CN109161547B - Nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus - Google Patents
Nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus Download PDFInfo
- Publication number
- CN109161547B CN109161547B CN201811099369.7A CN201811099369A CN109161547B CN 109161547 B CN109161547 B CN 109161547B CN 201811099369 A CN201811099369 A CN 201811099369A CN 109161547 B CN109161547 B CN 109161547B
- Authority
- CN
- China
- Prior art keywords
- vibrio alginolyticus
- ssdna aptamer
- aptamer
- ssdna
- pathogenic vibrio
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
Abstract
The invention discloses a ssDNA aptamer and application thereof in pathogenic vibrio alginolyticus, wherein the nucleotide sequence of the ssDNA aptamer is 5'-GACGCTTACTCAGGTGTGACTCGCGTTTTATTGGTGTGGGGCTGGGGCGGTGGGTGGCTCTACTGGTTCCGTTCGAAGGACGCAGATGAAGTCTC-3' (SEQ ID No: 1). The ssDNA aptamer has specificity and high sensitivity to pathogenic vibrio alginolyticus of trachinotus ovatus, and has no immunogenicity. The ssDNA aptamer has a stable structure, is easy to modify, is convenient to synthesize and store, and can be used for quickly and accurately detecting and diagnosing trachinotus ovatus-derived pathogenic vibrio alginolyticus.
Description
Technical Field
The invention relates to a ssDNA aptamer, a screening method, a detection method and application thereof, in particular to a ssDNA aptamer and application thereof in detection of pathogenic vibrio alginolyticus.
Background
As a big country for aquaculture, the aquaculture amount accounts for 70 percent of the total aquaculture amount of aquatic products in the world. However, the outbreak and prevalence of bacterial pathogens in recent years have caused huge economic losses to the aquaculture industry in our country. In coastal areas of south China such as Guangxi, vibrio alginolyticus is one of main pathogenic bacteria causing marine cultured fishes to generate bacterial fish diseases, and the fish diseases caused by the vibrio alginolyticus are rapid in onset, high in death rate and wide in prevalence range, and have serious threats to the development of aquaculture industry in south China. At present, the fish bacterial diseases are internationally diagnosed mainly by a traditional observation method, an immunological detection method, a molecular biological technology and the like. However, these methods have the problems of complicated operation, long time consumption, expensive instrument and reagent, low accuracy and the like, and can not rapidly and accurately detect and diagnose vibrio alginolyticus on site. Therefore, a rapid detection technology for pathogenic bacteria of aquatic organisms, which is convenient to operate, low in cost, short in time consumption and high in accuracy, is developed, and is important for discovering and determining the pathogens as soon as possible and further purposefully making a treatment scheme to control pathogen diffusion and reduce loss.
The Exponential Enrichment of ligand phylogenetic technology (SELEX), a biological library screening technique using volumes as high as 1014-1015The random oligonucleotide library of (a) is subjected to multiple rounds of screening in vitro to finally obtain a single-stranded oligonucleotide, i.e., an aptamer, capable of specifically recognizing the target substance. The aptamer has the advantages of easy screening and obtaining, low cost, easy modification, strong stability, high specificity identification, target substance combination and the like, is developed into a novel detection and treatment tool which is widely concerned at present, and has wide application prospect in the fields of biomedical basic research of major diseases and disease diagnosis.
Disclosure of Invention
The invention aims to provide a ssDNA aptamer for detecting pathogenic vibrio alginolyticus, which has high specificity, high sensitivity, no immunogenicity, stability and easy modification and is convenient to synthesize and store, so as to at least solve the problem that the existing biological detection technology can not quickly and accurately detect and diagnose the pathogenic vibrio alginolyticus on site.
The invention aims to provide a ssDNA aptamer capable of specifically recognizing Vibrio alginolyticus, wherein the nucleotide sequence of the ssDNA aptamer is 5'-GACGCTTACTCAGGTGTGACTCGCGTTTTATTGGTGTGGGGCTGGGGCGGTGGGTGGCTCTACTGGTTCCGTTCGAAGGACGCAGATGAAGTCTC-3' (SEQ ID No: 1).
Further, the nucleotide sequence of the ssDNA aptamer is SEQ ID NO: 1.
further, any position on the nucleotide sequence of the ssDNA aptamer can undergo phosphorylation, sulfhydrylation, methylation, amination or isotopic reaction.
