RU2723398C1 - Modified dna-aptamers linking extracellular domain egfr - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention represents a method for producing new DNA-aptamers to EGFR (epidermal growth factor receptor) recognizing an extracellular protein domain and containing a chemically modified nucleotide. Invention describes aptamer deoxyribooligonucleotides specifically binding to EGFR and characterized by a nucleotide sequence of general formula ACGCACCATTTGTTTAATATGXTTTTTAATXCCCCTTGTGGTGTGT, where X is either thymidine or 5-(1-(4-pyrenbutanoic acid propylamide)-4-triazolyl)deoxyribouridine, wherein the modified nucleotide is present in the oligonucleotide in only one of the positions.EFFECT: developed aptamers have improved affinity for the human EGFR protein and its mutant form EGFR vIII.6 cl, 7 dwg, 3 ex

Description

The invention relates to the field of biotechnology and medicine, and specifically to the production of new aptamers recognizing EGFR and EGFR vIII and containing chemically modified nucleotides with a pyrene derivative that can be used to recognize recombinant epidermal growth factor receptor (EGFR) proteins and its mutant form (EGFR vIII).

Aptamers (from Latin Aptus - “match” and Greek Meros - “repeat unit”) are short synthetic nucleic acid fragments (oligonucleotides) with a complex spatial structure that determines their unique properties to selectively bind (like a key to a lock) with any target: be then a chemical substance (isotope, medicine, toxin, etc.), polymers (enzymes, receptors, growth factors, regulatory and structural proteins, immunoglobulins, etc.), supramolecular complexes (e.g. viruses), whole cells (pathogenic bacteria, malignant and other defective cells).

The EGFR aptamers under development are modified DNA aptamers GR20-Pyr-04 and GR20-Pyr-06, which bind to the extracellular domain of the protein.

Important advantages of aptamers compared to drugs of protein and peptide nature are low immunogenicity and the ability, when complications (for example, bleeding) develop, to block their activity with specific antidotes based on oligonucleotides complementary to the drug aptamer. In addition, the possibility of chemical synthesis of aptamers allows us to achieve a high degree of purity of the drug, reproducibility of batches and scalability of production.

US9316647B2 (a priority dated 12/30/2011) describes an aptamer for free EGFR, comprising the following sequence XGANNGNNYGANNCNN (SEQ ID NO: 55). The disadvantage of this aptamer may be a significant number of modifications that can affect the stability of the structure as a whole. In addition, there is no evidence of aptamer affinity for the mutant forms of EGFR.

Another US Pat. No. 9,125,930 B2 (priority dated October 12, 2010) describes an EGFR aptamer comprising the following sequence 5 'GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC 3' (SEQ ID NO: 1). The disadvantage is that this aptamer is an RNA aptamer, which is associated with certain difficulties, RNA molecules easily degrade under the influence of various factors, such as RNases, high temperature, alkaline environment, etc., which ultimately can significantly affect the effectiveness of the drug.

The closest analogue of the invention is the GR20 aptamer, characterized by the nucleotide sequence of the general formula 5'-ACGCACCATTTGTTTAATATGTTTTTTAATTCCCCTTGTGGTGTGT-3 '.

An object of the present invention is to provide highly efficient EGFR ligands containing chemically modified nucleotide-derived pyrenes, based on the DNA aptamer. For subsequent practical use, the length of the aptamers should not exceed 50 nucleotides, which significantly reduces the cost and increases the yield during synthesis.

The solution to this problem is that the previously developed aptamer DNA oligonucleotide, characterized by the nucleotide sequence of the general formula 5'-ACGCACCATTTGTTTAATATGTTTTTTAATTCCCCTTGTGGTGTGT-3 '(GR20), was chemically modified by nucleotides in 22 and 31 positions as shown in Figure 1.

The modified aptamers GR20-Pyr-04 and GR20-Pyr-06 recognize the extracellular domain of EGFR with affinity 3 and 4 times higher than the original aptamer GR20, respectively, and also bind to the mutant version of EGFR vIII protein with affinity 5 times and 9, respectively times higher than the original GR20 aptamer. The chemical modification of the aptamer with pyrene derivatives at positions 22 and 31 led to improved interaction with proteins, provided that the requirements for a nucleotide length of no more than 50 nucleotides were met.

Description of drawings

Figure 1. The estimated secondary structure of the original GR20 aptamer predicted by the Mfold program.

Figure 2. Sensograms of binding of the new modified aptamer GR20-Pyr-04 at concentrations of 50, 125, 250, 500 nM with immobilized recombinant protein EGFR. The signal from the binding of the aptamer to the reference protein (C225 antibody) at similar concentrations was subtracted from the sensograms.

Figure 3. Sensograms of binding of the new modified aptamer GR20-Pyr-06 at concentrations of 50, 125, 250, 500 nM with immobilized recombinant protein EGFR. The signal from the binding of the aptamer to the reference protein (C225 antibody) at similar concentrations was subtracted from the sensograms.

Figure 4. Sensograms of binding of the immobilized starting aptamer GR20 to recombinant EGFR protein at concentrations of 45 and 100 nm. The signal from the interaction of the immobilized aptamer with 5 mM Tris-HCl buffer pH 7.0 with the addition of 140 mM sodium chloride and 10 mM potassium chloride was subtracted from the sensograms.

Figure 5. Sensitivity binding patterns of the new modified aptamer GR20-Pyr-04 at concentrations of 50, 125, 250, 500 nM with an immobilized mutant form of the epidermal growth factor receptor EGFR vIII. The signal from the binding of the aptamer to the reference protein (C225 antibody) at similar concentrations was subtracted from the sensograms.

Figure 6. Binding sensograms of the new modified aptamer GR20-Pyr-06 at concentrations of 50, 125, 250, 500 nM with an immobilized mutant form of the epidermal growth factor receptor EGFR vIII. The signal from the binding of the aptamer to the reference protein (C225 antibody) at similar concentrations was subtracted from the sensograms.

Figure 7. Sensogram of binding of the immobilized starting aptamer GR20 to recombinant protein EGFR vIII at a concentration of 50 nm. The signal from the interaction of the immobilized aptamer with 5 mM Tris-HCl buffer pH 7.0 with the addition of 140 mM sodium chloride and 10 mM potassium chloride was subtracted from the initial sensogram.

The following examples are provided in order to disclose the characteristics of the present invention and should not be construed as in any way limiting the scope of the invention.

Example 1. Synthesis of oligo nucleotides containing a modified nucleotide.

нагрузка 1 мкмоль) производства компании LGC Genomics Ltd. (Великобритания). Для фосфорамидита цитидина использовалась ацетильная защита. Фосфорамидит с функциональной группой для проведения клик-химии (5'-диметокситиритл-5-этинил-dU 3'-[(2-цианоэтил)-(N,N-диизопро-пил)]-фосфорамидит) был заказан в компании Baseclick GmbH (Германия). Используемые в олигонуклеотидном синтезе растворы деблока (3% дихлоруксусной кислоты в толуоле), активатора (0,25 М 4,5-дицианимидазол в безводном ацетонитриле), кэппирующие растворы (20% N-метилимидазол в ацетонитриле и смесь 20% уксусного ангидрида с 30% лутидином в ацетонитриле), оксилитель (раствор 0,005 М йода в смеси пиридин/вода в соотношении 9:1) и раствор 20% диэтиламина в ацетонитриле получены от emp Biotech GmbH (Германия). Безводный ацетонитрил (максимальное содержание воды 0,003%) получен от Biosolve BV (Нидерланды).For the synthesis of oligonucleotides, standard phosphoramidites and column reactors of the MerMade column type with a CPG carrier (pore diameter

load 1 μmol) manufactured by LGC Genomics Ltd. (Great Britain). For cytidine phosphoramidite, acetyl protection was used. Phosphoramidite with a functional group for click chemistry (5'-dimethoxythyryl-5-ethynyl-dU 3 '- [(2-cyanoethyl) - (N, N-diisopropyl)] - phosphoramidite) was ordered from Baseclick GmbH ( Germany). Solutions of deblock (3% dichloroacetic acid in toluene), activator (0.25 M 4,5-dicyanimidazole in anhydrous acetonitrile), capping solutions (20% N-methylimidazole in acetonitrile and a mixture of 20% acetic anhydride with 30% are used in oligonucleotide synthesis) lutidine in acetonitrile), an oxidizing agent (a solution of 0.005 M iodine in a pyridine / water mixture in a ratio of 9: 1) and a solution of 20% diethylamine in acetonitrile were obtained from emp Biotech GmbH (Germany). Anhydrous acetonitrile (maximum water content 0.003%) was obtained from Biosolve BV (Netherlands).

Azides for click chemistry reactions (benzylazide, 6-azidohexanoic acid and pyrenazide) were supplied by Baseclick GmbH (Germany) and Sigma-Aldrich, Inc. (USA). Copper (II) sulfate and L-ascorbic acid auxiliary reagents were obtained from Acros Organics (Thermo Fisher Scientific, Belgium), tris (3-hydroxypropyltriazolylmethyl) amine (TNPTA ligand) were obtained from Sigma-Aldrich, Inc. (USA). The remaining reagents used in the work were of pharmacopoeial quality and supplied by Sigma-Aldrich, Inc. (USA), Acros Organics (Thermo Fisher Scientific, Belgium) and AppliChem GmbH (Germany).

Конденсация амидитов (в том числе и модифицированного) с наращиваемым олигонуклеотидным звеном проводилась в течение 60 секунд. После завершения синтеза колонки с продуктом обрабатывались 20% раствором диэтиламина в ацетонитриле в течение 3 минут для удаления цианоэтильных групп, способных образовывать нежелательные примеси с целевым продуктом в процессе депротекции продукта.The synthesis of oligonucleotides was carried out chemically in the solid phase using phosphoramidite chemistry. The process of synthesis of the given sequences was performed on a MerMade 48 synthesizer (Bioautomation, USA) according to the standard instrument program. The working concentration of phosphoramidite solutions in anhydrous acetonitrile was 0.067 M. Before the synthesis, the prepared phosphoramidite solutions were dried over preactivated molecular sieves

The condensation of amidites (including modified) with an expandable oligonucleotide unit was carried out for 60 seconds. After the synthesis was completed, the product columns were treated with a 20% solution of diethylamine in acetonitrile for 3 minutes to remove cyanoethyl groups capable of forming undesirable impurities with the target product during deprotection of the product.

The deprotection was carried out by incubating the columns in a 30% aqueous solution of ammonia at room temperature for 17 hours. This method was chosen to minimize hydration of the ethynyl group and the formation of a methyl ketone derivative that blocks the click chemistry reaction. After completion of the deprotection procedure, the solutions with the columns were kept for 1 hour at -35 ° C, after which they were washed three times with 200 μl of an 80% aqueous ethanol solution. The oligonucleotide solutions collected after washing the columns were concentrated for 3 hours on a Concentrator Plus rotary evaporator (Eppendorf AG, Germany) at 30 ° C.

Next, the aberrant synthesis products were removed from the target full sequence using liquid chromatography. Separation was carried out on a Resource Q 1 mL anion exchange column (GE Healthcare Life Sciences, USA) in an AKTA purifier UPC 100 chromatographic system (GE Healthcare Life Sciences, USA), a buffer system containing 10 mM Tris * HCl and 50 mM NaClO4 (pH 7.8) was used ) Elution of oligonucleotides from the column was carried out in a gradient mode by adding buffer solution B (10 mM Tris * HCl, 500 mM NaClO4 (pH 7.8)): 0-70% buffer solution B for 30 column volumes at a flow rate of 3 ml / min. The solutions of the target oligonucleotides collected using the fraction collector were desalted / concentrated by 4 centrifugation cycles on Amicon Ultra-15 ultrafiltration cells, cut off limits 30 kDa (Merck KGaA, USA). The total oligonucleotide content in the samples was estimated spectrophotometrically by direct absorption of light solutions with a wavelength of 260 nm. The content of the target oligonucleotide in solutions with deprotection and in fractions with chromatographic purification was estimated by reverse phase HPLC (chromatographic system Agilent series 1200, Agilent Tech., USA) on an XTerra MS C18 Column column (Waters Corp., USA) in buffer system 100 mM TEAA / acetonitrile.

The click chemistry of the oligonucleotides with the ethynyl group and the selected azides was carried out in the presence of copper (I) ions. The reactions were carried out in a mixture of phosphate buffer and DMSO in a ratio of 5.5 - 4.5, containing 50 μM (about 14 nmol) of an oligonucleotide with an ethynyl group and a five-fold excess of azide. The reaction was catalyzed using a mixture of a 100 μM solution of copper (II) sulfate and a 50-fold excess of sodium ascorbate in the presence of a 5-fold (relative to copper sulfate) excess of the stabilizing TNPTA ligand. The solutions of the components before mixing were three times degassed with argon with stirring. The reaction was carried out for 2 hours at 40 ° C. After incubation, the reaction mixture was diluted with deionized water and concentrated on Amicon Ultra-15 ultrafiltration cells. The content of the target oligonucleotide in the reaction mixture was estimated by reverse phase HPLC. The resulting mixture contained from 31 to 67% of the target conjugate.

Methods for the study of the binding of aptamers to proteins by the method of biolayer interferometry.

The binding of the starting and stabilized aptamers to the recombinant extracellular domain of the human EGFR protein (R&D Systems) and to the recombinant extracellular fragment of the mutant form of the EGFR vIII protein (R&D Systems) was studied by biolayer interferometry. The method of bi-layer interferometry is based on the shift of the wavelength of the maximum of the interference intensity (nm) with a change in time of the thickness of the layer of biomolecules adsorbed on the surface of the biosensor, the obtained curves are called sensograms. From sensograms obtained for different concentrations of the complex components, the apparent ccd dissociation constant, the main characteristic of the affinity of the complex, is calculated. Since only specific sorption allows one to determine the parameters of complexation, this method requires the immobilization of one of the components of the complex on the surface of the biosensor. In the present study, proteins were immobilized onto the surface of sensors with carboxyl groups at the amino terminal groups of lysine. All studies using biolayer interferometry were performed on an Octet RED96 instrument (ForteBio Pall, USA) at a temperature of 25 ° С.

Protein immobilization was carried out by a combination of free amino groups of a protein (for example, the e-amino groups of lysine residues) and carboxyl groups on the surface of the AR2G biosensor. The biosensors were activated with a freshly prepared activating mixture of 40 mM 3- (3-dimethylaminopropyl) -1-ethylcarbodiimide hydrochloride and 10 mM sulfo-N-hydroxysuccinimide. Then, EGFR, EGFR vIII or C225 proteins immobilized on 40 mM sodium-potassium phosphate buffer pH 6.43 to concentrations of 1 μg / ml, 1 μg / ml or 5 μg / ml, respectively, were immobilized onto the activated surface of the biosensors. Both proteins were immobilized on different biosensors until the signal reached a plateau. Then, the unbound carboxyl groups of the biosensor were deactivated using 1 M ethanolamine hydrochloride pH 8.5. The signal was stabilized by washing off non-covalently bound protein molecules by lowering the sensor in 5 mM Tris-HCl buffer pH 7.0 with the addition of 140 mM sodium chloride and 10 mM potassium chloride. A 2 μM aptamer solution was transformed in the same buffer. To quantify the apparent ccd dissociation constant, protein binding was performed for aptamer solutions at concentrations of 50, 125, 250, and 500 nM. The association stage lasted 200 s, the dissociation stage 300 s. For protein regeneration after the stage of interaction with the aptamer, a solution of 1 M ethanolamine hydrochloride pH 8.5 was used. Sensors with immobilized monoclonal antibody to EGFR C225 (Merck) were used as reference. The primary processing of the data obtained on the device included the subtraction of the signal from the interaction of the aptamer with the C225 antibody. In all cases, the signal from the interaction of the aptamer with the negative control C225 was significantly lower than the signal from the interaction with EGFR or EGFR vIII.

To compare the affinity of the new modified aptamers with the original GR20 aptamer, the latter was immobilized on the surface of the SAX streptavidin chip using a biotin tag at the 5'-end of the aptamer DNA oligonucleotide, which is introduced by chemical synthesis. Before immobilization, a 2 μM aptamer solution in 5 mM Tris-HCl buffer pH 7.0 with the addition of 140 mM sodium chloride and 10 mM potassium chloride was transformed by keeping it at 95 ° C for 5 minutes and then cooling to 25 ° C. The aptamer was immobilized to the sensor at a concentration of 200 nM until a plateau value was reached. The signal was stabilized by washing non-covalently bound aptamer molecules by washing the sensor in 5 mM Tris-HCl buffer pH 7.0 with the addition of 140 mM sodium chloride and 10 mM potassium chloride. Recombinant proteins EGFR and EGFR vIII were dissolved in the same buffer to obtain solutions with concentrations of 45 and 100 nM or 25 and 50 nM, respectively, and they were coupled with an immobilized aptamer to quantify the apparent ccd dissociation constant. The association stage lasted 200 s, the dissociation stage 300 s. As a negative control, similar experiments were carried out with calf fetuin (SigmaAldrich). Initial processing of the data obtained on the device included subtracting the signal from the interaction of the immobilized aptamer with 5 mM Tris-HCl buffer pH 7.0 with the addition of 140 mM sodium chloride and 10 mM potassium chloride.

Each sensogram was processed manually using Origin software (OriginLab Corporation) in order to obtain data on the kinetics of complex formation. The complex (AB) of aptamer (A) and protein (B) is formed by the following reaction:

moreover, the rate constant of the direct reaction (association) is k _a , and the rate constant of the reverse reaction (dissociation of the complex) k _d . From a signal change at the association stage, both of these constants can be obtained, and from the dissociation stage, only the dissociation rate constant [1]. From the ratio of the values of these rate constants, the equilibrium apparent dissociation constant kK _{d was} calculated by the equation:

Example 2. The study of binding to the receptor of epidermal growth factor EGFR.

Sensograms obtained by biolayer interferometry to calculate the apparent dissociation constant of the complex of the new modified aptamer GR20-Pyr-04 with the epidermal growth factor receptor protein EGFR immobilized on the surface of the biosensor are shown in figure 2.

Sensograms obtained by biolayer interferometry to calculate the apparent dissociation constant of the complex of the new modified aptamer GR20-Pyr-06 with the epidermal growth factor receptor protein EGFR immobilized on the surface of the biosensor are shown in figure 3.

For comparison, the apparent dissociation constant was calculated for the complex of the original GR20 aptamer with the epidermal growth factor receptor protein EGFR. Sensograms were obtained by the method of biolayer interferometry when immobilizing a biotinylated aptamer on the surface of a streptavidin biosensor and are shown in figure 4.

The calculated apparent ccd dissociation constant for the GR20-Pyr-04 aptamer complex with immobilized EGFR is 1.6 ± 0.2 nM, and for the GR20-Pyr-06 aptamer complex with immobilized EGFR is 1.11 ± 0.16 nM, which, respectively 3 and 4 times lower than the ccd constant obtained for the complex with the initial GR20 aptamer (4.6 ± 1.2 nM). Both values indicate a high affinity of the new modified aptamers for the EGFR protein.

Example 3. The study of binding to a mutant form of the receptor for epidermal growth factor EGFR vIII.

Sensograms obtained by the method of biolayer interferometry to calculate the apparent dissociation constant of the complex of the new modified aptamer GR20-Pyr-04 with a mutant form of the epidermal growth factor receptor EGFR vIII immobilized on the surface of the biosensor are shown in figure 5.

Sensograms obtained by the method of biolayer interferometry to calculate the apparent dissociation constant of the complex of the new modified aptamer GR20-Pyr-06 with the mutant form of the epidermal growth factor receptor EGFR vIII immobilized on the surface of the biosensor are shown in figure 6.

For comparison, the apparent dissociation constant was calculated for the complex of the initial aptamer GR20 with the mutant form of the epidermal growth factor receptor EGFR vIII. Sensograms were obtained by the method of biolayer interferometry when immobilizing a biotinylated aptamer on the surface of a streptavidin biosensor and are shown in figure 7.

The calculated apparent ccd dissociation constant for the GR20-Pyr-04 aptamer complex with immobilized EGFR vIII is 0.26 ± 0.08 nM, and for the GR20-Pyr-06 aptamer complex with immobilized EGFR vIII it is 0.14 ± 0.05 nM, which is, respectively, 5 times and 9 times lower than the ccd constant known for the complex with the initial aptamer GR20 (1.28 ± 0.05 nM). Both values indicate a high affinity of the new modified aptamers for the mutant form of the EGFR vIII protein.

List of references.

O'Shannessy, D.J., Brighamburke, M., Soneson, K.K., Hensley, P., & Brooks, I. (1993). Determination of Rate and Equilibrium Binding Constants for Macromolecular Interactions Using Surface Plasmon Resonance: Use of Nonlinear Least Squares Analysis Methods. Analytical Biochemistry, 212 (2), 457-468.

Claims (6)

1. Aptamer modified DNA oligonucleotide that specifically binds to the epidermal growth factor receptor (EGFR) and is characterized by the nucleotide sequence of the general formula 5'-ACGCACCATTTGTTTAATATGXTTTTTAATTCCCCTTGTGGTGTGT-3 ', where X is 5- (4-azolepropyltropenylphenol) ) deoxyribouridine. 2. Aptamer modified DNA oligonucleotide that specifically binds to the epidermal growth factor receptor (EGFR) and is characterized by the nucleotide sequence of the general formula 5'-ACGCACCATTTGTTTAATATGTTTTTTAATXCCCCTTGTGGTGTGT-3 ', where X is 5- (4-azylpropyltropanol) ) deoxyribouridine. 3. Aptamer modified DNA oligonucleotide that specifically binds to a mutant form of the epidermal growth factor receptor (EGFR vIII) and is characterized by the nucleotide sequence of the general formula 5'-ACGCACCATTTGTTTAATATGXTTTTTAATTCCCCTTGTGGTGTGT-3 ', where-4 4-triazolyl) deoxyribouridine. 4. Aptamer modified DNA oligonucleotide that specifically binds to a mutant form of the epidermal growth factor receptor (EGFR vIII) and is characterized by the nucleotide sequence of the general formula 5'-ACGCACCATTTTGTTTAATATGTTTTTTAATXCCCCTTGTGGTGTGT-3 ', where-4 4-triazolyl) deoxyribouridine. 5. A method for recognizing an epidermal growth factor receptor (EGFR), comprising the use of aptamer modified oligonucleotide DNAs according to any one of claims. 12. 6. A method for recognizing a mutant form of the epidermal growth factor receptor (EGFR vIII), comprising the use of aptamer modified oligonucleotide DNAs according to any one of claims. 3, 4.

Images