CN112111494B - DNAzymes for identifying pseudomonas aeruginosa, screening and detecting method and application - Google Patents
DNAzymes for identifying pseudomonas aeruginosa, screening and detecting method and application Download PDFInfo
- Publication number
- CN112111494B CN112111494B CN202011034652.9A CN202011034652A CN112111494B CN 112111494 B CN112111494 B CN 112111494B CN 202011034652 A CN202011034652 A CN 202011034652A CN 112111494 B CN112111494 B CN 112111494B
- Authority
- CN
- China
- Prior art keywords
- pseudomonas aeruginosa
- dnazymes
- dnazyme
- screening
- pae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/001—Enzyme electrodes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/127—DNAzymes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/21—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Pseudomonadaceae (F)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a method for specifically identifying pseudomonas aeruginosaPseudomonas aeruginosa) The invention obtains 2 DNAzymes which are specifically identified and cut by the Pseudomonas aeruginosa and substrates thereof. The invention also elaborates the screening and detecting method and the application of the DNAzyme. The DNAzyme for specifically recognizing the pseudomonas aeruginosa can form a secondary structure of a special loop ring, has a specific recognition effect on the pseudomonas aeruginosa, and the fluorescent labeled DNAzymes can detect 10 6 CFU/mL pseudomonas aeruginosa with the detection range of more than 1 multiplied by 10 6 CFU/mL. The cleavage rate was 0.0167min as measured by kinetics ‑1 . The DNAzymes can be applied to detection of pseudomonas aeruginosa.
Description
Technical Field
The invention belongs to the technical field of pathogenic bacteria detection and molecular biology, and particularly relates to pseudomonas aeruginosaPseudomonas aeruginosa) DNAzymes for specific detection, a screening method thereof, a method for detecting pseudomonas aeruginosa and application thereof.
Background
Pseudomonas aeruginosa (P. aeruginosa) Is a gram-negative bacillus widely distributed in nature and is also a common conditional pathogen of human skin and respiratory tract. It is characterized by secondary infection, which often occurs when the immunity of the organism is reduced. Pseudomonas aeruginosa can cause red skin disease of fish, so that fish body is bloody and inflamed, fins fall off, and aquatic products are seriously harmedAnd (5) breeding. The pseudomonas aeruginosa has strong viability and drug resistance and is not easy to be eliminated in the production process of drinking water, and the WHO uses the pseudomonas aeruginosa as an indicator bacterium of the pollution hazard of bottled mineral water. Pseudomonas aeruginosa is also an important pathogenic bacterium for inpatients, particularly ICU patients, and can cause human cystic pulmonary fibrosis, keratitis, gastrointestinal infection, septicemia and the like.
DNAzymes are DNA oligonucleotides with catalytic activity obtained by in vitro screening. DNAzymes have the advantages of stable structure, relatively small molecules, high catalytic efficiency, easiness in synthesis and modification, no possibility of causing immune reaction of organisms and the like. DNAzymes are typically from 10 13 ~10 15 Screening single-stranded DNA sequences with RNA specific cutting function from a random DNA library. The random libraries for in vitro screening have fixed primer sequences at two ends and four bases of A, T, G and C in fixed number in the middle. The first DNAzyme was reported in 1994 for RNA metal ion cleavage. Under the action of metal ions, the main mechanism of catalytic cleavage of DNAzyme is as follows: the 2' -OH on the deoxyribonucleoside base of the substrate attacks the phosphorus atom in the phosphodiester bond adjacent to the base, so that the potential of the phosphorus atom is changed, and the DNA chain of the substrate is broken, thereby achieving the cutting effect. The screening process mainly comprises the following steps: designing and synthesizing a random library and a primer; linking and purifying an initial screening library; positive screening and negative screening; polymerase chain amplification (PCR) and sequencing by cloning. Generally, the DNAzyme screening process lasts for 4 to 20 cycles (depending on the screening target), and the counter-screening is continuously introduced during the process to improve the specificity of the obtained target sequence.