Further, a marker is bound to the nucleotide sequence of the ssDNA aptamer.
Still further, the label is selected from one or more of biotin, enzyme, and a luminescent group.
Still further, the luminescent group is selected from one or more of fluorescein isothiocyanate, carboxytetramethylrhodamine and hydroxyfluorescein.
Another object of the present invention is to provide a method for screening ssDNA aptamers, comprising the steps of:
step 1: synthesizing a single-stranded DNA library and primers shown in the following sequences:
random Library 50:
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC；
5' primer: 5 '-FAM-GACGCTTACTCAGGTGTGACTCG-3';
3' primer: 5 '-Biotin-GAGACTTCATCTGCGTCCTTCG-3';
step 2: dissolving 10nmol of the random library in 500 μ l PBS, performing constant-temperature water bath at 92 ℃ for 5min, rapidly performing ice bath for 10min, and incubating the treated random library and Vibrio alginolyticus viable bacteria on ice for 1 h; after incubation and combination are finished, centrifuging and removing supernatant, taking 10mL PBS to wash live vibrio alginolyticus, carrying out constant-temperature water bath for 10min at 92 ℃, centrifuging for 1-20min under the condition of 12000g, and collecting supernatant, wherein the supernatant is a ssDNA aptamer library for specifically identifying vibrio alginolyticus;
and step 3: taking 100ul of ssDNA aptamer library for identifying vibrio alginolyticus obtained by screening to perform PCR amplification, wherein the specific amplification strip program is as follows: 5min at 94 ℃, 1min at 94 ℃, 30sec at 56 ℃, 1min at 72 ℃, 5min at 72 ℃ after 20 cycles of circulation;
and 4, step 4: incubating 100 mu l of streptavidin-labeled magnetic beads and the double-stranded DNA obtained by amplification in the step (3) for 20min at normal temperature, sucking the magnetic beads by using a magnetic separator and removing a supernatant, washing the magnetic beads by using 2mL of PBS, adding 200 mu l of 200mM NaOH solution, reacting for 10min at normal temperature, recovering the magnetic beads by using a magnetic separation frame, and keeping a supernatant;
and 5: adding the supernatant obtained in the step (4) into sterile water, washing, then carrying out salt separation by a desalting column, naturally dripping under the action of gravity, and adding 500 mu l of PBS into the collected liquid to obtain a solution containing the DNA single-strand library;
step 6: replacing the random library in the step 2 with the DNA single-stranded library obtained in the step 5, and repeating the step 2-5 for 8 times;
and 7: heating the DNA library in the step 6 in a constant-temperature water bath at 92 ℃ for 5min, then rapidly carrying out ice bath for 10min, and taking the solution of the treated DNA single-stranded library and aeromonas hydrophila to incubate for 1h on ice; after the incubation and combination are finished, centrifuging and collecting supernatant, and incubating the supernatant solution and the live vibrio alginolyticus bacteria on ice for 0.5-2 h; after incubation and combination are completed, centrifuging to remove supernatant, taking 10mL PBS to wash live vibrio alginolyticus, carrying out constant-temperature water bath for 10min at 92 ℃, centrifuging for 1-20min under the condition of 12000g, and collecting supernatant, wherein the supernatant is a negatively screened ssDNA aptamer library for high-specificity identification of vibrio alginolyticus;
and 8: and (3) taking the supernatant solution obtained in the step (7), and repeating the experimental operation sequence of the step (3), the step (4), the step (5), the step (7), the step (2), the step (3), the step (4) and the step (5) for 8 times in sequence, wherein the finally obtained solution is the ssDNA aptamer.
Another object of the present invention is to provide a method for rapidly detecting pathogenic vibrio Alginolyticus (AFMP) using the ssDNA aptamer, comprising the steps of:
step 1: biotin labeling the ssDNA aptamer;
step 2: mixing 1-100mg of a sample to be detected with the ssDNA aptamer with the concentration of 100-; after incubation and combination, washing a sample to be detected, uniformly mixing the sample to be detected in 200 mu l of PBS solution, detecting by using a flow cytometer, and detecting whether pathogenic vibrio alginolyticus exists in the sample to be detected according to the change of a fluorescence value.
