RU2700097C1 - Dna-aptamer binding an extracellular domain of egfr - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: described is a group of inventions comprising an aptamer DNA oligonucleotide specifically binding to EGFR, characterized by a nucleotide sequence: ACGCACCATTTGTTTAATATGTTTTTTAATTCCCCTTGTGGTGTGT, and a method of producing said aptamer DNA oligonucleotide. Method of producing DNA oligonucleotide involves cutting 5'- and 3'-end sequence of sequence ATCCAGAGTGACGCAGCATTTGTTTAATATGTTTTTTAATTCCCCTTGTGGTGTGTTGTGGACACGGTGGCTTAGT and 16G replacement by 16C, which leads to duplex increase from 5 to 8 nucleotide pairs and its stabilization.

EFFECT: disclosed invention extends the range of agents for binding with EGFR.

2 cl, 4 dwg, 2 ex

Description

The invention relates to the field of biotechnology and medicine, and specifically to the production of a new aptamer that recognizes EGFR, which has improved binding to the target and can be used to recognize and visualize cells expressing EGFR, and targeted delivery of compounds to these cells.

Aptamers (from Latin Aptus - “match” and Greek Meros - “repeat unit”) are short synthetic nucleic acid fragments (oligonucleotides) with a complex spatial structure that determines their unique properties to selectively bind (like a key to a lock) with any target: be then a chemical substance (isotope, medicine, toxin, etc.), polymers (enzymes, receptors, growth factors, regulatory and structural proteins, immunoglobulins, etc.), supramolecular complexes (e.g. viruses), whole cells (pathogenic ba terii, malignant and other defective cells).

Important advantages of aptamers compared to drugs of protein and peptide nature are low immunogenicity and the ability, when complications (for example, bleeding) develop, to block their activity with specific antidotes based on oligonucleotides complementary to the drug aptamer. In addition, the possibility of chemical synthesis of aptamers allows us to achieve a high degree of purity of the drug, reproducibility of batches and scalability of production.

US 9125930, “EGFR aptamer inhibitor for use in therapy and diagnosis”, priority dated October 12, 2010, describes a method for treating EGFR-mediated disorder by administering to a patient a pharmaceutical composition comprising a nucleotide aptamer consisting of the sequence 5 ′ GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGGCG 3 : 1) and where EGFR-mediated disorder is a hyperproliferative disease. However, this invention describes the action of aptamer RNA.

In the patents KR 101680335 B1 “Aptamer against EGFR and anticancer composition containing the same”, priority dated 05.29.2015 and KR101859615 B1 “EGFR-specific DNA aptamer as incubation additives for promotion of mammalian cell growth and uses it”, priority dated July 17, 2016 EGFR aptamers and a composition containing this aptamer are disclosed, however, the length of the sequences is quite large.

In the application PCT / GB2015 / 051812 “Aptamers against egfr and therapeutic uses thereof”, priority of 06/23/2014 also discloses an aptamer for EGFR, the applicant presents a wide range of sequences that can serve as a therapeutic agent. On the other hand, sequences are shown as examples that have nothing to do with the invention of the applicant.

All of the above documents, despite the fact that aptamers and compositions for EGFR are disclosed, have significant differences and disadvantages. Somehow, some talk about RNA aptamers, which essentially differ from the DNA of aptamers both at the chemical level and structure. In addition, a large disadvantage of RNA aptamers is their instability in physiological fluids and significant costs in production. In other documents, DNA aptamers of a complex or longer structure are disclosed, which in turn affects the yield during synthesis and generally makes reproduction expensive.

Thus, there is a great need for alternative, therapeutically effective aptamers, which are capable of showing significant binding to EGFR in excess of the existing prior art, while significantly reducing costs and increasing the yield of the synthesis.

An object of the present invention is to provide a highly efficient ligand for EGFR based on aptamer DNA. For subsequent practical use, the length of the aptamer should not exceed 50 nucleotides, which significantly reduces the cost and increases the yield during synthesis. The result in solving the problem was the experimentally obtained aptamer to EGFR, in particular the GR20 aptamer DNA, which binds to the extracellular domain of the protein.

Of the closest prototypes to the invention, DNA aptamers referred to in the article “Cell-SELEX Aptamer for Highly Specific Radionuclide Molecular Imaging of Glioblastoma In Vivo” [Wu et al, 2014] can be classified. Experimental work on one of the aptamers showed significant results that exceed the performance of the prototype.

The solution to this problem lies in the fact that the previously developed aptamer DNA oligonucleotide [Wu et al, 2014], characterized by the nucleotide sequence of the general formula ATCCAGAGTGACGCAGCATTTGTTTAATATGTTTTTATATCCCCTTGTGGTGTGTTGTGGACACGGTGecTAGUCHCTAG UCTAG. The secondary structures of the initial and shortened aptamers are shown in Fig. 1. To obtain a new shortened variant, the 5'- and 3'-terminal sequences 1-10 and 57-76 were cut and 16G was replaced by 16C, which leads to an increase in duplex from 5 to 8 pairs of nucleotides and its stabilization.

The truncated aptamer GR20 recognizes the extracellular domain of EGFR with an affinity of three times that of the original aptamer. Removal of sites insignificant for complexation and stabilization of the duplex led to improved interaction with the protein. The specificity of the aptamer was tested on a related HER2 protein from the same ERBB family as EGFR. The dissociation constant of the complex with HER2 could not be determined, but its value was more than 200 nM.

The following examples are provided in order to disclose the characteristics of the present invention and should not be construed as in any way limiting the scope of the invention.

Example 1. The study of protein binding.

The binding of the starting and truncated aptamers to EGFR with the recombinant extracellular domain of the protein was studied by surface plasmon resonance (SPR). The SPR method is based on changing the optical properties of the surface of the chip on which one of the complex components (ligand) is immobilized, when it interacts with another complex component (analyte). In the present study, a recombinant protein, the epidermal growth factor receptor (EGFR), acted as a ligand, and aptamers to it as an analyte. The signal from complex formation is measured in arbitrary units of resonance (RU), the resulting curves are called sensograms. All SPR studies were performed on a ProteOn XPR36 instrument (Bio-Rad Laboratories, Inc.) at a temperature of 25 ° C. The recombinant extracellular fragment of the EGFR protein (from 25 to 645 amino acid residues) was obtained from R&D Systems (1095-ER). As a negative control, a recombinant extracellular domain (from 23 to 652 amino acid residues) of the EGFR analogue from the same ErbB tyrosine protein kinase family of HER2, obtained from G&P Biosciences (HER2 ECD), was used. In fig. 2 under item “B” shows the structure of the extracellular domains of EGFR proteins (Homo sapiens), namely the structure of the extracellular and transmembrane parts of the monomeric protein EGFR (green) with bound EGF (pink), where the lysine residues — the ε-amino group of these residues — are shown in orange can covalently bind to carboxyl groups on the surface of the chip. The atomic coordinates are taken from PDB ID 3NJP [Lu et al, 2010]. In fig. 2, under “B”, the structure of the extracellular domains of HEP2 (Rattus norvegicus) is shown, namely, the structure of the extracellular part of the HER2 monomeric protein (green), where the lysine residues are shown in orange — the ε-amino group of these residues can covalently bind to carboxyl groups on the chip surface . The atomic coordinates were taken from PDB ID 1N8Y [Cho et al, 2003]. The degree of similarity of the extracellular domains of human and rat HER2 proteins is 85%, while the difference in the number of lysine residues necessary for immobilizing the proteins on the chip surface is insignificant.

Protein immobilization was carried out by combining free amino groups of a protein (for example, s-amino groups of lysine residues) and carboxyl groups on the surface of GLC or GLM chips (with a low or medium density of carboxyl groups on the surface). Activating and deactivating reagents from the ProteOn Amine Coupling Kit (Bio-Rad Laboratories, Inc.) were used for the immobilization stage.

A freshly prepared activating mixture of 40 mM 3- (3-dimethylaminopropyl) -1-ethylcarbodiimide hydrochloride and 10 mM sulfo-N-hydroxysuccinimide was injected at a rate of 30 μl / min for 300 s. EGFR and HER2 were then immobilized, diluted in 10 mM sodium acetate buffer, pH 4.6, to concentrations of 1 μg / ml and 11 μg / ml, respectively, passing their solutions at a rate of 25 μl / min for 60 s.

Both proteins were immobilized on different tracks of the chip to achieve close signal values in the region of 5000 RU. Then, the unbound carboxyl groups of the chip were deactivated with 1 M ethanolamine hydrochloride pH 8.5 (30 μl / min 300 s). The signal was stabilized by washing non-covalently bound protein molecules by sequentially passing 10 mM sodium acetate buffer pH 4.5, sodium phosphate buffer (PBS) pH 7.4 and 1 M sodium chloride solution (all solutions were injected at a rate of 100 μl / min within 60 s). All further studies were carried out in PBS pH 7.4 (MP Biomedicals, 0928103). The analyte was injected at a rate of 100 μl / min for 120 s, the dissociation step lasted 300 s. To regenerate the protein after the stage of interaction with the analyte, a 1 M sodium chloride solution was injected sequentially at a speed of 100 μl / min for 18 s and PBS for 60 s. For a qualitative assessment of the binding of DNA aptamers (Eurogen) were used as analyte at concentrations of 100 nM, which obviously exceeds K _D , but does not cause non-specific binding. A positive control for aptamers is monoclonal antibodies to EGFR: 225 and H11 (Invitrogen). The negative control is the aptamer for the hemagglutinin of the influenza A21 virus [Jeon S. et al, 2004].

The primary processing of the data obtained on the device included the removal of artifacts and subtraction of the signal from the interaction of the aptamer with the HER2 protein. In all cases, the signal from the interaction of the aptamer with the negative control of HER2 was significantly lower than the signal from the interaction with EGFR. Aptamer A21 to influenza hemagglutinin did not bind to either EGFR or HER2. As a result of a qualitative analysis of aptamers known in the literature (estimates of R _max , the maximum signal from the aptamer-protein interaction), the validity of the chosen research methodology was confirmed. The binding of these aptamers to EGFR was determined qualitatively (according to R _max , the maximum signal from the aptamer-protein interaction). A decrease in the length of the U31 aptamer by 30 nucleotides at least does not lead to a deterioration in the binding of the aptamer to EGFR, since the R _{max of} the GR20 complex with EGFR is 12.6 ± 0.5 RU, which is not less than the R _{max of} the U31 complex with EGFR, equal to 6 , 1 ± 0.3 RU. Figure 3 shows the sensograms of binding of the aptamers U31 and GR20 (100 nM) with the recombinant immobilized EGFR protein. The signal from the binding of aptamers to the negative control (HER2 protein) is subtracted from the sensograms.

Example 2. Determination of dissociation constants.

For the U31 aptamer, the dissociation constant K _D is known — the main characteristic of the affinity of the complex, however, it was obtained on a culture of cells rich in the mutant EGFR protein (U87-EGFRvIII) using the enzyme-linked immunosorbent assay [Wu et al, 2014] and is 8 ± 2 nM. For the correct comparison of the previously known and new aptamers, we obtained dissociation constants of their complexes with the recombinant extracellular fragment of EGFR by the SPR method. For this, sensograms were obtained on the same chip for the interaction of aptamers in various concentrations with EGFR and HER2 proteins. Figure 4 presents the sensograms for calculating the K _D complexes of aptamers with the EGFR protein. The signal from the binding of aptamers to the negative control (HER2 protein) is subtracted from the sensograms. The following aptamer concentrations were used to quantify the dissociation constant: 1000, 100, 30, 3 nM. The signal from the interaction of the aptamer with the HER2 protein was subtracted from the signal from the interaction of aptamers with the EGFR protein.

Each sensogram was processed manually using Origin software (OriginLab Corporation) in order to obtain data on the kinetics of complex formation. The complex (AB) of aptamer (A) and protein (B) is formed by the following reaction:

A + B↔AB,

moreover, the rate constant of the direct reaction (association) is k _a , and the rate constant of the reverse reaction (dissociation of the complex) k _d . From a signal change at the association stage (i.e., analyte injection), both of these constants can be obtained, and from the dissociation stage (that is, subsequent transmission of the buffer), only the dissociation rate constant. From the ratio of the values of these rate constants, the equilibrium apparent dissociation constant K _{D was} calculated by the equation:

For the aptamer, U31 K _D was 23 ± 4 nM, for GR20 - 6 ± 2 nM. Thus, by the SPR method, it was confirmed that the truncated GR20 aptamer has an increased affinity for the recombinant extracellular fragment of the EGFR protein compared to the original U31 aptamer.

Bibliography.

Jeon S. N., Kayhan B., Ben-Yedidia T., Arnon R. A DNA aptamer prevents influenza infection by blocking the receptor binding region of the viral hemagglutinin. // J Biol Chem. 2004. V. 279. P. 48410-48419

Wu X, Liang H, Tan Y, Yuan C, Li S, Li X, Li G, Shi Y, Zhang X. Cell-SELEX aptamer for highly specific radionuclide molecular imaging of glioblastoma in vivo. // PLoS One. 2014.V. 9.P. e90752.

Claims (4)

1. Aptamer DNA oligonucleotide that specifically binds to EGFR and is characterized by a nucleotide sequence of the General formula: ACGCACCATTTGTTTAATATGTTTTTTAATTCCCCTTGTGGTGTGT. 2. The method of obtaining aptamer DNA oligonucleotide according to claim 1, characterized in that the nucleotide sequence of the General formula ATCCAGAGTGACGCAGCATTTGTTTAATATGTTTTTTATATTCCCCTTGTGGTGTGTTGTGGACACGGTGGCTTAGT are cut off the 5'- and 3'-terminal sequences 1-10 and 57-76 and replaced by 16G by 16C, which leads to an increase in 8 nucleotide duplex.

Images