Currently, the research on pseudomonas aeruginosa at home and abroad is mainly embodied in the aspects of Serotype (Serotype), genotype (Genotype), virulence factor (virogene) and immunological characteristics (immunity characteristics). Although there are many methods for detecting P.aeruginosa, most methods take a long time, are expensive and are not suitable for field use. For example, cell culture typically takes several days to complete, whereas antibody-based assays require multiple washes and are expensive. Isothermal amplification technology requires many primers and is complex in design, and product recovery and sequencing are also difficult. PCR requires DNA extraction, multiple reagents and thermal cycling, and may extract DNA from cells that have died. At present, DNAzymes are mainly screened on metal ions, microbial cells, proteins, small molecules and the like. Although the DNAzymes related to bacteria are researched and reported, the DNAzymes do not report the detection of pseudomonas aeruginosa.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a novel DNAzymes for the specificity detection of pseudomonas aeruginosa, and the simple, quick and accurate detection of the pseudomonas aeruginosa can be realized.
It is still another object of the present invention to provide a screening method of the DNAzyme.
The invention also aims to provide application and a detection method of the DNAzyme for detecting the pseudomonas aeruginosa.
In order to achieve the purpose, the invention adopts the following technical scheme:
the invention provides a method for specifically identifying pseudomonas aeruginosaPseudomonas aeruginosa) The DNAzymes of (1), wherein the nucleotide sequence of the DNAzymes is a single-stranded DNA fragment, and the nucleotide sequence (5 '-3') of the DNAzymes is PAE-1 or PAE-2:
PAE-1：TCCCCCTCTTGTTCCGGAGGAAGGACGGCAGGTGACCCTT
GGACGGGGTTGTCAGCAGTCTGTCCAT
PAE-2：TCCCCCTCTTGTGTGCGGGAGCACAGAGGGGGTGACGGTG
GTCTGGGGTTGTCAGCAGTCTGTCCAT
substrate: TGCTGACAACTrAGGACAAGAGGGGA.
The invention relates to DNAzymes for specifically identifying pseudomonas aeruginosa, and a further preferable technical scheme is as follows: a substrate for use in its detection of a target, the sequence of which is: TGCTGACAACTrAGGACAAGAGGGGA.
The invention relates to DNAzymes for specifically identifying pseudomonas aeruginosa, and a further preferable technical scheme is as follows: and (3) carrying out any mutation on the DNAzymes sequence and/or the substrate, and modifying the obtained sequence and/or the substrate, and using the sequence and/or the substrate for detecting the pseudomonas aeruginosa.
The invention relates to DNAzymes for specifically identifying pseudomonas aeruginosa, and a further preferable technical scheme is as follows: the mutation and the modification are selected from: modification, phosphorylation, methylation, amination, sulfhydrylation and isotopic modification; adding biotin, digoxin, fluorescent substance, quenching group, nano material, polyethylene glycol, peptide fragment, protein, folic acid or enzyme label.
The invention also discloses a screening method of DNAzyme for specifically identifying Pseudomonas aeruginosa, which comprises the following steps:
(1) Synthesizing an oligonucleotide library containing 35 random bases and a primer containing a cleavage site and a biotin tag;
(2) Culturing pseudomonas aeruginosa to be detected in a nutrient broth liquid culture medium; diluting the bacterial suspension in a concentration gradient manner and coating the bacterial suspension on an agar plate to detect the number of bacteria;
(3) Centrifuging the thalli obtained in the step (2), and reserving supernatant fluid, namely extracellular products;
(4) Connecting the initial libraries through PCR, introducing a cutting site and a biotin label, purifying by an alcohol precipitation method and recovering a DNA sequence;
(5) Connecting the PCR product obtained in the step (4) with magnetic beads coated with streptomycin at 37 ℃ for 30 minutes;
(6) Then, magnetically separating to remove supernatant, washing magnetic beads by using streptomyces streptavidin reaction buffer solution, and removing DNA sequences without biotin;
(7) Washing the magnetic beads with 0.2N NaOH, and magnetically separating to prepare a single strand;
(8) Washing the magnetic beads with deionized water to make the pH value close to neutral;
(9) Mixing the pseudomonas aeruginosa extracellular product with the same volume with 2 multiplied by screening buffer solution, incubating and cutting for 1 hour at 37 ℃, carrying out magnetic separation, and recovering supernatant by an alcohol precipitation method;
(10) Amplifying the product obtained in the step (9) by PCR and using the product for the next round of screening;
(11) High-throughput sequencing and DNA sequence analysis;
(12) And detecting the activity and the property of the candidate DNAzyme, and screening to obtain the PAE-1 and the PAE-2.
In the screening method of DNAzyme for specifically identifying Pseudomonas aeruginosa, a further preferred technical scheme is that the biotin tags are all marked at the 5' end of the DNA sequence.