The invention also aims to provide the application of the ssDNA aptamer in detecting pathogenic vibrio alginolyticus.
Compared with the existing protein antibody, the aptamer obtained by screening through the SELEX technology has higher affinity and specificity, and has the characteristics that the protein antibody does not have, including no immunogenicity; the preparation period is short, and the reproducibility is good; the molecular weight is small, and the in vitro chemical synthesis is convenient; the marking is convenient; the different parts of the nucleic acid aptamer are easy to modify and replace; the sequence is stable and easy to transport and store, etc. When the rapid detection method of pathogenic vibrio alginolyticus based on the aptamer is used for detecting the vibrio alginolyticus, the operation is simple and rapid, and the method can be used for developing a related rapid detection kit. The method has important significance for the rapid detection of the vibrio alginolyticus, and has good application prospect in the field of detection of aquatic pathogenic bacteria vibrio alginolyticus.
Drawings
FIG. 1 is a graph comparing fluorescence intensity detected by flow cytometry for ssDNA aptamers in example 1 of the present invention;
FIG. 2 is a graph showing the comparison of the binding of ssDNA aptamers to Vibrio harveyi, Vibrio vulnificus, Vibrio cholerae, Aeromonas hydrophila, Aeromonas veronii and Vibrio alginolyticus, respectively, in example 1 of the present invention;
FIG. 3 is a diagram showing the results of detection of four different strains of Vibrio alginolyticus (TOQZ01, TOQZ02, TOQZ03, TOQZ04) and Vibrio harveyi in example 2 of the present invention by ssDNA aptamers.
Detailed Description
In order to make the technical solutions of the present invention better understood by those skilled in the art, the technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments.
Example 1
Example 1 preparation of ssDNA aptamers is as follows:
step 1: synthesis of random Single-stranded DNA libraries and primers shown in the following sequence
Random Library 50:
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC；
5' primer: 5 '-FAM-GACGCTTACTCAGGTGTGACTCG-3';
3' primer: 5 '-Biotin-GAGACTTCATCTGCGTCCTTCG-3';
step 2: dissolving 10nmol of the random library in 500 μ l PBS, performing constant-temperature water bath at 92 ℃ for 5min, then rapidly inserting into ice, performing ice bath for 10min, and incubating the treated random library and Vibrio alginolyticus viable bacteria on the ice for 1 h; after incubation and combination are finished, centrifuging to remove supernatant, washing live vibrio alginolyticus bacteria by using 10mL PBS, carrying out constant-temperature water bath at 92 ℃ for 10min, and centrifuging 12000g to collect supernatant, namely a nucleic acid aptamer library for specifically identifying vibrio alginolyticus;
and step 3: taking 100ul of the screened aptamer library for identifying the vibrio alginolyticus to carry out PCR amplification, wherein the specific amplification strip program comprises the following steps: 5min at 94 ℃, 1min at 94 ℃, 30sec at 56 ℃, 1min at 72 ℃ and 5min at 72 ℃ after 20 cycles. All supernatants obtained after the first round of screening are used for PCR amplification to obtain amplification products;
and 4, step 4: incubating 100 mu l of streptavidin-labeled magnetic beads and the double-stranded DNA obtained by PCR amplification in the step 3 for 20min at normal temperature, binding the double-stranded DNA to the surfaces of the magnetic beads by utilizing the affinity action of biotin on the double-stranded DNA and the streptavidin on the magnetic beads, removing supernatant by utilizing a magnetic separator, washing the magnetic beads by using 2mL of PBS, adding 200ul of NaOH solution (200mM) into an EP (ultraviolet) tube, reacting for 10min at normal temperature, and recovering by utilizing a magnetic separation frame to obtain supernatant; after the desalting column was washed with 10mL of sterile water, the supernatant was added to the desalting column and allowed to drip naturally under the action of gravity. Adding 500. mu.l PBS, and collecting the solution containing the DNA single-stranded library;
and 5: replacing the random library in the step (2) with the DNA single-stranded library obtained in the step (4), and repeating the positive screening process, the PCR amplification and the single-stranded DNA library preparation process shown in the step (2-4) for 8 times;
step 6: and 5, in the second round and the subsequent rounds of screening, using aeromonas hydrophila as a contrast, and carrying out negative screening on the DNA single-stranded library obtained by screening after the step 5 so as to improve the screening efficiency. The specific negative screening process is as follows: dissolving the screened DNA library, incubating with viable aeromonas hydrophila for 1h on ice after water bath at the constant temperature of 92 ℃ and ice bath, and centrifugally collecting a supernatant solution after incubation is finished; then the supernatant solution and the live vibrio alginolyticus bacteria are combined in an ice bath; after incubation and combination are finished, centrifuging to remove supernatant, washing live vibrio alginolyticus bacteria by using 10mL PBS, carrying out constant-temperature water bath at 92 ℃ for 10min, centrifuging 12000g to collect supernatant, wherein the collected supernatant is a negative screened aptamer library for high-specificity identification of vibrio alginolyticus;
and 7: and (3) performing PCR amplification on the supernatant solution collected in the step (6) and preparation of the single-stranded DNA library in the step (4), sequentially repeating the steps of the step (6), the step (2), the step (3) and the step (4), detecting the enhancement condition of the obtained library on the vibrio alginolyticus identification capacity by using a flow cytometer, and obtaining the strongest vibrio alginolyticus identification capacity of the library after 8 rounds of screening. After the obtained amplification product is subjected to clone sequencing analysis, the ssDNA aptamer with the sequence of 5'-GACGCTTACTCAGGTGTGACTCGCGTTTTATTGGTGTGGGGCTGGGGCGGTGGGTGGCTCTACTGGTTCCGTTCGAAGGACGCAGATGAAGTCTC-3' (SEQ ID NO:1) which can be used for detecting the vibrio alginolyticus in the embodiment is finally obtained.
Example 1 AFMP detection method for ssDNA aptamers as follows:
step 1: biotin labeling of the ssDNA aptamer of example 1;
step 2: 200nM of hydroxyl Fluorescein (FAM) -labeled screening libraries at round 1, round 3, round 5, round 6, round 7, round 8 and round 9 were dissolved in 500. mu.l PBS, incubated with Vibrio alginolyticus viable bacteria on ice for 40min, centrifuged at 1000g to remove supernatant, centrifuged and washed three times with 10mLPBS, and finally Vibrio alginolyticus was mixed in 200. mu.l PBS for 50000 cells detected by flow cytometry. And detecting the pathogenic vibrio alginolyticus from the trachinotus ovatus according to the change of the fluorescence value. As shown in FIG. 1, 1st, 3rd, 5th, 6th, 7th, 8th and 9th represent the binding of the flow cytometer library for detecting binding of the pathogenic trachinotus ovatus-derived pathogenic vibrio alginolyticus with hydroxyfluorescein (FAM) labeled 1st, 3rd, 5th, 6th, 7th, 8th and 9th, respectively, in example 1.
Example 2
The procedure of example 1 was followed to construct a peptide based on SEQ ID NO:1 nucleic acid aptamer, namely a rapid detection method (AFMP) for pathogenic vibrio alginolyticus from trachinotus ovatus, and 4 different vibrio alginolyticus strains.
As shown in FIG. 3, the above rapid detection method (AFMP) can specifically recognize four different Vibrio alginolyticus strains (TOQZ01, TOQZ02, TOQZ03, TOQZ04), while no significant recognition of the control group of Vibrio harveyi occurred.
Example 3
And (3) taking the ssDNA aptamer obtained in the example 1, and assembling an AFMP kit to form the AFMP detection kit for diagnosing whether the fish is infected by vibrio alginolyticus.
Based on the results shown in fig. 1, 2 and 3, it can be proved that the ssDNA aptamer shown in example 1 of the present invention can be specifically bound to vibrio alginolyticus after being labeled and modified by fluorescent substances or luminescent materials such as biotin, enzyme, fluorescein isothiocyanate and hydroxyfluorescein, and can be used for detecting pathogenic vibrio alginolyticus originating in trachinotus ovatus.
The ssDNA aptamer obtained by SELEX screening has good affinity and specificity, is stable in structure, has good affinity and specificity after group marking and modification, can be applied to an AFMP detection kit, has the characteristics of short preparation period, good reproducibility and small molecular weight compared with a protein antibody, is convenient for in vitro synthesis, and has good application prospect in the field of detection of pathogenic vibrio alginolyticus which is sourced from trachinotus ovatus.
