B to form monomers of desAABB fibrin, which then aggregate, crosslink and become insoluble. In the process of blood coagulation, thrombin not only causes the formation of fibrin from fibrinogen, but also activates many factors of the coagulation cascade. Another important function of thrombin is the induction of platelet activation and aggregation, a reaction that triggers the formation of blood clots in the vessels of the arterial bed. This function is carried out by the interaction of thrombin with specific PAR receptors (protease activated receptors, protease activated receptors). Thrombin cleaves the N-terminal peptide of the receptor, and the emerging new N-terminal fragment interacts with a special extracellular region of the receptor, which leads to the initiation of an activating signal. At least two sections of the thrombin molecule — the active center of the enzyme and the region of specific “recognition” of the substrate, the binding to which orientes the substrate relative to the active center, take part in the hydrolysis of high molecular weight substrates. High affinity and specific binding of the two thrombin substrates mentioned above - fibrinogen and PAR receptor - is carried out through a site called exosite I. Considering the key role of thrombin in the main thrombotic reactions - fibrin formation and platelet activation, it is obvious that inhibition of thrombin activity is one of the most promising and effective ways to prevent and treat thrombosis. [Lane D.A., Philippou H., Huntington J.A. Blood 2005, v.106, pp.2605-2612].

A traditional anticoagulant drug that inhibits thrombin reactions is heparin and its derivatives. Heparin does not directly inhibit thrombin activity - its mechanism of action is based on the activation of antithrombin III, the main endogenous thrombin inhibitor. In addition, heparin is able to bind not only antithrombin, but also many other plasma proteins and vascular bed cells. Recent circumstances determine the negative side effects of heparin, such as thrombocytopenia. Direct thrombin inhibitors, such as the hirudin polypeptide and its derivatives (bivalirudin) and some low molecular weight synthetic inhibitors (argatroban, dabigatran), which inhibit thrombin activity, acting directly on the enzyme itself, are deprived of heparin deficiencies. Hirudin and its derivatives interact with both the active center and the site of substrate binding (exosite 1), while low molecular weight inhibitors interact only with the active center. Also, unlike heparin, these compounds do not interact with other (except for thrombin) plasma and cellular proteins, and do not cause the development of such an undesirable side effect as thrombocytopenia. (Di Nisio M., Middeldorp S., Buller H. R. New Eng. J. Med. 2005, v. 353, pp. 1028-1040].

The peptides Gly-Pro, Trp-Pro, Pro-Gly, Gly-Pro-Gly-Gly and Pro-Gly-Pro are known to have anticoagulant and fibrinolytic activity (V.E. Pastorova, L.Ya. Lyapina, T.Yu. Smolina, IP Ashmarin, Anticoagulant and Fibrinolytic Effects of Some Proline-Containing Peptides, Izvestiya AN, Biological Series. 1998. No. 3, p. 390-394).

However, all of these peptides do not have antiplatelet and antithrombotic activity.

Peptides Pro-Gly and Pro-Gly-Pro with antiplatelet activity are known (V.E. Pastorova, L.Ya. Lyapina, I.P. Ashmarin, R.U. Ostrovskaya, T.A. Gudasheva, E.V. Lugovskoy, Fibrindepolymerization activity and antiplatelet effect of cyclic and linear short proline-containing peptides. Izvestiya AN, Biological Series, 2001, No. 5, pp. 593-596).

However, these known peptides have a weak anticoagulant effect.

Aptamers - DNA or RNA oligonucleotides capable of highly specific binding and inhibition of the activity of target molecules can also be used as direct thrombin inhibitors.

Like antibodies, DNA molecules are capable of admitting various three-dimensional structures depending on their sequence. Some of them may be relevant for binding to the target. Small ligands as well as large protein complexes can serve as such targets. Aptamers are selected using the SELEX method for binding to the selected target. (Systematic evolution of ligands by exponential enrichment) for the selection and identification of single-stranded DNA or RNA molecules called aptamers.

If necessary, a directed design and / or modification of the selected aptamer is carried out. In their affinity for the target molecule, aptamers are comparable to antibodies. However, unlike antibodies, and other compounds having a peptide structure (for example, hirudin and its derivatives), oligonucleotide aptamers are non-immunogenic compounds.

Aptamer technology combines the generation of tremendous structural diversity in random oligonucleotide pools with the power of polymerase chain reaction (PCR) to amplify selected sequences. This technology involves screening a large pool with random sequences of oligonucleotides and is based on the fact that they allow a large number of tertiary structures, some of which may have the desired binding or catalytic activity against target molecules. Although inhibition is not necessary for this selection, in many cases, these ligands directly inhibit the biological functions of the target proteins. In these cases, the inhibitory functions of these ligands are presumably due to the overlap of their sites with the functional region of proteins.

In recent years, aptamers are considered as potential pharmacological substances that can be used to develop drugs. [Kulbachinsky A.V. Success biol. chemistry. 2006.V.246. S.193-224; Lee J.F., Stovall G.M., Ellington A.D. Curr. Opin. Chem. Biol. 2006, v.10, pp. 282-289]. One of the areas associated with the possibility of pharmacological use of aptamers is the creation on their basis of an antithrombotic drug - a direct thrombin inhibitor [Spiridonova V.A., Rog E.V., Dugina T.N. Strukova SM., Kopylov A.M. Bioorg. Chemistry. 2003. V. 29, No. 5. S.495-498]

Aptamer DNAs were obtained for thrombin, the properties of which are described, for example, in a number of publications below:

Bock L.C., Griffin L.C., Latham J.A., Vermaas E.H., Toole J.J. Nature 1992. v. 355. p.564-566]

Macaya R.F., Gao H., Joesten M.E., Yang M., Patel R., Bertelsen A.H., Cook A.F. Biochemistry, 1995, v. 34, p.4478-92.

Tasset D.M., Kubik M.F., Steiner W.J. Mol. Biol, 1997, v. 272, p. 688-698.

Kubik M.F., Stephens A.W., Schneider D., Marlar R.A., Tasset D. Nucleic Acid Res. 1994, v.22, p. 2619-2626.

Ikebukuro K., Okumura Y., Sumikura K., Karube I., Nucleic Acid Res. 2003, RS 3, p.205-206.

Ikebukuro K, Okumura Y, Sumikura K, Karube I, Nucleic Acid Res. 2005, v. 33, N12, e108.

Ikebukuro K., Yoshida W., NomaT., Sode K. Biotechnol Lett. 2006, v. 28, p. 1933-1937.

Pagano B., Martino L., Randazzo A., Giancola C. Biophys. J. 2008 v. 94, p. 562-569.

Griffin L.C., Tidmarsh G.F., Bock L.C., Toole J.J., Leung L.L.K. Blood 1993, v. 12, p. 3271-3276.

Li W-X., Kaplan A.V., Grant G.W., Toole J.J., Leung L.L. Blood 1994, v. 3, p. 677-682.

Reyderman L., Stavchansky S. Pharmaceutical research 1998, v. 15, p. 904-910.

Shaw J.P., Fishback J.A., Cundy K.C., Lee W.A. Pharmaceutical research 1995, v. 12, p. 1937-1942.

Lee W.A., Fishback J.A., Shaw J.P., Bock L.C., Griffin L.C., Cundy K.C. Pharmaceutical research 1995, v. 12, p. 1943-1947.

Dobrovolsky A.B., Titaeva E.V., Khaspekova S.G., Spiridonova V.A., Kopylov A.M., Mazurov A.V. Bull. Exp. Biol. Honey. 2009. V.147, No. 7. S.41-45.

In particular, RU 2360000, 06/27/2009 describes new cathepsin G-inhibiting aptamers, which are single or double stranded linear DNA sequences or polynucleotide sequences, characterized in that they have a chain length of at least 60 nucleotides, preferably 70 nucleotides and essentially do not undergo intermolecular and / or intramolecular pairing.

These DNA sequences can have a chain length of 70-120 nucleotides, preferably 70-110 nucleotides, even more preferably 80-100 nucleotides. Although the sequences may be single or double stranded, single stranded sequences are preferred. The sequences are also preferably characterized in that they have a molar guanine content of about 25-50%, preferably 35-45% and / or have an AG / TC molar ratio of about 1.0-2.0, preferably 1.2-1.8 ( for the purposes of this invention, AG is the total number of nucleotides A and G of this sequence, while TC is the total number of nucleotides T and C of this sequence).

Preferred options are:

oligomers of (GT) _n or (AC) _n in which n is in the range of 35-60, preferably 40-50;

homopolymers of (T) _n , or (G) _n , or (A) _n , or (C) _n , or (inosine) _n , in which n is in the range of 70-120, preferably 80-100.

These aptamers selectively and effectively inhibit cathepsin G, and therefore, they can be used in the manufacture of a medicament for the treatment and prophylaxis of inflammatory diseases, procoagulant conditions, genetic diseases, degenerative diseases, DNA damage, neoplasia and / or skin diseases.

Previously, the inventors of the claimed invention developed an original 31-link DNA aptamer, code-named RE31 and having the sequence GTGACGTAGGTTGGTGTGGTTGGGGCGTCAC. This aptamer is not inferior in its ability to inhibit the activity of thrombin, also to the 31-unit aptamer 31ТВА (TBA - thrombin binding aptamer) with the sequence CACTGGTAGGTTGGTGTGGTTGGGGCCAGTG, one of the most highly effective antithrombin aptamers described above. [Spiridonova V.A., Golovin A.V., Kopylov A.M., Dobrovolsky A.B., Mazurov A.V. Application for patent of the Russian Federation No. 2008149583 dated December 17, 2008].

However, it is known that unmodified aptamers, including DNA aptamers against thrombin, are characterized by a very short (not more than a few minutes) lifetime in the bloodstream [Griffin L.C., Tidmarsh G.F., Bock L.C., Toole J.J., Leung L.L.K. Blood 1993, v.12, p.3271-3276]. This property can prevent the creation of effective drugs on their basis. In this regard, to extend the lifetime in vivo base oligonucleotide sequences can undergo chemical modifications. These modifications, firstly, protect aptamers from the action of nucleases, and, secondly, slow down their excretion through the kidneys. Modified aptamers with potential antithrombotic properties are known against the von Willebrand factor [Gilbert J.C., De Feo-Fraulini T., Hutabarat R.M., Horvath C.J., Merlino P.C., Marsh H.N. et al. Circulation 2007, v. 116, pp. 2678-2686] and factor IX [Dyke C.K., Steinhubl S.R., Kleiman N.S., Cannon R.O., Aberle L.G., Lin M., et al. Circulation 2006, v.114, pp.2490-2497].

The technical task of the present invention is the modification of antithrombin DNA aptamer RE31 in order to extend its life time in the bloodstream without significantly reducing the ability to inhibit thrombin reactions.

The stated technical problem is achieved by a modified aptamer oligonucleotide, which is an oligodeoxyribonucleotide DNA aptamer, characterized by a nucleotide sequence

GTGACGTAGGTTGGTGTGGTTGGGGGCGTCAC and conjugated at the 5 ′ or 3 ′ end to the NH ₂ group by esterification with a phosphate group aminohexanol at the 5 ′ or 3 ′ end and / or with PEG polyethylene glycol attached at the 5 ′ and / or 3 ′ end, with at least one of the attached at the 5 ′ and 3 ′ end of the substituents is polyethylene glycol (PEG), and corresponding to the General formula

d R-GTGACGTANGGTTGGTGTGGTTGGGGCGTCAC-R,

where d is deoxyribose, while the oligonucleotide contains deoxyribose in all positions, R are chemical substituents — NH ₂ group and / or polyethylene glycol (PEG).

So, the task is achieved by joining at the 5 ′ and 3 ′ ends of the base oligonucleotide aptamer RE31 with the sequence GTGACGTANGGTTGGTGTGGTTGGGGCGTCAC aminohexanol (NH ₂ groups) or polyethylene glycol (PEG).

Thus, the general formula of the modified DNA aptamers of the invention can be represented as:

where d is deoxyribose (oligonucleotide contains deoxyribose in all positions), R are chemical substituents. As substituents (modifying agents) R, aminohexanol is used, which esterifies the phosphate group at the 5 ′ or 3 ′ end and PEG, while at least one of the substituents attached at the 5 ′ and 3 ′ end is polyethylene glycol (PEG).

Based on formula (1), 3 modified aptamers with the code names NH ₂ -RE-PEG, PEG-RE-NH ₂ and PEG-RE-PEG were created. The NH ₂ -RE-PEG aptamer introduced 5 ′ NH ₂ groups and PEG at the 3 ′ ends of the oligonucleotide, the PEG-RE-NH ₂ aptamer introduced 5 ′ NH and PEG ₂ at the 3 ′ ends of the oligonucleotide, and the aptamer PEG-RE-PEG - the introduction of PEG at both ends of the oligonucleotide.

All 3 aptamers according to the invention:

- inhibit the activity of thrombin in human blood plasma, prolonging APTT, prothrombin and thrombin time, in concentrations comparable to the basic aptamer RE31;

- inhibit thrombin-stimulated platelet aggregation mediated by the binding of thrombin to PAR platelet receptors in concentrations comparable to the basic aptamer RE31;

- when administered intravenously to experimental animals, they circulate in the bloodstream longer than the basic aptamer RE31.

The modified DNA aptamers of the invention are prepared as follows.

The basic oligonucleotide sequence of the RE31 aptamer is synthesized on an Applied BioSystems 380b automated synthesizer using standard derivatives (synthons) of nucleotides, as described in detail in Appendix A to the scientific and technical report in step 1.

After the synthesis of the main oligonucleotide sequence is completed, the desired modification is introduced at the 5′-end. First, a glycol moiety is introduced that is phosphorylated at the terminal hydroxyl group. Aminohexanol is added to the 5′-terminal phosphorus residue, so that the aliphatic amino group becomes terminal.

The introduction of the amino group at the 3'-end is carried out according to a similar scheme - after removing the oligonucleotide from the polymer carrier, the phosphite ester is oxidized to the phosphate derivative and hexanol is added to it, which forms an ether with a pentavalent terminal phosphorus residue, and the amino group remains exposed to the solution. The synthesis scale was 0.1-0.2 μmol / g.

With the introduction of polyethylene glycol, the nucleotide attached to the glass is esterified with polyethylene glycol (PEG), then phosphorylated for further work. When polyethylene glycol is introduced at the 3'-end, spacers are used — oligonucleotide sequences that are small in length, which allow flexibility to be added to the polymer chain and make it possible to further attach extended glycol units of the desired length.

The cleavage of the oligodeoxyribonucleotide from the polymer carrier and the removal of the protective groups are carried out as follows. The polymer from the column is placed in a 1.5 ml tube, pour 0.5 ml conc. NH ₃ and incubated at room temperature for 1.5-2.0 hours. The precipitate was collected by centrifugation, washed with 0.3 ml conc. NH ₃ supernatants were combined and kept at 55 ° for 10-12 hours. After cooling the solution, ammonia was evaporated and the residue was dissolved in 1 ml of distilled water.

Analysis of the reaction mixture was carried out on a Tracor chromatograph, a 4 × 250 mm column with a reverse phase sorbent Diasorb C16T with a pore size of 7 μm. The column is pre-equilibrated with buffer: 48 mM potassium phosphate (pH = 7.0), 2 mM tetrabutylammonium dihydrogen phosphate, 5% acetonitrile, at 45 ° and a flow rate of 1 ml / min. The measurements are carried out at 260 nm, the substance is injected with a syringe in a volume of 2.5 μl. On the chromatogram of the reaction mixture, in addition to the target oligonucleotide, as a rule, shorter products are visible. Their formation is associated with the impossibility of complete condensation, with 100% yield. Preparative separation of the reaction mixture is carried out by reverse phase chromatography. The media is the same as that used in the first case. Typically, the volume of the reaction mixture is 0.5-1.0 ml. The substance elutes in the following range (50-80%) of a buffer of 48 mM potassium phosphate (pH = 7.0), 2 mM tetrabutylammonium dihydrogen phosphate, 40% acetonitrile. The collected material was evaporated many times by adding 1 ml of a 50% solution of methanol in water to remove traces of ammonia. Removal of 5′-O-dimethoxytrityl protection is carried out in 1.5 ml of 80% acetic acid, 30 min at room temperature. To remove acetic acid, the solution was repeatedly evaporated on a rotary evaporator, each time adding 1.5 ml of a 50% solution of methanol in water. The resulting product is dissolved in 1 ml of water. To determine the amount of oligonucleotide obtained at the end of the separation, chromatograms were processed by integrating the peak areas and the concentration of the target product was calculated by the formula S × 4 × 10 ^-6 .

The following examples illustrate the properties of modified DNA aptamers, as direct inhibitors of thrombin with an extended lifetime in the bloodstream, and their use (use), but do not limit them.

Example 1. Inhibition of modified thrombin coagulation reactions with aptamers. Comparison with the basic, unmodified aptamer RE31.

Analysis of the effect of modified aptamers (NH ₂ -RE-PEG, PEG-RE-NH ₂ and PEG-RE-PEG) on blood coagulation included the study of 3 indicators: thrombin time, prothrombin time and activated partial thromboplastin time (APTT). Studies were carried out in comparison with the basic aptamer RE31.

In the thrombin time test, the effect of aptamers on the formation of fibrin catalyzed by exogenous thrombin was determined. 0.1 ml of the aptamer solution in 25 mM HEPES buffer (pH 7.4) containing 150 mM NaCl and 5 mM KCl and 0.1 ml of human citrate plasma was added to the coagulometer cuvette. After incubation for 2 min at 37 ° C, the reaction was started by adding 0.1 ml of a human thrombin solution with a concentration of 6 units / ml (specific activity 4400 units / ml). The clot formation time was recorded.

Figure 1 shows that all three modified aptamers in concentrations up to 0.38 μM significantly (more than 8-10 times) increase the time of fibrin formation after adding exogenous thrombin to human plasma. In terms of their ability to inhibit the action of exogenous thrombin, they are inferior to the basic aptamer RE31, on average by approximately 1.5 times in accordance with the concentrations at which the same effects are achieved on the time of plasma coagulation.

Figure 1 shows the effect of the modified aptamers and the basic aptamer RE31 on thrombin time. The results of one of 3 reproducible experiments are presented.

In the next two series of experiments, we studied the effect of aptamers on the formation of a fibrin clot catalyzed by endogenous thrombin upon activation of coagulation along the “external” (prothrombin time) and “internal” pathways (APTT). The effect of aptamers on prothrombin time was investigated as follows. 20 μl of the aptamer solution in 25 mM HEPES buffer (pH 7.4) containing 150 mM NaCl and 5 mM KCl, then 100 μl of normal human citrate plasma was added to the coagulometer cuvette. After incubation for 2 min at 37 ° C, the reaction was started by adding 100 μl of Ca-thromboplastin (STA Neoplastin Plus manufactured by Diagnostica Stago). The effect of aptamers on APTT was investigated as follows. 20 μl of the aptamer solution in 25 mM HEPES buffer (pH 7.4) containing 150 mM NaCl and 5 mM KCl, then 100 μl of normal human citrate plasma was added to the coagulometer cuvette. Incubated for 2 min at 37 ° C, 100 μl of STA ARTT reagent was added and after 3 minutes the reaction was started by adding 100 μl of 25 mM CaCl ₂ . In both tests, clot formation time was recorded.

Figure 2 shows the effect of the modified aptamers and the basic aptamer RE31 on prothrombin time.

Figure 3 shows the effect of the modified aptamers and the basic aptamer RE31 on APTT. The results of one of 3 reproducible experiments are presented.

Figure 2 and 3 shows that in both cases, all three modified aptamers at concentrations up to 3 μM significantly lengthened the coagulation time — the prothrombin time was no less than 5 times, and APTT about 3-4 times. The concentrations of modified aptamers, at which effects similar to the basic aptamer RE31 were achieved, were higher in both tests - in the test, the prothrombin time was no more than 2 times, and the APTT test was 1.5-4 times for different aptamers.

It can be noted that in all 3 coagulation tests, the NH ₂ -RE-PEG aptamer showed the highest inhibitory activity among the modified aptamers. For this aptamer, differences in equally effective concentrations compared to the basic RE31 aptamer did not exceed 50%.

Example 2. Inhibition of modified aptamers of thrombin-induced platelet aggregation. Comparison with the basic, unmodified aptamer RE31.

The effect of modified aptamers (NH ₂ -RE-PEG, PEG-RE-NH ₂ and PEG-RE-PEG) on thrombin-induced platelet aggregation was investigated in comparison with the basic aptamer RE31.

Washed platelets were obtained from the blood of healthy donors in accordance with the previously described method [Mazurov AV, DVVinogradov, NVKabaeva, GN Antonova, Yu.A. Romanov, TNVlasik, et al. Thromb. Haemost, 1991, v. 66, pp. 494-499]. The washed platelets were suspended in a Tyrode / Hepes solution (137 mM NaCl, 2.7 mM KCl, 0.36 mM NaH ₂ PO ₄ , 0.1% dextrose, 1 mM MgCl ₂ , 0.35% BSA, 5 mM Hepes, pH 7.35) at a concentration of 3 × 10 ⁸ per 1 ml. After resuspension, CaCl _{2 was} added to the washed platelets at a final concentration of 1 mM. Platelet aggregation was studied in a BIOL aggregometer. 300 μl of the washed platelet suspension was added to the aggregometer cuvette and aggregation was recorded by the change in the light transmission of the suspension (T,%) at 37 ° and stirring at a speed of 800 rpm. To stimulate aggregation, human thrombin was used at a final concentration of 0.25 units / ml (specific activity 4400 units / mg). Aptamers were added to the aggregation cuvette at least 2 min before the addition of thrombin, and thrombin (0.1 u / ml) 30 s after the start of light transmission.

Figures 4 and 5 show the curves of thrombin-induced platelet aggregation in the absence and presence of the studied aptamers. It can be seen that at a concentration of 0.01 μM, all three modified aptamers to one degree or another suppressed thrombin-induced aggregation. The maximum effect was achieved in the presence of NH ₂ -RE-PEG, which inhibited aggregation almost as much as the original unmodified aptamer RE31. (figure 4). With an increase in the concentration of modified aptamers to 0.02-0.025 μM, all of them completely suppressed thrombin-induced aggregation. Figure 5 shows, by way of example, aggregation curves when various concentrations of the least effective PEG-RE-PEG aptamer are added.

Figures 4 and 5 show the effect of the modified aptamers and the basic RE31 aptamer on thrombin-induced platelet aggregation. Figure 4. No aptamers were added to platelets (curve 0) or aptamers RE31 (curve 1), NH ₂ -RE-PEG (curve 2), PEG-RE-NH ₂ (curve 3), PEG-RE-PEG (curve 4) were added to concentration of 0.01 μm. Figure 5. No aptamers were added to platelets (curve 0) or PEG-RE-PEG aptamers were added at concentrations of 0.025, 0.02, 0.015 and 0.01 μM (curves 1-4, respectively). Both drawings show the results of one of 3 reproducible experiments.

Despite the significant (sometimes several times) scatter in the absolute values of the aptamer concentrations at which complete inhibition of aggregation was observed in various experiments, the ratio between the effects of the studied aptamers remained unchanged. In its inhibitory activity, NH ₂ -RE-PEG was slightly inferior to the basic aptamer RE31, but slightly superior to 2 other modified aptamers - PEG-RE-NH ₂ and PEG-RE-PEG (see figure 4).

Example 3. The removal of modified aptamers from the bloodstream of rats. Comparison with the basic, unmodified aptamer RE31.

The rate of removal of modified aptamers (NH ₂ -RE-PEG, PEG-RE-NH ₂ and PEG-RE-PEG) from the bloodstream of rats after their intravenous administration was determined in comparison with the basic aptamer RE31. The presence of aptamers in the bloodstream was recorded by their ability to inhibit the effect of thrombin on blood coagulation in the thrombin time test.

To Wistar rats (weight from 350 to 500 g), aptamers were administered intravenously at a dose of 60 μg per 100 g of weight through a catheter installed in the atrium. Blood was taken before and then 5, 15, 30 and 60 minutes after the administration of aptamers. As an anticoagulant, 0.11 M sodium citrate was used in a blood: anticoagulant ratio of 1: 9. The blood volume in each sample is 1 ml. Blood was centrifuged at 10,000 g for 5 min and then plasma was taken. Rat plasma was mixed with standard human plasma in a ratio of 1: 3 and thrombin time was measured, stimulating coagulation with human thrombin solution with an activity of 3 u / ml. (Rat plasma was diluted to standardize the measurement conditions). For 100%, the time of clot formation in the samples taken before the introduction of aptamers was taken.

Figure 6 shows the removal of aptamers from the bloodstream of rats. Rats were given the indicated aptamers and blood was taken before and at the indicated intervals after administration of the aptamers. Rat plasma was mixed with standard human plasma in a ratio of 1: 3 and thrombin time was determined in the resulting mixture. Average values from 3 experiments are presented.

As can be seen from Fig.6, the effects of the unmodified base RE31 aptamer on thrombin time can be recorded only 5 minutes after the rat was introduced into the bloodstream, and after 15 minutes the thrombin time did not differ from the control (before the introduction of the aptamer). With the introduction of all modified aptamers, the elongation of the thrombin time after 5 minutes was more pronounced than with the introduction of the aptamer RE31 - 2-2.5 times compared with 60-70%, respectively. In contrast to RE31, all modified aptamers retained their effect 15 minutes and 30 minutes after administration (prolongation of thrombin time by 40-60% and 15-40%, respectively) and only after 60 minutes the indicators were compared with the control level. The most pronounced effects after 15 and 30 minutes were recorded for the aptamer NH ₂ -RE-PEG.

It should be noted that a longer action of modified aptamers on thrombin time was observed, despite the fact that in vitro the degree of inhibition of thrombin activity by them was slightly lower compared to the basic aptamer RE31 (see example 1). The results obtained indicate that the modifications made significantly - not less than 3-5 times (for different modification options) increase the lifetime of aptamers in the bloodstream in vivo.

Claims (1)

A modified aptamer oligonucleotide with the ability to inhibit thrombin reactions with an increased lifetime in the bloodstream, which is a DNA oligodeoxyribonucleotide - an aptamer characterized by a nucleotide sequence
GTGACGTAGGTTGGTGTGGTTGGGGCGTCAC
and conjugated at the 5 ′ or 3 ′ end to the NH ₂ group by esterification with a phosphate group aminohexanol at the 5 ′ or 3 ′ end and / or to polyethylene glycol (PEG) attached at the 5 ′ and / or 3 ′ end, with at least one of attached at the 5 ′ or 3 ′ end of the substituents is polyethylene glycol (PEG), and corresponding to the general formula
d R-GTGACGTANGGTTGGTGTGGTTGGGGCGTCAC-R,
where d is deoxyribose, while the oligonucleotide contains deoxyribose in all positions, R are chemical substituents — NH ₂ group and / or polyethylene glycol (PEG).

Images