RU2736790C1 - Modified 50-link dna-aptamers linking extracellular domain egfr - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: described is a group of inventions comprising an aptamer modified DNA oligonucleotide specifically binding to an epidermal growth factor receptor (EGFR) (versions), aptameric modified DNA oligonucleotide specifically binding to mutant form of epidermal growth factor receptor (EGFR vii) (versions), method for recognition of epidermal growth factor receptor (EGFR) and method for recognition of mutant form of receptor of epidermal growth factor (EGFR vIII). In one embodiment, the aptameric modified DNA oligonucleotide is characterized by a nucleotide sequence of general formula 5'-CGACGCACCATTTGTTTAATAXGTTTTTT AATTCCCCTTGTGGTGCGTCG-3', where X is 5-(1-(4-pyrenbutanoic acid propylamide)-4-triazolyl)deoxyribouridine.

EFFECT: invention extends the range of products specifically binding to epidermal growth factor receptor (EGFR) and its mutant form (EGFR vIII).

6 cl, 3 ex, 7 dwg

Description

The invention relates to the field of biotechnology and medicine, specifically, to the production of new aptamers recognizing EGFR and EGFR vIII and containing chemically modified nucleotides with a pyrene derivative, which can be used to recognize recombinant proteins of the epidermal growth factor receptor (EGFR) and its mutant form (EGFR vIII).

Aptamers (from Latin Aptus - "to match" and Greek Meros - "repeat unit") are short synthetic fragments of nucleic acids (oligonucleotides) with a complex spatial structure that determines their unique properties to selectively bind (like a key with a lock) to any target: be then a chemical substance (isotope, medicine, toxin, etc.), polymers (enzymes, receptors, growth factors, regulatory and structural proteins, immunoglobulins, etc.), supramolecular complexes (for example, viruses), whole cells (pathogenic bacteria, malignant and other defective cells).

The aptamers we are developing for EGFR, in particular the subject of patenting - modified DNA aptamers GR200-Pyr-03 and GR200-Pyr-05, bind to the extracellular domain of the protein.

An important advantage of aptamers in comparison with drugs of a protein and peptide nature is their low immunogenicity and the possibility, in the event of complications (for example, bleeding), to block their activity with specific antidotes based on oligonucleotides complementary to the drug aptamer. In addition, the ability to chemically synthesize aptamers allows a high degree of drug purity, batch reproducibility, and production scalability to be achieved.

US Pat. No. 9,316,647 B2 (priority date 12/30/2011) describes an aptamer to free EGFR, including the following sequence XGANNGNNYGANNCNN (SEQ ID NO: 55). The disadvantage of this aptamer may be a significant number of modifications, which may affect the stability of the structure as a whole. In addition, there are no data on the affinity of the aptamer for mutant forms of EGFR.

Another patent US 9125930 B2 (priority dated 10/12/2010) describes an aptamer to EGFR, including the following sequence 5'GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC 3 '(SEQ ID NO: 1). The disadvantage is that this aptamer is an RNA aptamer, which is associated with certain difficulties, RNA molecules are easily degraded under the influence of various factors, such as RNases, high temperature, alkaline environment, etc., which ultimately can significantly affect the effectiveness of the drug.

The closest analogue of the invention is the GR20 aptamer, characterized by the nucleotide sequence of the general formula 5'-ACGCACCATTTGTTTAATATGTTTTTTAATTCCCCTTGTGGTGTGT-3 '.

The objective of the present invention is to provide highly effective ligands to EGFR containing chemically modified pyrene derivative nucleotides based on a DNA aptamer. For subsequent practical use, the length of the aptamer should not exceed 50 nucleotides, which significantly reduces the cost and increases the synthesis yield.

The solution to this problem lies in the fact that the aptameric DNA oligonucleotide developed earlier in our laboratory, characterized by the nucleotide sequence of the general formula 5'-CGACGC ACCATTTGTTTAATATGTTTTTTAATTCCCCTTGTGGTGCGTCG-3 '(GR200) was chemically modified at 26 nucleotides in 22 and - (1- (4-pyrenebutanoic acid propylamide) -4-triazolyl) deoxyribouridine as indicated in Figure 1.

The modified DNA aptamers GR200-Pyr-03 and GR200-Pyr-05 recognize the extracellular domain of EGFR with an affinity 7.5 times higher than that of the original GR200 aptamer, and also bind to the mutant version of the EGFR vIII protein with an affinity of 5 times, respectively, and 1.8 times higher than that of the original GR200 aptamer. Chemical modification of the GR200 aptamer with pyrene derivatives improved the interaction with both proteins, while the length of the oligonucleotides does not exceed 50 nucleotides.

Description of drawings

Figure 1. The putative secondary structure of the original GR200 aptamer predicted by the Mfold program, indicating the position of the modified nucleotides.

Figure 2. Binding sensograms of the new modified aptamer GR200-Pyr-03 at concentrations of 50, 125, 250, 500 nM with the immobilized recombinant EGFR protein. The signal from the binding of the aptamer to the reference protein (antibody C225) at similar concentrations was subtracted from the sensorgrams.

Figure 3. Binding sensograms of the new modified aptamer GR200-Pyr-05 at concentrations of 50, 125, 250, 500 nM with the immobilized recombinant EGFR protein.

The signal from the binding of the aptamer to the reference protein (antibody C225) at similar concentrations was subtracted from the sensorgrams.

Figure 4. Sensograms of the binding of the parent GR200 aptamer at concentrations of 50, 125, 250, 500 nM with the immobilized recombinant EGFR protein. The signal from the binding of the aptamer to the reference protein (antibody C225) at similar concentrations was subtracted from the sensorgrams.

Figure 5. Binding sensograms of the new modified aptamer GR200-Pyr-03 at concentrations of 50, 125, 250, 500 nM with an immobilized mutant form of the epidermal growth factor receptor EGFR vIII. The signal from the binding of the aptamer to the reference protein (antibody C225) at similar concentrations was subtracted from the sensorgrams. Figure 6. Binding sensograms of the new modified aptamer GR200-Pyr-05 at concentrations of 50, 125, 250, 500 nM with an immobilized mutant form of the epidermal growth factor receptor EGFR vIII. The signal from the binding of the aptamer to the reference protein (antibody C225) at similar concentrations was subtracted from the sensorgrams. Figure 7. Sensograms of binding of the parent GR200 aptamer at concentrations of 50, 125, 250, 500 nM with an immobilized mutant form of the epidermal growth factor receptor EGFR vIII. The signal from the binding of the aptamer to the reference protein (antibody C225) at similar concentrations was subtracted from the sensorgrams.

The following examples are provided for the purpose of revealing the characteristics of the present invention and should not be construed as limiting the scope of the invention in any way.

Example 1. Synthesis of oligonucleotides containing a modified nucleotide

For the synthesis of oligonucleotides, standard phosphoramidites and column reactors of the MerMade column type with CPG-carrier (pore diameter 1000A, load 1 μmol) manufactured by LGC Genomics Ltd. were used. (United Kingdom). Acetyl protection was used for cytidine phosphoramidite. Phosphoramidite with a functional group for click chemistry (5'-dimethoxytyritl-5-ethynyl-dU 3 '- [(2-cyanoethyl) - (N, N-diisopropyl)] - phosphoramidite) was ordered from Baseclick GmbH ( Germany). Used in oligonucleotide synthesis solutions of deblock (3% dichloroacetic acid in toluene), activator (0.25 M 4,5-dicyanimidazole in anhydrous acetonitrile), capping solutions (20% N-methylimidazole in acetonitrile and a mixture of 20% acetic anhydride with 30% lutidine in acetonitrile), an oxidizing agent (a solution of 0.005 M iodine in a pyridine / water mixture in a ratio of 9: 1), and a solution of 20% diethylamine in acetonitrile were obtained from emp Biotech GmbH (Germany). Anhydrous acetonitrile (maximum water content 0.003%) was obtained from Biosolve BV (Netherlands).

Azides for performing click chemistry reactions (benzyl azide, 6-azidohexanoic acid, and pyrenazide) were supplied by Baseclick GmbH (Germany) and Sigma-Aldrich, Inc. (USA). Auxiliary reagents copper (II) sulfate and L-ascorbic acid were obtained from Acros Organics (Thermo Fisher Scientific, Belgium), tris (3-hydroxypropyltriazolylmethyl) amine (ligand THPTA) was obtained from Sigma-Aldrich, Inc. (USA). The rest of the reagents used in the work were of pharmacopoeial quality and were supplied by Sigma-Aldrich, Inc. (USA), Acros Organics (Thermo Fisher Scientific, Belgium) and AppliChem GmbH (Germany).

Конденсация амидитов (в том числе и модифицированного) с наращиваемым олигонуклеотидным звеном проводилась в течение 60 секунд. После завершения синтеза колонки с продуктом обрабатывались 20% раствором диэтиламина в ацетонитриле в течение 3 минут для удаления цианоэтильных групп, способных образовывать нежелательные примеси с целевым продуктом в процессе депротекции продукта.The synthesis of oligonucleotides was carried out chemically on a solid phase using phosphoramidite chemistry. The synthesis of the given sequences was carried out on a MerMade 48 synthesizer (Bioautomation, USA) according to the standard program of the device. The working concentration of phosphoramidite solutions in anhydrous acetonitrile was 0.067 M. The prepared phosphoramidite solutions were dried over pre-activated molecular sieves before synthesis.

Condensation of amidites (including modified ones) with the growing oligonucleotide unit was carried out for 60 seconds. After completion of the synthesis, the columns with the product were treated with a 20% solution of diethylamine in acetonitrile for 3 minutes to remove cyanoethyl groups capable of forming undesirable impurities with the target product during the deprotection of the product.

Deprotection was carried out by incubating the columns in 30% aqueous ammonia solution at room temperature for 17 hours. This method was chosen to minimize the hydration of the ethynyl group and the formation of a methyl ketone derivative that blocks the click chemistry reaction. After the completion of the deprotection procedure, the solutions with the columns were kept for 1 hour at -35 ° C, after which they were washed three times with 200 μL of 80% aqueous ethanol solution. The oligonucleotide solutions collected after washing the columns were concentrated for 3 hours on a Concentrator Plus rotary evaporator (Eppendorf AG, Germany) at 30 ° C.

purifier UPC 100 (GE Healthcare Life Sciences, США), использовалась буферная система, содержащая 10 мМ Tris*HCl и 50 мМ NaClO4 (рН 7.8). Элюирование олигонуклеотидов с колонны осуществлялось в градиентном режиме путем добавления буферного раствора В (10 мМ Tris*HCl, 500 мМ NaClO4 (рН 7.8)): 0-70% буферного раствора В за 30 объемов колонны при скорости потока 3 мл/мин. Собранные при помощи коллектора фракций растворы целевых олигонуклеотидов подвергались обессоливанию/ концентрированию посредством 4-х циклов центрифугирования на ультрафильтрационных ячейках Amicon Ultra-15, cut off limits 30 кДа (Merck KGaA, США). Общее содержание олигонуклеотида в образцах оценивалось спектрофотометрически по прямому поглощению растворов света с длиной волны 260 нм. Оценка содержания целевого олигонуклеотида в растворах с депротекции и во фракциях с хроматографической очистки производилась методом обращено-фазовой ВЭЖХ (хроматографическая система Agilent series 1200, Agilent Tech., США) на колонне XTerra MS С18 Column (Waters Corp., США) в буферной системе 100 мМ ТЕАА/ацетонитрил.Then, aberrant synthesis products were removed from the target full-link sequence using liquid chromatography. Separation was carried out on an anion exchange column Resource Q 1 mL (GE Healthcare Life Sciences, USA) in a chromatographic system

purifier UPC 100 (GE Healthcare Life Sciences, USA), a buffer system containing 10 mM Tris * HCl and 50 mM NaClO4 (pH 7.8) was used. Elution of oligonucleotides from the column was carried out in a gradient mode by adding buffer solution B (10 mM Tris * HCl, 500 mM NaClO4 (pH 7.8)): 0-70% buffer solution B for 30 column volumes at a flow rate of 3 ml / min. The solutions of the target oligonucleotides collected using the fraction collector were subjected to desalting / concentration by means of 4 cycles of centrifugation on Amicon Ultra-15 ultrafiltration cells, cut off limits 30 kDa (Merck KGaA, USA). The total oligonucleotide content in the samples was assessed spectrophotometrically by the direct absorption of solutions of light with a wavelength of 260 nm. The content of the target oligonucleotide in solutions with deprotection and in fractions with chromatographic purification was estimated by reversed-phase HPLC (chromatographic system Agilent series 1200, Agilent Tech., USA) on an XTerra MS C18 Column (Waters Corp., USA) in a buffer system 100 mM TEAA / acetonitrile.

The reaction of the click chemistry of oligonucleotides with an ethynyl group and the selected azides was carried out in the presence of copper (I) ions. The reactions were carried out in a mixture of phosphate buffer and DMSO in a 5.5: 4.5 ratio containing 50 μM (about 14 nmol) of an oligonucleotide with an ethynyl group and a fivefold excess of azide. The reaction was catalyzed using a mixture of 100 μM copper (II) sulfate solution and a 50-fold excess of sodium ascorbate in the presence of a 5-fold (with respect to copper sulfate) excess of the stabilizing ligand THPTA. The solutions of the components were degassed three times with argon with stirring before mixing. The reaction was carried out for 2 hours at 40 ° C. After incubation, the reaction mixture was diluted with deionized water and concentrated on Amicon Ultra-15 ultrafiltration cells. The content of the target oligonucleotide in the reaction mixture was estimated by reversed-phase HPLC. The resulting mixtures contained from 31 to 67% of the target conjugate.

Techniques for studying the binding of aptamers to proteins by biolayer interferometry

The binding of the original and stabilized aptamers to the recombinant extracellular domain of the human EGFR protein (R&D Systems) and to the recombinant extracellular fragment of the mutant form of the EGFR vIII protein (R&D Systems) was studied by biolayer interferometry. The biolayer interferometry method is based on the shift of the wavelength of the maximum interference intensity (nm) with time variation of the thickness of the layer of biomolecules sorbed on the biosensor surface; the obtained curves are called sensograms. From the sensograms obtained for different concentrations of the components of the complex, the apparent dissociation constant kCd, the main characteristic of the affinity of the complex, is calculated. Since only specific sorption makes it possible to determine the parameters of complex formation, this method requires immobilization of one of the complex components on the biosensor surface. In the present study, proteins were immobilized on the surface of sensors with carboxyl groups at the terminal amino groups of lysine. All studies by the method of biolayer interferometry were carried out on an Octet RED96 device (ForteBio Pall, USA) at a temperature of 25 ° C.

Immobilization of proteins was carried out by combining free amino groups of the protein (for example, e-amino groups of lysine residues) and carboxyl groups on the surface of the AR2G biosensor. Biosensors were activated with a freshly prepared activating mixture of 40 mM 3- (3-dimethylaminopropyl) -1-ethylcarbodiimide hydrochloride and 10 mM sulfo-N-hydroxysuccinimide. Then EGFR, EGFR vIII, or C225 proteins were immobilized on the activated surface of biosensors, diluted in 40 mM sodium-potassium phosphate buffer pH 6.43 to concentrations of 1 μg / ml, 1 μg / ml, or 5 μg / ml, respectively. Both proteins were immobilized on different biosensors until the signal reached a plateau. Then, the unbound carboxyl groups of the biosensor were deactivated using 1 M ethanolamine hydrochloride, pH 8.5. The signal was stabilized by washing off non-covalently bound protein molecules by lowering the sensor in 5 mM Tris-HCl buffer pH 7.0 supplemented with 140 mM sodium chloride and 10 mM potassium chloride. In the same buffer, a 2 μM aptamer solution was preformed. To quantify the apparent dissociation constant kCd, protein binding was performed for aptamer solutions at concentrations of 50, 125, 250, 500 nM. The association stage lasted 200 s, and the dissociation stage lasted 300 s. For protein regeneration after the stage of interaction with the aptamer, a solution of 1 M ethanolamine hydrochloride, pH 8.5, was used. Sensors with an immobilized monoclonal antibody to EGFR C225 (Merck) were used as a reference. The primary processing of the data obtained on the device included the subtraction of the signal from the interaction of the aptamer with the C225 antibody. In all cases, the signal from the interaction of the aptamer with the negative control C225 was significantly lower than the signal from the interaction with EGFR or EGFR vIII.

Each sensogram was manually processed using the Origin software (OriginLab Corporation) to obtain data on the kinetics of complex formation. The complex (AB) of aptamer (A) and protein (B) is formed by the following reaction:

A + B↔AB,

the rate constant of the forward reaction (association) is ka, and the rate constant of the reverse reaction (dissociation of the complex) is kd. Both of these constants can be obtained from the change in the signal at the stage of association, and only the rate constant of dissociation can be obtained from the stage of dissociation [1]. The equilibrium apparent dissociation constant kKd was calculated from the ratio of these rate constants using the equation:

Example 2. Study of binding to epidermal growth factor receptor EGFR.

The sensograms obtained by the method of biolayer interferometry for calculating the apparent dissociation constant of the complex of the new modified aptamer GR200-Pyr-03 with the protein epidermal growth factor receptor EGFR immobilized on the surface of the biosensor are shown in figure 2.

The sensograms obtained by the method of biolayer interferometry for calculating the apparent dissociation constant of the complex of the new modified aptamer GR200-Pyr-05 with the protein epidermal growth factor receptor EGFR immobilized on the surface of the biosensor are shown in Figure 3.

The sensograms obtained by biolayer interferometry using a similar technique for calculating the apparent dissociation constant of the complex of the parent GR200 aptamer with the protein epidermal growth factor receptor EGFR immobilized on the surface of the biosensor are shown in Figure 4.

The calculated apparent kCd dissociation constants for the complexes of the new modified DNA aptamers GR200-Pyr-03 and GR200-Pyr-05 with immobilized EGFR are 0.12 ± 0.02 nM, which is 7.5 times lower than the kCd constant obtained for the complex with the original GR200 aptamer (0.9 ± 0.2 nM) and indicates a high affinity of the new modified aptamers for the EGFR protein.

Example 3. Study of binding to the mutant form of the epidermal growth factor receptor EGFR vIII.

The sensograms obtained by biolayer interferometry for calculating the apparent dissociation constant of the complex of the new modified GR200-Pyr-03 aptamer with the mutant form of the epidermal growth factor receptor EGFR vIII immobilized on the biosensor surface are shown in Figure 5.

The sensograms obtained by the biolayer interferometry method for calculating the apparent dissociation constant of the complex of the new modified GR200-Pyr-05 aptamer with the mutant form of the epidermal growth factor receptor EGFR vIII, immobilized on the biosensor surface, are shown in Figure 6.

The sensograms obtained by biolayer interferometry using a similar technique for calculating the apparent dissociation constant of the complex of the parent GR200 aptamer with the mutant form of the epidermal growth factor receptor EGFR vIII immobilized on the biosensor surface are shown in Figure 7.

The calculated apparent dissociation constant kCd for the complex of the GR200-Pyr-03 aptamer with immobilized EGFR vIII is 0.12 ± 0.02 nM, and for the complex of the GR200-Pyr-05 aptamer with immobilized EGFR vIII it is 0.34 ± 0.06 nM, which, respectively, is 5 times and 1.8 times lower than the kCd constant known for the complex with the initial GR200 aptamer (0.60 ± 0.09 nM). Chemical modification of the GR200 aptamer with pyrene derivatives resulted in improved interaction with EGFR vIII.

Those skilled in the art will appreciate that numerous changes and / or modifications can be made to the above described embodiments without departing from the broad general scope of the present invention. Thus, the presented embodiments are to be considered in all respects illustrative and not restrictive.

List of references

D.J., Brighamburke, М., Soneson, K.K., Hensley, P., & Brooks, I. (1993). Determination of Rate and Equilibrium Binding Constants for Macromolecular Interactions Using Surface Plasmon Resonance: Use of Nonlinear Least Squares Analysis Methods. Analytical Biochemistry, 212(2), 457-468.

DJ, Brighamburke, M., Soneson, KK, Hensley, P., & Brooks, I. (1993). Determination of Rate and Equilibrium Binding Constants for Macromolecular Interactions Using Surface Plasmon Resonance: Use of Nonlinear Least Squares Analysis Methods. Analytical Biochemistry, 212 (2), 457-468.

--->

<110> Limited Liability Company "APTO-PHARM"

<120> Modified 50-nt DNA aptamers binding the extracellular domain of EGFR

<140> 2019134988

<141> 31.10.2019

<160>

<210>

<211> 50

<212> DNA

<213>

<400> CGACGCACCATTTGТTTAATAXGTTTTTTAATTCCCCTTGTGGTGCGTCG

X - 5- (1- (4-pyrenebutanoic acid propylamide) -4-triazolyl) deoxyribouridine

<110> Limited Liability Company "APTO-PHARM"

<120> Modified 50-nt DNA aptamers binding the extracellular domain of EGFR

<140> 2019134988

<141> 31.10.2019

<160>

<210>

<211> 50

<212> DNA

<213>

<400> CGACGCACCATTTGТTTAATATGTTXTTTAATTCCCCTTGTGGTGCGTCG

X - 5- (1- (4-pyrenebutanoic acid propylamide) -4-triazolyl) deoxyribouridine

<---

Claims (14)

1. Aptameric modified DNA oligonucleotide that specifically binds to the epidermal growth factor receptor (EGFR) and is characterized by the nucleotide sequence of the general formula 5'-CGACGCACCATTTGTTTAATAXGTTTTTTAATTCCCCTTGTGGTGCGTCG-3 ', where X is 5- (1- (4-pyrenebutanoic acid propylamide) -4-triazolyl) deoxyribouridine. 2. Aptameric modified DNA oligonucleotide that specifically binds to the epidermal growth factor receptor (EGFR) and is characterized by the nucleotide sequence of the general formula 5'-CGACGCACCATTTGTTTAATATGTTXTTTAATTCCCCTTGTGGTGCGTCG-3 ', where X is 5- (1- (4-pyrenebutanoic acid propylamide) -4-triazolyl) deoxyribouridine. 3. Aptameric modified DNA oligonucleotide that specifically binds to the mutant form of the epidermal growth factor receptor (EGFR vIII) and is characterized by the nucleotide sequence of the general formula 5'-CGACGCACCATTTGTTTAATAXGTTTTTTAATTCCCCTTGTGGTGCGTCG-3 ', where X is 5- (1- (4-pyrenebutanoic acid propylamide) -4-triazolyl) deoxyribouridine. 4. Aptameric modified DNA oligonucleotide that specifically binds to the mutant form of the epidermal growth factor receptor (EGFR vIII) and is characterized by the nucleotide sequence of the general formula 5'-CGACGCACCATTTGTTTAATATGTTXTTTAATTCCCCTTGTGGTGCGTCG-3 ', where X is 5- (1- (4-pyrenebutanoic acid propylamide) -4-triazolyl) deoxyribouridine. 5. A method for recognizing the epidermal growth factor receptor (EGFR), including the use of aptameric modified DNA oligonucleotides according to any one of claims. 1-2. 6. A method for recognizing the mutant form of the epidermal growth factor receptor (EGFR vIII), comprising the use of aptameric modified DNA oligonucleotides according to any one of claims. 3-4.

Images