Finally, it should be noted that the above-mentioned embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the same, and although the present invention is described in detail with reference to the above-mentioned embodiments, it should be understood by those skilled in the art that the modifications and equivalents of the specific embodiments of the present invention can be made by those skilled in the art after reading the present specification, but these modifications and variations do not depart from the scope of the claims of the present application.
SEQUENCE LISTING
<110> Guangxi academy of sciences
<120> nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus
<130> 2018
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 95
<212> DNA
<213> Artificial Synthesis
<400> 1
gacgcttact caggtgtgac tcgcgtttta ttggtgtggg gctggggcgg tgggtggctc 60
tactggttcc gttcgaagga cgcagatgaa gtctc 95
Claims (6)
1. An ssDNA aptamer, wherein the nucleotide sequence of the ssDNA aptamer is 5' -GACGCTTACTCAGGTGTGACTCGCGTTTTATTGGTGTG
GGGCTGGGGCGGTGGGTGGCTCTACTGGTTCCGTTCGAAGGACGCAGATGAAGTCTC- 3’。
2. The ssDNA aptamer of claim 1, wherein a marker is bound to the nucleotide sequence of the ssDNA aptamer.
3. The ssDNA aptamer according to claim 2, wherein the label is selected from one or more of biotin, an enzyme, and a luminescent group.
4. The ssDNA aptamer according to claim 3, wherein the luminescent group is selected from one or more of fluorescein isothiocyanate, carboxytetramethylrhodamine, hydroxyfluorescein.
5. A method for rapid detection of pathogenic vibrio alginolyticus using the ssDNA aptamer according to claim 1, comprising the steps of:
step 1: biotin labeling the ssDNA aptamer;
step 2: mixing 1-100mg of a sample to be detected with the ssDNA aptamer with the concentration of 100-; after incubation and combination, cleaning a sample to be detected, uniformly mixing the sample to be detected in 200 mu l of PBS solution, detecting by using a flow cytometer, and detecting whether pathogenic vibrio alginolyticus exists in the sample to be detected according to the change of a fluorescence value; the use does not include use in disease diagnosis.
6. Use of the ssDNA aptamer of claim 1 to detect pathogenic Vibrio alginolyticus, excluding use in disease diagnosis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811099369.7A CN109161547B (en) | 2018-09-20 | 2018-09-20 | Nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811099369.7A CN109161547B (en) | 2018-09-20 | 2018-09-20 | Nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109161547A CN109161547A (en) | 2019-01-08 |
| CN109161547B true CN109161547B (en) | 2021-11-09 |
Family
ID=64879926
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811099369.7A Active CN109161547B (en) | 2018-09-20 | 2018-09-20 | Nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109161547B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858358B (en) * | 2017-12-01 | 2020-12-08 | 广西科学院 | ssDNA nucleic acid aptamer capable of identifying and combining vibrio alginolyticus and application thereof |
| CN108034659B (en) * | 2017-12-01 | 2020-12-08 | 广西科学院 | ssDNA aptamer and application thereof in vibrio alginolyticus rapid detection |
| CN107858359B (en) * | 2017-12-01 | 2020-12-29 | 广西科学院 | Nucleic acid aptamer capable of specifically recognizing vibrio alginolyticus and application thereof |
| CN111621431B (en) * | 2019-12-25 | 2022-05-10 | 广西科学院 | Micromonospora aureofaciens with algae-lysing capability and application thereof to Karenia mikimotoi |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605075A (en) * | 2012-03-22 | 2012-07-25 | 集美大学 | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences |
| CN104789568A (en) * | 2015-03-20 | 2015-07-22 | 中国科学院南海海洋研究所 | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer |
| CN104789569A (en) * | 2015-03-20 | 2015-07-22 | 中国科学院南海海洋研究所 | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer |
| CN107858358A (en) * | 2017-12-01 | 2018-03-30 | 广西科学院 | A kind of ssDNA aptamers that can be identified and combine vibrio alginolyticus and its application |
| CN108004240A (en) * | 2017-12-01 | 2018-05-08 | 广西科学院 | SsDNA aptamer and its application of one species specificity for vibrio alginolyticus |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2223492C2 (en) * | 1998-10-09 | 2004-02-10 | Чирон Корпорейшн | Protein obtained from neisseria meningitidis (variants, its fragment, nucleic acid encoding thereof (variants), probe, primer, composition |
| US20030194702A1 (en) * | 2000-12-22 | 2003-10-16 | Engelhard Eric K. | Novel compositions and methods for cancer |
| CN102329862B (en) * | 2011-09-02 | 2013-06-05 | 集美大学 | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof |
| CN107619850A (en) * | 2017-09-08 | 2018-01-23 | 集美大学 | A kind of method of the quantitative detection vibrio alginolyticus based on aptamer |
| CN108034659B (en) * | 2017-12-01 | 2020-12-08 | 广西科学院 | ssDNA aptamer and application thereof in vibrio alginolyticus rapid detection |
-
2018
- 2018-09-20 CN CN201811099369.7A patent/CN109161547B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605075A (en) * | 2012-03-22 | 2012-07-25 | 集美大学 | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences |
| CN104789568A (en) * | 2015-03-20 | 2015-07-22 | 中国科学院南海海洋研究所 | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer |
| CN104789569A (en) * | 2015-03-20 | 2015-07-22 | 中国科学院南海海洋研究所 | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer |
| CN107858358A (en) * | 2017-12-01 | 2018-03-30 | 广西科学院 | A kind of ssDNA aptamers that can be identified and combine vibrio alginolyticus and its application |
| CN108004240A (en) * | 2017-12-01 | 2018-05-08 | 广西科学院 | SsDNA aptamer and its application of one species specificity for vibrio alginolyticus |
Non-Patent Citations (1)
| Title |
|---|
| 基于核酸适配体吸附检测技术的卵形鲳鲹源溶藻弧菌的快速检测;朱冬琳等;《广西科学院学报》;20190903;第35卷(第3期);第219-224页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109161547A (en) | 2019-01-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109161547B (en) | Nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus | |
| CN108034659B (en) | ssDNA aptamer and application thereof in vibrio alginolyticus rapid detection | |
| CN107858358B (en) | ssDNA nucleic acid aptamer capable of identifying and combining vibrio alginolyticus and application thereof | |
| CN111073892B (en) | Nucleic acid aptamer for identifying garrupa iridovirus infected cells, construction method and application thereof | |
| CN107858359B (en) | Nucleic acid aptamer capable of specifically recognizing vibrio alginolyticus and application thereof | |
| CN109055381B (en) | ssDNA nucleic acid aptamer for vibrio anguillarum specific recognition and screening and application | |
| CN113215167B (en) | Aptamer and application thereof in detecting cells infected by largemouth black bass iridovirus | |
| CN110643611A (en) | Aptamer, construction method thereof and application thereof in detection of grouper iridovirus | |
| CN104789696A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN104789569A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN104789568A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN109136229B (en) | Aptamer for specifically recognizing trachinotus ovatus-derived nervous necrosis virus and application thereof | |
| CN109207480B (en) | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof | |
| CN107937404B (en) | Nucleic acid aptamer and application thereof in identification and detection of vibrio alginolyticus | |
| KR101891406B1 (en) | DNA Aptamer Specifically Binding to Surface of Living Cell of Salmonella typhimurium and Uses Thereof | |
| CN109161548B (en) | Aptamer and application thereof in detection of trachinotus ovatus-derived nervous necrosis virus | |
| CN108004240B (en) | ssDNA nucleic acid aptamer specific to vibrio alginolyticus and application thereof | |
| CN109161546B (en) | Aptamer and application thereof in detection of trachinotus ovatus source pathogenic vibrio alginolyticus | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| CN113462693B (en) | Application of ssDNA aptamer in identifying largemouth black bass iridovirus infected cells | |
| CN111363748B (en) | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus | |
| CN111454956B (en) | Nucleic acid aptamer for Chinese soft-shelled turtle iridovirus as well as construction method and application thereof | |
| CN111363749A (en) | Aptamer for detecting Chinese softshell turtle iridovirus and construction method and application thereof | |
| CN113278621B (en) | ssDNA aptamer and application thereof in identification and detection of vibrio harveyi | |
| CN110257387B (en) | Aptamer for identifying grass carp hemorrhagic disease virus as well as construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |