CN110643611A

CN110643611A - Aptamer, construction method thereof and application thereof in detection of grouper iridovirus

Info

Publication number: CN110643611A
Application number: CN201911041817.2A
Authority: CN
Inventors: 李鹏飞; 余庆; 刘明珠; 肖贺贺; 吴思婷; 德蒂·费兹瑞恩塞亚·普察
Original assignee: GUANGXI ZHUANG AUTONOMOUS REGION INSTITUTE OF OCEANOLOGY; Guangxi Academy of Sciences
Current assignee: GUANGXI ZHUANG AUTONOMOUS REGION INSTITUTE OF OCEANOLOGY; Guangxi Academy of Sciences
Priority date: 2019-10-30
Filing date: 2019-10-30
Publication date: 2020-01-03
Anticipated expiration: 2039-10-30
Also published as: CN110643611B

Abstract

An aptamer comprising the nucleotide sequence: GGTGGCATTAGTGATCTAAAAAGGAACTATACATTGGGGAGGATGGTTGC are provided. The aptamer provided by the invention has the advantages of small molecular weight, short preparation period, good reproducibility, convenience for in-vitro chemical synthesis and marking, and stable sequence and easiness in transportation and storage. The aptamer has high specificity and affinity to the grouper iridovirus, and has no immunogenicity.

Description

Aptamer, construction method thereof and application thereof in detection of grouper iridovirus

Technical Field

The invention belongs to the technical field of aquatic pathogen detection, and particularly relates to a nucleic acid aptamer, a construction method thereof and application thereof in detection of grouper iridovirus.

Background

The development of the ocean economy is promoted by the force of marching towards the ocean, and the important strategy of China is developed. Guangxi is an international transportation hub connected with the east Union, is adjacent to the main consumer market of marine products such as southeast Asia and the like, and the mariculture industry is rapidly developed in recent years. The grouper has fine and smooth meat quality and rich nutrition, is used as a large and rare mariculture fish, the annual output of the grouper culture in China currently reaches over 13 million tons, the direct industrial output value exceeds billion yuan, and the economic value is extremely high. However, with the increase of the culture density and the expansion of the culture scale of the groupers, the offshore culture environment tends to be poor, and the increasingly poor culture water area environment causes frequent outbreaks of various diseases, thereby causing huge economic loss. Among them, grouper iridovirus is the main viral pathogen causing the disease of groupers, and the fish disease fatality rate caused by the virus is extremely high, which is called as 'marine foot-and-mouth disease'. At present, systematic research on the grouper iridovirus is carried out internationally, mainly comprises epidemiological investigation, pathogen separation and identification, sensitive cell line construction, virus ultrastructure observation, virus diagnosis technology development and the like, and the infection and pathogenic mechanism of the grouper iridovirus are disclosed to a certain extent. Suspected iridovirus disease of grouper occurs in pond-cultured grouper in northern sea area of Guangxi in 2018, and the iridovirus disease of grouper (SGIV) is proved to be a main pathogenic pathogen by analyzing and identifying pathogenic microorganisms in diseased grouper through Polymerase Chain Reaction (PCR) detection technology. Therefore, the research and development of the detection technology with convenient operation, low cost, short time consumption and high accuracy is extremely important for controlling the damage of the SGIV virus of the grouper. However, the current diagnosis method aiming at the grouper SGIV virus mainly comprises a common PCR technology, a nested PCR technology, a fluorescent quantitative PCR technology and the like. The detection result of the PCR technology is accurate and reliable, but the PCR technology has the defects of complex operation, long time consumption, expensive instrument and reagent and the like, and can not meet the requirement of rapid and accurate detection and diagnosis on site. Therefore, the technology and the functional product for quickly detecting the SGIV virus of the grouper on the culture site are developed, are convenient to operate, low in cost, short in time consumption and high in accuracy, and are important for finding and determining the pathogen as soon as possible and further purposefully making a treatment scheme to control pathogen diffusion and reduce loss.

The aptamer is a single-stranded oligonucleotide capable of specifically recognizing a target substance, which is obtained by in vitro multiple rounds of screening from an artificially synthesized random sequence library by using an Exponential Enrichment ligand phylogenetic technology (SELEX). The aptamer has the advantages of high specificity, high affinity, strong stability, easy chemical synthesis and chemical modification and the like. Based on the characteristic that the aptamer can recognize pathogenic microorganisms or pathological cells with high specificity, the aptamer is widely used for constructing biosensors, and accurate detection and diagnosis of pathogeny or diseases are realized through signal amplification and the like. At present, the aptamer serving as a novel and widely-focused novel detection and treatment tool has wide application prospects in the fields of human medical research, disease diagnosis, virus infection mechanism research and the like.

Disclosure of Invention

The invention aims to provide an aptamer, a construction method thereof and application thereof in detection of grouper iridovirus, so as to realize high-sensitivity and high-specificity detection of the grouper iridovirus.

According to one aspect of the present application, there is provided an aptamer comprising the nucleotide sequence of SEQ ID No. 1.

Preferably, it comprises the nucleotide sequence of SEQ ID NO. 2.

Preferably, at least one nucleotide in its nucleotide sequence is phosphorylated, thiolated, methylated, aminated, or isotopically esterified.

Preferably, the kit further comprises a sequence for coding a marker, wherein the marker is selected from one or more of luminescent substances, biotin or enzymes.

Preferably, the marker is a luminescent substance, and the luminescent substance is one or more selected from hydroxyl fluorescein, fluorescein isothiocyanate or carboxytetramethyl rhodamine.

According to another aspect of the present invention, there is provided a method for constructing the above aptamer using SELEX technology, comprising the steps of: (1) establishing a single-stranded DNA random Library50, wherein the nucleotide sequence of the single-stranded DNA random Library50 is as follows:

5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC；

(2) screening a single-stranded DNA random Library50 by using a grouper somatic cell infected with the grouper iridovirus to obtain a specific DNA Library of the grouper iridovirus; (3) and (2) carrying out PCR amplification by taking the specific DNA library as a template, wherein a 5 'end primer adopted by the PCR amplification comprises a nucleotide sequence of SEQ ID NO.3, and a 3' end primer adopted by the PCR amplification comprises a nucleotide sequence of SEQ ID NO. 4.

Preferably, the amplification procedure for PCR amplification is: 5 minutes at 94 ℃, 1 minute at 94 ℃, 30 seconds at 56 ℃, 1 minute at 72 ℃ and 25 cycles; 5 minutes at 72 ℃.

According to another aspect of the present invention, there is provided the use of the aptamer described above for detecting Epinephelus iridovirus.

According to another aspect of the invention, a fluorescent molecular detection probe for grouper iridovirus is provided: the aptamer is included, and the marker is hydroxyfluorescein.

Compared with the existing protein antibody, the aptamer provided by the invention has the advantages of small molecular weight, no immunogenicity, short preparation period, good reproducibility and the like, and is convenient for in vitro chemical synthesis; moreover, the aptamer has high stability and is easy to transport and store; in addition, the aptamer is convenient to label, and different parts of the aptamer are easy to modify and replace. Compared with the existing protein antibody, the invention adopts SELEX technology in the process of constructing the aptamer, so that the obtained aptamer has higher affinity and specificity to the grouper iridovirus; in particular, the aptamer provided by the invention is partially substituted or modified to obtain the aptamer derivative, and the aptamer derivative can be used for detecting the SGIV virus of the grouper as long as the aptamer derivative has the molecular structure, the physicochemical property and the function which are basically the same as or similar to those of the original aptamer. The nucleotide sequences of the aptamer and the derivative thereof provided by the invention are provided with marker sequences, and the high-efficiency detection of the grouper iridovirus can be realized by simple and rapid operation in combination with corresponding detection means.

Drawings

FIG. 1 is a diagram showing the prediction of the secondary structure of an aptamer having the nucleotide sequence of SEQ ID NO. 2;

FIG. 2 shows the FAM fluorescence value test results of the samples measured by the flow cytometer in example 2;

FIG. 3 shows the observation results of the laser scanning confocal microscope in example 2: (a) a light mirror image of a test group sample, (b) a fluorescence image of the test group sample, (c) a superimposed effect image of the (a) image and the (b) image, (d) a light mirror image of a control group sample, (e) a fluorescence image of the control group sample, and (f) a superimposed effect image of the (d) image and the (e) image.

Detailed Description

In order to make the technical solutions of the present invention better understood by those skilled in the art, the technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments.

Example 1 screening and preparation of aptamers for detection of Epinephelus iridovirus

S1, construction of random single-stranded DNA (ssDNA) library and synthesis of primers

Constructing a random ssDNA Library50, wherein two ends are fixed sequences, the middle 50 nucleotides are random sequences, and the nucleotide sequences are as follows:

5' -GACGCTTACTCAGGTGTGACTCG (50N) CGAAGGACGCAGATGAAGTCTC. The sequences of the 5' end primers used were as follows: 5 ' -FAM-GACGCTTACTCAGGTGTGACTCG-3 ', the 3 ' end primer used has the following sequence: 5 '-Biotin-GAGACTTCATCTGCGTCCTTCG-3'. Both random ssDNA libraries and primers were synthesized by Shanghai Biotechnology, Inc.

S2.SELEX screening (corresponding to positive screening)

10nmol of the random ssDNA library is dissolved in 500 muL PBS, and is subjected to thermostatic water bath at 92 ℃ for 5min, then is quickly inserted into ice, and is subjected to ice bath for 10min, and the treated random ssDNA library and SGIV virus-infected splenocytes of grouper are incubated on ice for 1 h.

After the incubation and combination are completed, the supernatant is removed by centrifugation, 10mL of spleen cells of the grouper infected by the SGIV virus are washed by PBS, the spleen cells are subjected to constant-temperature water bath at 92 ℃ for 10min, and the supernatant is collected by centrifugation at 12000g, namely the ssDNA nucleic acid library for specifically identifying the cells of the grouper infected by the SGIV virus.

S3.PCR amplification

100 mu L of ssDNA library obtained by screening and identifying SGIV virus infected cells is taken and subjected to PCR amplification with a 5 'end primer and a 3' end primer. The PCR reaction system was as follows (1000. mu.L): 10 XBuffer 100 uL, dNTP Mix (2.5mM)80 uL, 5 'primer 40 uL, 3' primer 40 uL, ssDNA library 100 uL, rTaq enzyme 12.5 uL, ddH₂O627.5 μ L. The PCR amplification procedure was: 5min at 94 ℃, 1min at 94 ℃, 30sec at 56 ℃ and 1min at 72 ℃ after 25 cycles; 5min at 72 ℃. The supernatants obtained after the first round of SELEX screening were all used for PCR amplification to obtain a double stranded nucleic acid (dsDNA) library.

S4. preparation of ssDNA library

Incubating 100 mu L of streptavidin-labeled magnetic beads and a dsDNA library prepared from S3 for 20min at normal temperature, utilizing the affinity action of biotin on the dsDNA and streptavidin on the magnetic beads to bond the dsDNA to the surfaces of the magnetic beads, removing supernatant by utilizing a magnetic separator, washing the magnetic beads by using 2mL of PBS, then adding 200 mu L of NaOH solution (200mM) into an EP tube, reacting for 10min at normal temperature to denature and melt the dsDNA, leaving one chain with the biotin bonded with the streptavidin on the magnetic beads, and recovering the supernatant by utilizing a magnetic separation rack after the reaction is finished; adding the supernatant into a desalting column washed by sterile water, and naturally dripping under the action of gravity. To the filtrate was added 500. mu.L of PBS and the solution containing the ssDNA library was collected for the next round of screening.

S5. iterative screening of ssDNA libraries

The SELEX screening, PCR amplification and ssDNA library preparation procedures shown in S2-S4 were repeated 10 times using the ssDNA library obtained in S4 instead of the random ssDNA library in S2.

S6. negative screening

And (3) dissolving the ssDNA library obtained by the second round of S5 and the subsequent round of screening, performing constant-temperature water bath at 92 ℃, incubating the ssDNA library and normal cells of the grouper on ice for 1h, and centrifugally collecting supernatant solution after incubation, wherein the supernatant solution is the ssDNA library subjected to negative screening.

In the step, normal cells of the grouper are used as a control, and the ssDNA library obtained by screening after S5 is subjected to negative screening so as to improve the screening efficiency of the ssDNA library.

S7.11 round of screening

And (3) performing PCR amplification on the supernatant collected in S6 and preparation of an ssDNA library of S4 through S3, sequentially repeating the processes of S6, S2, S3 and S4, detecting the change condition of the recognition capability of the obtained ssDNA library on SGIV virus infected cells through a flow cytometer, and repeating 11 rounds of screening, wherein the recognition capability of the obtained ssDNA library on the SGIV virus infected cells is strongest. And (3) after the obtained amplification product is subjected to clone sequencing analysis, finally obtaining the ssDNA aptamer for detecting SGIV virus infected cells, wherein the nucleotide sequence of the ssDNA aptamer is as follows:

GGTGGCATTAGTGATCTAAAAAGGAACTATACATTGGGGAGGATGGTTGC(SEQ ID NO.1)，

or the like, or, alternatively,

GACGCTTACTCAGGTGTGACTCGGGTGGCATTAGTGATCTAAAAAGGAACTATACATTGGGGAGGATGGTTGCCGAAGGACGCAGATGAAGTCTC(SEQ ID NO.2)。

MFOLD software (http:// MFOLD. rna. albany. edu/? q ═ MFOLD/DNA-Folding-Form) is used for predicting the secondary structure of the aptamer with the nucleotide sequence of SEQ ID NO.2 on line, and the prediction result is shown in FIG. 1, the aptamer forms a special stem-loop structure and a hairpin structure, the Gibbs free energy (delta G) of the aptamer is-18.54. similarly, the ssDNA aptamer with the nucleotide sequence of SEQ ID NO.1 also forms a special stem-loop structure and a hairpin structure.

Example 2

2.1 Main Instrument

Attune NxT flow cytometer (seemer feishell technology), FV3000 laser scanning confocal microscope

(olympus).

2.2 Experimental procedures

The aptamers of SEQ ID NO.2 constructed in example 1 were labeled with hydroxyfluorescein (FAM), respectively.

Test groups: 10nmol of FAM-labeled SEQ ID NO.2 aptamer is put in 500 mu L PBS and is put in thermostatic water bath at 92 ℃ for 5min, then the mixture is quickly inserted into ice and is subjected to ice bath for 10min, the treated FAM-labeled SEQ ID NO.2 aptamer and SGIV virus-infected grouper splenocytes are incubated on the ice for 1h, and after the incubation and combination are completed, the supernatant is removed by centrifugation.

Control group: 10nmol of FAM-labeled SEQ ID NO.2 aptamer is put in 500 mu L PBS, water bath is carried out at constant temperature of 92 ℃ for 5min, then the mixture is quickly inserted into ice and is subjected to ice bath for 10min, the treated FAM-labeled SEQ ID NO.2 aptamer and normal grouper spleen cells are incubated on the ice for 1h, and after incubation and combination are completed, the supernatant is removed by centrifugation.

Cell precipitates obtained by incubation of the test group and the control group are detected by using a flow cytometer and a laser scanning confocal microscope respectively.

2.3 results of the experiment

The detection result of the flow cytometer is shown in fig. 2, compared with the fluorescence value of the surface of the spleen cell of the normal grouper detected by the flow cytometer in the control group, the fluorescence value of the surface of the spleen cell of the grouper infected by the SGIV virus detected by the flow cytometer in the test group is obviously increased, namely, the FAM-labeled SEQ ID No.2 aptamer has high specific recognition capability on the SGIV virus infected cell.

The detection result of the confocal laser scanning microscope is shown in fig. 3, and the result proves that compared with the normal cells in the control group, the fluorescent effect of the SGIV virus infected cells in the test group is obvious, and the cell samples in the test group emit strong green light. The FAM-labeled SEQ ID NO.2 aptamer is obviously bound on the surface of spleen cells of SGIV virus-infected grouper, namely the FAM-labeled SEQ ID NO.2 aptamer has high specific recognition capability on SGIV virus-infected cells.

Although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the true spirit and scope of the present invention.

SEQUENCE LISTING

<110> Guangxi academy of sciences

<120> aptamer, construction method thereof and application thereof in detection of grouper iridovirus

<130>

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 50

<212> DNA

<213> Artificial sequence

<400> 1

ggtggcatta gtgatctaaa aaggaactat acattgggga ggatggttgc 50

<210> 2

<211> 95

<212> DNA

<213> Artificial sequence

<400> 2

gacgcttact caggtgtgac tcgggtggca ttagtgatct aaaaaggaac tatacattgg 60

ggaggatggt tgccgaagga cgcagatgaa gtctc 95

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence

<400> 3

gacgcttact caggtgtgac tcg 23

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<400> 4

gagacttcat ctgcgtcctt cg 22

Claims

1. An aptamer, characterized in that: comprises the nucleotide sequence of SEQ ID NO. 1.

2. The aptamer according to claim 1, wherein: comprises the nucleotide sequence of SEQ ID NO. 2.

3. The aptamer according to claim 1, wherein: at least one nucleotide of the nucleotide sequence is phosphorylated, thiolated, methylated, aminated, or isotopically substituted.

4. The aptamer according to claim 2, wherein: at least one nucleotide of the nucleotide sequence is phosphorylated, thiolated, methylated, aminated, or isotopically substituted.

5. The aptamer according to any one of claims 1 to 4, wherein: also comprises a sequence for coding a marker, wherein the marker is selected from one or more than one of luminescent substances, biotin or enzymes.

6. The aptamer according to claim 5, wherein: the marker is a luminescent substance, and the luminescent substance is one or more than one of hydroxyl fluorescein, fluorescein isothiocyanate or carboxyl tetramethyl rhodamine.

7. A method for constructing an aptamer according to any of claims 1 or 2, wherein the SELEX technique is used, comprising the steps of:

(1) establishing a single-stranded DNA random Library50, wherein the nucleotide sequence of the single-stranded DNA random Library50 is as follows:

5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC；

(2) screening the single-stranded DNA random Library50 by using the grouper somatic cells infected with the grouper iridovirus to obtain a specific DNA Library of the grouper iridovirus;

(3) and carrying out PCR amplification by taking the specific DNA library as a template, wherein a 5 'end primer adopted by the PCR amplification comprises a nucleotide sequence of SEQ ID NO.3, and a 3' end primer adopted by the PCR amplification comprises a nucleotide sequence of SEQ ID NO. 4.

8. The method for constructing an aptamer according to claim 7, wherein the amplification procedure of the PCR amplification is:

5 minutes at 94 ℃, 1 minute at 94 ℃, 30 seconds at 56 ℃, 1 minute at 72 ℃ and 25 cycles; 5 minutes at 72 ℃.

9. Use of the aptamer according to any one of claims 1 to 4 for detecting grouper iridovirus.

10. A fluorescent molecular detection probe for grouper iridovirus is characterized in that: comprising the aptamer according to claim 6, wherein the marker is hydroxyfluorescein.