The screening method of DNAzyme for specifically identifying Pseudomonas aeruginosa as described above further preferably adopts the technical scheme that the concentration of the Pseudomonas aeruginosa strain used is 4.5X 10 8 CFU per ml; the instrument used in the concentration determination of the DNA cutting fragment is an ultramicro ultraviolet spectrophotometer; all binding and cleavage reactions were performed in 1.5 ml sterile centrifuge tubes; the DNAzyme cutting fluorescence intensity detection experiment instrument is a full-wavelength multifunctional microplate detector; the diameter of the magnetic beads cleaved by DNAzymes and magnetically separated was 0.5. Mu.m.
The invention also discloses a method for detecting the pseudomonas aeruginosa, which comprises the steps of mixing the sample with the marked DNAzyme and the substrate, detecting corresponding numerical values, comparing the numerical values with blanks and judging.
The invention also discloses an application of the DNAzymes, which is to apply the DNAzymes with the sequence number of PAE-1 or PAE-2 to pseudomonas aeruginosaPseudomonas aeruginosa) Specific recognition of (3).
Compared with the prior art, the technical scheme of the invention has the following beneficial effects:
1. the invention provides pseudomonas aeruginosa dependent DNAzymes with strong specificity, high cutting capability and low detection limit, can quickly and effectively detect pseudomonas aeruginosa without performing complex pretreatment on a detection target, can be widely applied to the quick detection of pseudomonas aeruginosa pathogenic microorganisms in aquaculture and hospital wards, effectively protects water bodies from being polluted by pathogenic bacteria, and has wide application value in aquaculture, water body antifouling and hospital diagnosis.
2. The invention uses pseudomonas aeruginosa to screen DNAzyme with specificity, uses other strains as negative controls, and performs property research such as specificity, sensitivity and the like on the obtained DNAzyme to obtain the biosensor with hypersensitiveness and specificity on the pseudomonas aeruginosa. Provides a simple, rapid and accurate method for detecting and identifying the pseudomonas aeruginosa and diagnosing diseases caused by the pseudomonas aeruginosa thalli.
3. The DNAzymes which specifically recognize pseudomonas aeruginosa can form a secondary structure of a special loop ring, have a specific recognition effect on pseudomonas aeruginosa, and the fluorescent-labeled DNAzymes can detect 10 6 CFU/mL pseudomonas aeruginosa with the detection range of more than 1 multiplied by 10 6 CFU/mL. The cleavage rate was 0.0167min as measured by kinetics -1 。
Description of the drawings:
FIG. 1 is a schematic cut-away diagram of a fluorescent simulated molecular beacon designed in the present invention;
FIG. 2 is a graph showing the concentration of the cut pieces in each round of in vitro screening according to the present invention;
FIG. 3 is the top 10 DNA sequences and their proportion map obtained by high throughput sequencing according to the present invention;
FIG. 4 is a graph showing the cleavage activity of candidate DNA sequences in the present invention;
FIG. 5 is a graph showing a comparison of the activity levels of two DNAzymes having cleavage activity obtained in the present invention;
FIG. 6 is a diagram showing the secondary structure simulation of two Pseudomonas aeruginosa specific RNA-cleaved DNAzymes screened according to the present invention;
FIG. 7 is a graph of the present invention optimized for the concentration of Pseudomonas aeruginosa extracellular product reaction;
FIG. 8 is a graph of DNAzyme cleavage effect pH optimization in the present invention;
FIG. 9 shows Na in the screening buffer according to the present invention + 、Mg 2+ A concentration optimization map;
FIG. 10 is a graph showing the detection of DNAzyme cleavage activity by different metal ions in the present invention;
FIG. 11 is a diagram showing the detection of the specificity of the PAE-1 DNAzyme species in the present invention;
FIG. 12 is a graph showing the sensitivity detection of PAE-1 DNAzyme in the present invention;
FIG. 13 is a graph showing the molecular weight identification of targets in the present invention;
FIG. 14 shows the kinetics of the cleavage reaction in the present invention.
Detailed Description
The screening and property identification of the pseudomonas aeruginosa specific RNA cleaved DNAzymes of the present invention will be described in detail below with reference to the accompanying drawings and the detailed description.
The embodiment is as follows:
1. preparation before screening
(1) Designing a random library and a PCR primer, wherein the random library is 75 nt in sequence, the 5' end is phosphorylated, the middle is 35 nt in random sequence, and the two sides are 20 nt in primer sequence. Shanghai Bioengineering, inc. synthesized random libraries of DNA and related in vitro screened DNA sequences (5 '-3').
Initial library: pGGACAAGAGGGGGATCTTGT-N 35 -GTTGTCAGCAGTCTGTCCAT
Primer 1: ATGGACAGACTGCTGACAAC
FAM-substrate:FAM-ATGGACAGACTGCTGACAACTrAGGACAAGAGGGGGA
(2) Culturing Pseudomonas aeruginosa in nutrient broth liquid culture medium until OD is reached 600 nm The culture was stopped near 1 and the number of bacteria per ml was determined by gradient dilution plating.
(3) Preparation of extracellular products: all the culture solutions were dispensed into 1.5 mL sterile centrifuge tubes on average in an amount of 1 mL, centrifuged at 12000 rpm for 5 min at room temperature, and the supernatants were collected and stored in a-20 ℃ freezer for further use.
(4) All initial DNA libraries and related primers need to be purified by 10% denaturing polyacrylamide gel electrophoresis (dPAGE).
(5) The random library, primer 1 and primer 2 were PCR amplified as follows to prepare an initial DNA library that meets RNA cleavage requirements:
50. μ L PCR system includes: 1. mu.L of random library (final concentration of 20 ng to 100 ng), 2. Mu.L of 10. Mu.M primer 1 and primer 2, 1.5. Mu.L of 10 mM dNTP mixture, 5. Mu.L of 10 XPCR reaction premix, 1. Mu.L of 5U/. Mu.L of LTaq DNA polymerase, and 37.5. Mu.L of ultrapure water. The PCR amplification conditions were as follows: pre-denaturation at 94 ℃ for 5 min, denaturation at 94 ℃ for 30 s, annealing at 57 ℃ for 30 s, extension at 72 ℃ for 1 min, amplification for 8 cycles, and final extension at 72 ℃ for 2 min.
(6) All products were purified and recovered by alcohol precipitation and used as initial screening libraries for in vitro screening.
2. In vitro screening
(1) To a 1.5 mL sterile centrifuge tube was added 50. Mu.L of streptomycin-coated magnetic beads (0.5. Mu.L in diameter, resuspended by shaking well before removal) at a concentration of 50 mg/mL, and the beads were washed with 500. Mu.L of streptavidin reaction buffer and repeated three times.
Streptavidin reaction buffer: 10 mM Tris-HCl,1 mM EDTA, 1M NaCl,0.01% -0.1% Tween-20, pH7.5
(2) The purified PCR product containing the biotin tag was dissolved in 500. Mu.L of streptavidin reaction buffer, mixed with washed magnetic beads (at a magnetic bead concentration of 5 mg/mL), and the reaction tube was set on a DNA mixer and connected at 37 ℃ for 30 min.
(3) Unbound DNA (supernatant) was removed using a magnetic separator and washed twice with 500. Mu.L of streptavidin reaction buffer.
(4) Add 500. Mu.L of 0.2N NaOH, mix well, let stand at room temperature for 2 min, then perform magnetic separation to remove biotin-free DNA, repeat this step 1 time.
(5) The beads were washed with deionized water several times until the pH was maintained at around 7.
(6) 150. Mu.L of 2 Xscreening buffer solution for resuspending the magnetic beads, then 150. Mu.L of Pseudomonas aeruginosa extracellular product (CEM-PA) were added, and after mixing well, the mixture was placed on a DNA mixer and cut at 37 ℃ for 1h.
2 × screening buffer: 100 mM HEPES,300 mM NaCl,30 mM MgCl 2 ，0.02% Tween-20，pH7.0
(7) Magnetic separation, alcohol precipitation method to recover the cutting fragment (supernatant) and Q5000 ultraviolet spectrophotometer to detect the concentration.
(8) And drying the alcohol precipitation product, and performing PCR amplification for the next round of screening.
The progress of the screening was judged by the detection of the concentration of the cleavage product for each round of screening, as shown in FIG. 2.
High throughput sequencing analysis:
the obtained PCR product is sent to Shanghai biological engineering Co., ltd for high-throughput sequencing. Sequencing by using a Miseq platform of Illumina company to generate original data of DNA sequences, performing statistical analysis on the sequences qualified by processing, calculating the repeated occurrence times of different sequences, and sequencing from high to low according to the occurrence times. We selected the first 10 sequences according to their length and percentage from high to low, and performed the full sequence alignment of these 10 sequences using Clustal software.
The sequence proportion graph is shown in fig. 3.
And (3) detecting the activity of the candidate DNA sequence:
preparation of DNAzyme complex: mu.L of 100. Mu.M FAM-Substrate, 2. Mu.L of 100. Mu.M synthetic DNA sequence and 35. Mu.L Buffer B were mixed well, denatured at 90 ℃ for 1 minute, and naturally cooled to room temperature to form a DNAzyme complex (final concentration of 5. Mu.M).
1. Fluorescence method.
The cutting result was tested according to the design of FIG. 1. mu.L of 2 × screening buffer, 41. Mu.L of ultrapure water, 4. Mu.L of 5. Mu.M DNAzyme complex and 10. Mu.L of CEM-PA were mixed uniformly in a 96-well plate (each sample contains 3 parallel samples), and the mixture was detected in a multifunctional full-wavelength microplate reader at intervals of 30 s and with plate readings of 60 to 120 min (excitation wavelength = 488 nm, incident wavelength = 520 nm). Finally, each reaction mixture is stopped by urea stop solution and detected by 15 percent dPAGE electrophoresis, a gel imager is used for data analysis and the cutting product is quantified to determine the cutting rate, and a formula is usedY t =Y o + a(1− e −kx ) Performing a linear fit whereinY t AndY o respectively represents the intensity of the cutting fragment at different reaction time and 0,krepresenting the real-time cutting rate. The detection results are shown in FIG. 4
2. Denaturing polyacrylamide gel electrophoresis (15% dPAGE).
mu.L of 2 Xscreening buffer, 41. Mu.L of ultrapure water, 4. Mu.L of 5. Mu.M DNAzyme complex and 10. Mu.L of CEM were mixed well in a light-shielding tube and cleaved at 37 ℃ for 30 min. According to the following steps: add 2 XUrea stop buffer to volume 1 and run at 150V for 1h. With Gel Doc TM The EZ gel imaging analysis system analyzes the photographs.
15 The% dPAGE formulation is as follows:
15% dPAGE stock 7 mL
10% ammonium persulfate 32. Mu.L
3. ELISA plate rapid detection
And diluting the DNAzyme compound to 200 mM, taking 30 mu L of the DNAzyme compound by using a pipette gun, adding the diluted DNAzyme compound to the center of a hole of an enzyme-labeled plate, keeping the plate in a dark place, putting the plate in an oven for 1-2 h until the plate is dried, taking the plate out, adding 20 mu L of CEM-PA, and placing the plate in a dark box type ultraviolet analyzer for observation and photographing.
And (3) secondary structure analysis:
the IDT Oligo Analyzer 3.1 (https:// sg. Idttna. Com/UNAFold) oligonucleotide structure on-line analysis system was used to predict PAE-1 and PAE-3 secondary structures. As a result, both of these DNAzymes were found to contain a specific stem-loop structure (see FIG. 5). The sequence of the red part of the stem loop is highly conserved in PAE-1 and PAE-2, and may be related to the active region of CEM-PA.
Optimizing the concentration of extracellular products:
equal volume of different OD at the same concentration of PAE-1 600 nm CEM-PA values of (0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9) are plotted on the abscissa by fitting a linear curve equation to the formulaF=Y 0 +a* x performing a linear curve fitting, whereinFIs of different OD 600 nm The strength of the PAE-1 cleavage fragment at concentration,Y 0 is OD 600 The intensity of the corresponding fragment is 0, and a is a constant. The fluorescence ratio of the cleavage product fragments was plotted on the ordinate as a comparison chart as shown in FIG. 6. The results show that with OD 600 The strength of the cleavage fragment is gradually increased and increased together with OD 600 nm When it is equal to 0.8, a balance period is entered, the correlation R of which 2 A number of 0.985 indicates a good correlation between OD and cut fragment strength.
Optimizing the pH value of the cutting reaction:
taking OD 600 nm The CEM-PA concentration at 0.8 was constant to investigate the PAE-1 cleavage activity at different pH values. Due to Mg in the reaction solution 2+ Precipitates are easy to form under alkaline conditions, so that the experimental accuracy is influenced, and the pH value of 4.5-8 is selected as an optimal range. Adjusting pH to 4.5-5 with acetic acid-sodium acetate, adjusting pH to 5.5-6.5 with MES, and adjusting pH to 7-8 with HEPES. As shown in FIG. 7, the activity of PAE-1, PAE-2 was weak or inhibited (e.g., pH 4.5 and 5) in an acidic environment, and showed higher activity at higher pH (e.g., pH7.5 and 8), with only a small increase in pH7.5 to pH8, and further increase in pH did not increase the cleavage activity but rather affected the accuracy of the experiment due to precipitation. Therefore, we chose pH8.0 as the optimum pH for the DNAzyme reaction and used this to perform other chemical property determinations of the DNAzyme.
Screening for Na in buffer + 、Mg 2+ Concentration optimization:
DNAzymes have strong cleavage activity in the presence of specific metal ions, and the activity of the DNAzymes can be significantly influenced by different types and concentrations of the metal ions. The divalent metal ion is a key factor for the deoxyribozyme to exert activity, and can stabilize the reaction transition state of the deoxyribozyme and facilitate the folding of the deoxyribozyme into an active structure. We first tested different concentrations (0, 30, 60, 90, 120, 150, 180, 210, 240, 300, 400 and 600 mM) of Na + And Mg 2+ Effect on PAE-1 DNAzyme Activity when Mg 2+ At a concentration of 0, na concentrations of 0, 30, 60, 90, 120, 150, 180, 210, 240, 300, 400 and 600 mM were measured, respectively + Effect on DNAzyme activity. Selecting Na with the highest activity + Is 30mM as Na + Detection of different Mg at a concentration of 30mM 2+ DNAzyme activity of (1). (see FIG. 8), the activity of PAE-1, PAE-2 was accompanied by Na + And Mg 2+ The increase in concentration is shown by a tendency to rise first and then fall when Na is added + At a concentration of more than 30mM or Mg 2+ The DNAzyme activity is reduced sharply when the concentration exceeds 60 mM, even when the concentration is more than that of Na + And Mg 2+ The concentration was low at 0. This is likely that the high concentration of metal ions alters the three-dimensional structure of the DNAzyme, reducing the cleavage activity.
Detection of cleavage activity by different metal ions:
we first evaluated three ions of lithium, sodium and potassium (Li) + 、Na + And K + Concentration of 30 mM) on DNAzyme activity at 1h (see fig. 9), the activity was: k + >Li + >Na + . EDTA was then added to the buffer containing the divalent metal ion to form a complex to determine its effect on DNAzyme. The results show that DNAzyme is greatly inhibited in its activity without the assistance of divalent metal ions. Followed by 30mM Na + In the presence of (A), different divalent metal ions (Ca) were tested 2+ 、Ni 2+ 、Ba 2+ 、Zn 2+ 、Mn 2+ 、Mg 2+ 、Cd 2+ 、Co 2+ 、Hg 2+ 、Sr 2+ ) Effect on DNAzyme activity (see figure 9). Wherein Mn is 2+ 、Ni 2+ 、Co 2+ And Mg 2+ Has better auxiliary effect, and the cutting activity is as follows: mg (magnesium) 2+ >Co 2+ >Ni 2+ >Mn 2+ And have similarities to previously reported. We have found that these metal ions have some similarity, li + 、Na + And K + All belong to IA group on the periodic table of elements, and have certain similarity in extra-nuclear electron arrangement, co 2+ 、 Ni 2+ 、 Mn 2+ All belong to transition metal elements in the fourth period, and the number of electron layers is the same. So except for the inherent Na + Outer, K + And Co 2+ Also has good cutting effect.
And (3) specific detection:
in the experiment, pseudomonas aeruginosa extracellular products are taken as screening targets, besides cell metabolism, a culture medium is also a key factor influencing the experiment, in order to eliminate cutting possibly caused by the culture medium, a sequence-DNAzyme and a blank culture medium are mixed for verification, and the specificity of the PAE-1 and the PAE-2 under 8 different bacteria extracellular products is verified. (see FIG. 10), the results show that the blank medium (labeled blank) not only does not cause cleavage, but also results in quenching of fluorescence. 8 bacteria tested: vibrio vulnificus, staphylococcus aureus, yersinia enterocolitica, pseudomonas aeruginosa, pseudomonas salmonicida, vibrio vulnificus, edwardsiella tarda, escherichia coli and Bacillus subtilis have no cleavage activity and the fluorescence values are kept low. Therefore, the PAE-1 and the PAE-2 have high specificity to the pseudomonas aeruginosa, and can be prepared into a biosensor for specifically detecting the pseudomonas aeruginosa after being modified, so that convenience is provided for detecting the pseudomonas aeruginosa in future.
And (3) sensitivity detection:
we adopt a gradient dilution method to dilute the culture solution of the pseudomonas aeruginosa (6.5 multiplied by 10) 8 cfu/mL) to collect Pseudomonas aeruginosa extracellular products at different concentrations, thereby determining the effective detection range of PAE-1, PAE-2. DNAzyme detection was performed under the optimal conditions described above using Pseudomonas aeruginosa extracellular products (medium 12000 rmp 5 min centrifugation) at different concentrations, and the change in fluorescence at 37 ℃ over 2h is shown in FIG. 11. The results show that the concentration of the pseudomonas aeruginosa is from 10 -6 Gradually increased, the fluorescence value generated by cutting gradually strengthened, and the detection limit is 6.5 multiplied by 10 -6 cfu/mL。
Target properties and molecular weight prediction:
to determine the type of extracellular products of P.aeruginosa, we first hypothesized that this target is a class of proteins. The experimental group was digested with 36. Mu.L of water, 45. Mu.L of BufferB, 5. Mu.L of trypsin and 10. Mu.L of CEM at 37 ℃ for 60 minutes, then mixed well with 4. Mu.L of DNAzyme, and read at 37 ℃ for 2h (excitation = 488 nm, incident = 520 nm). The control group was inactivated by boiling the trypsin in water for 5 minutes, and the other steps were the same, and the results are shown in FIG. 12. The result shows that CEM-PA can be digested by trypsin, and the target can be determined to be protein. We then tried to estimate the molecular weight of the protein using centrifuge filter tubes of different pore sizes, we filtered CEM-PA using 3K, 5K, 10K and 50K spin columns, respectively, and incubated the filtrates separately, which showed that only 50K filtrate induced cleavage of PAE-1, PAE-2, none others did cause cleavage reaction (see FIG. 13), and the data showed that the molecular weight of the target protein was between 10 kDa and 50 kDa.
Cutting rate:
based on the above studies, we performed in 100 mM HEPES, 60 mM K + 、30mM Mg 2+ And pH8.0 (see FIG. 14), and the kinetics of the PAE-1, PAE-2 cleavage reaction were determined by the first-order reaction rate equationY t =Y 0 + a（1-e -bx ) To perform a kinetic linear curve fit, whereinY t AndY 0 represents the DNAzyme cleavage fragment intensity at a given reaction time t and time 0, respectively,brepresenting the reaction rate constant. The fitting results show that: the PAE-1 has good cutting performance and the reaction rate constant is 0.0167min -1 PAE-2 also has benign cutting properties with a reaction rate constant of 0.0197min -1 The rate indicates that the DNAzyme can effectively detect the pseudomonas aeruginosa under specific conditions.
Sequence listing
<110> Jiangsu ocean university
<120> DNAzymes for identifying pseudomonas aeruginosa, screening and detecting method and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 67
<212> DNA
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 1
tccccctctt gttccggagg aaggacggca ggtgaccctt ggacggggtt gtcagcagtc 60
tgtccat 67
<210> 2
<211> 67
<212> DNA
<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 2
tccccctctt gtgtgcggga gcacagaggg ggtgacggtg gtctggggtt gtcagcagtc 60
tgtccat 67
Claims (1)
1. A DNAzymes for specifically recognizing Pseudomonas aeruginosa (Pseudomonas aeruginosa), wherein: the nucleotide sequence of the DNAzymes is a single-stranded DNA fragment, and the nucleotide sequence is PAE-1 or PAE-2:
PAE-1：TCCCCCTCTTGTTCCGGAGGAAGGACGGCAGGTGACCCTT
GGACGGGGTTGTCAGCAGTCTGTCCAT
PAE-2：TCCCCCTCTTGTGTGCGGGAGCACAGAGGGGGTGACGGTG
GTCTGGGGTTGTCAGCAGTCTGTCCAT。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011034652.9A CN112111494B (en) | 2020-09-27 | 2020-09-27 | DNAzymes for identifying pseudomonas aeruginosa, screening and detecting method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011034652.9A CN112111494B (en) | 2020-09-27 | 2020-09-27 | DNAzymes for identifying pseudomonas aeruginosa, screening and detecting method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112111494A CN112111494A (en) | 2020-12-22 |
| CN112111494B true CN112111494B (en) | 2023-04-07 |
Family
ID=73797096
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011034652.9A Active CN112111494B (en) | 2020-09-27 | 2020-09-27 | DNAzymes for identifying pseudomonas aeruginosa, screening and detecting method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112111494B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113278616B (en) * | 2021-06-17 | 2022-07-01 | 温州医科大学 | DNAzyme capable of specifically recognizing toxoplasma gondii and having RNA cutting function and kit |
| CN115029348B (en) * | 2022-05-23 | 2024-03-12 | 大连理工大学 | Chain-like deoxyribozyme probe for identifying pseudomonas cocoanut and application thereof |
| CN115011604B (en) * | 2022-07-26 | 2023-10-27 | 长沙医学院 | Aptamer pilA-1 of pseudomonas aeruginosa IV pilin PilA and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3263115A1 (en) * | 2016-06-30 | 2018-01-03 | Technische Hochschule Mittelhessen | Invention relating to an agent combating pseudomonas aeruginosa |
| CN110106178A (en) * | 2019-05-17 | 2019-08-09 | 淮海工学院 | The DNAzyme and screening technique and purposes for identifying and cutting for Vibrio anguillarum |
-
2020
- 2020-09-27 CN CN202011034652.9A patent/CN112111494B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3263115A1 (en) * | 2016-06-30 | 2018-01-03 | Technische Hochschule Mittelhessen | Invention relating to an agent combating pseudomonas aeruginosa |
| CN110106178A (en) * | 2019-05-17 | 2019-08-09 | 淮海工学院 | The DNAzyme and screening technique and purposes for identifying and cutting for Vibrio anguillarum |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112111494A (en) | 2020-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112111494B (en) | DNAzymes for identifying pseudomonas aeruginosa, screening and detecting method and application | |
| CN102844445B (en) | Enhanced multiple FISH | |
| CN110106178B (en) | DNAzyme for identifying and cutting vibrio anguillarum, screening method and application | |
| Köster et al. | Analytical methods for microbiological water quality testing | |
| CN112159854B (en) | Primer composition for detecting CRISPR/Cas12a of escherichia coli O157-H7 and detection method | |
| JP2010532665A (en) | Nucleic acid sequences and their combinations for sensitive amplification and detection of bacterial and fungal sepsis pathogens | |
| CN112831580B (en) | Reaction system for detecting vibrio parahaemolyticus DNA, kit and application thereof | |
| Bonadonna et al. | Innovative analytical methods for monitoring microbiological and virological water quality | |
| CN111073892A (en) | Aptamer for identifying grouper iridovirus infected cells and construction method and application thereof | |
| CN111073891B (en) | Aptamer for detecting grouper iridovirus as well as construction method and application thereof | |
| CN112094847A (en) | Aptamer for detecting helicobacter pylori, screening detection method and application | |
| KR101891406B1 (en) | DNA Aptamer Specifically Binding to Surface of Living Cell of Salmonella typhimurium and Uses Thereof | |
| US20130011831A1 (en) | Compositions And Methods For The Rapid Detection Of Legionella pneumophila | |
| CN112458090B (en) | DNAzyme for vibrio vulnificus specific recognition RNA cutting and application | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| CN113846103A (en) | Aptamer specifically combined with Gymnodinium breve toxin-A and application thereof | |
| RU2567011C2 (en) | PEPTIDE-NUCLEIC ACID PROBE, SET AND METHOD FOR DETECTION AND/OR QUANTITATIVE DETERMINATION OF Salmonella spp AND THEIR APPLICATIONS | |
| RU2511029C2 (en) | RECOMBINANT STRAIN OF Escherichia coli TG1(pRVMoscow3253G-L) FOR OBTAINING SET OF PCR-STANDARDS AND SET OF PCR-STANDARDS FOR DETERMINATION OF CONCENTRATION OF RABIES VIRUS "Moskva 3253" IN RABIES ANTIGEN | |
| Khan et al. | Molecular strategies: detection of foodborne bacterial pathogens | |
| CN111378769A (en) | Kit for detecting chlamydia pneumoniae | |
| Li et al. | Combination of direct boiling and glass beads increases the purity and accuracy of bacterial DNA extraction | |
| CN112941079B (en) | Aptamer for high-specificity detection of legionella pneumophila and detection method and application thereof | |
| CN113215166B (en) | Nucleic acid aptamer and application thereof | |
| RU2796820C1 (en) | Method of detecting a plague microbe and a set of reagents for its implementation | |
| CN110257386B (en) | Aptamer for resisting grass carp GCRV I virus as well as construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |