CN109207480B - Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof - Google Patents
Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof Download PDFInfo
- Publication number
- CN109207480B CN109207480B CN201811123360.5A CN201811123360A CN109207480B CN 109207480 B CN109207480 B CN 109207480B CN 201811123360 A CN201811123360 A CN 201811123360A CN 109207480 B CN109207480 B CN 109207480B
- Authority
- CN
- China
- Prior art keywords
- necrosis virus
- trachinotus ovatus
- library
- aptamer
- nervous necrosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
Abstract
The invention discloses a ssDNA aptamer specific to trachinotus ovatus neuronecrosis virus and application thereof, wherein the nucleotide sequence of the ssDNA aptamer is 5'-GTCTGAAGTAGACGCAGGAGAACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCACAGTCACACCTGAGTAAGCGT-3' (SEQ ID NO:1) or 5'-AACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCAC-3' (SEQ ID NO: 2). The ssDNA aptamer has specificity and high sensitivity to trachinotus ovatus derived nervous necrosis virus infected cells, and has no immunogenicity. The ssDNA aptamer has high specificity, high affinity, no cytotoxicity, stability, easy modification, and convenient synthesis and preservation, and can be used for rapidly and accurately detecting and diagnosing trachinotus ovatus-derived nervous necrosis virus infected cells.
Description
Technical Field
The invention relates to a ssDNA aptamer, a screening method, a detection method and application thereof, in particular to a nucleic acid aptamer specifically aiming at trachinotus ovatus nervous necrosis virus and application thereof.
Background
As a big country for aquaculture, the aquaculture amount accounts for 70 percent of the total aquaculture amount of aquatic products in the world. Guangxi is a big province of aquaculture in China, and the main cultured species comprise trachinotus ovatus, grass carp, channel catfish, grouper, prawn, oyster, pinctada martensii and various edible plants. However, with the acceleration of the urbanization, industrialization and large-scale cultivation process, the Guangxi aquaculture environment is increasingly deteriorated, various diseases are frequently outbreak, and huge economic losses are caused. Toxic nervous necrosis fish disease caused by outbreak of Trachinotus ovatus cultured in offshore cages in northern sea of Guangxi in 2017 is obtained by identifying pathogenic microorganisms in the diseased Trachinotus ovatus, separating and obtaining the Trachinotus ovatus-derived nervous necrosis virus, and naming the virus as Guingxi Trachinostus Ovatus Nervous Necrosris Virus (GTONNV). It is reported that. The neuronecrosis virus can cause the vacuolation of brain tissue and retina tissue cells of eyes of fishes, and particularly has great harm to larval fishes and juvenile fishes in the production period of seedlings, the outbreak speed is high, and the fatality rate is as high as 95-100%. According to the disease prevention and control principle of 'prevention is mainly performed and prevention and control are combined', high-efficiency prevention and control measures are rapidly and purposefully implemented through rapid detection and accurate diagnosis at the early stage of nervous necrosis virus infection, and the method is of great importance for controlling large-scale outbreak and epidemic of viruses. However, the current diagnostic methods for the fish nervous necrosis virus mainly include Polymerase Chain Reaction (PCR) detection and the like. The PCR detection result is accurate and reliable, but the defects of complex operation, long time consumption, expensive instrument and reagent and the like exist, and the requirement of rapid and accurate detection and diagnosis on site cannot be met. Therefore, the rapid detection technology for the trachinotus ovatus-derived nervous necrosis virus, which is convenient to operate, low in cost, short in time consumption and high in accuracy and can be used for a culture site, is important for discovering and determining pathogens as soon as possible and further purposefully making a treatment scheme to control pathogen diffusion and reduce loss.
The Exponential Enrichment of Ligands by Evolution technology (SELEX) is a biological library screening technology, which uses random oligonucleotide library with volume up to 1014-. The aptamer has the advantages of easy screening and obtaining, low cost, easy modification, strong stability, high specificity identification, target substance combination and the like, is developed into a novel detection and treatment tool which is widely concerned at present, and has wide application prospect in the fields of biomedical basic research of major diseases and disease diagnosis.
Disclosure of Invention
The invention aims to provide a ssDNA aptamer for detecting trachinotus ovatus-derived nervous necrosis virus, which has high specificity, high sensitivity, no immunogenicity, stability, easy modification and convenient synthesis and storage, and at least solves the problem that the existing biological detection technology cannot accurately detect and diagnose the trachinotus ovatus-derived nervous necrosis virus on site.
The invention aims to provide a ssDNA aptamer capable of specifically recognizing the nervous necrosis virus, and the nucleotide sequence of the ssDNA aptamer is 5'-GTCTGAAGTAGACGCAGGAGAACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCACAGTCACACCTGAGTAAGCGT-3' (SEQ ID NO:1) or 5'-AACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCAC-3' (SEQ ID NO: 2).
Further, any position on the nucleotide sequence of the ssDNA aptamer can undergo phosphorylation, sulfhydrylation, methylation, amination or isotopic reaction.
Further, a marker is bound to the nucleotide sequence of the ssDNA aptamer.
Still further, the label is selected from one or more of biotin, enzyme, and a luminescent group.
Still further, the luminescent group is selected from one or more of fluorescein isothiocyanate, carboxytetramethylrhodamine and hydroxyfluorescein.
Another object of the present invention is to provide a method for screening ssDNA aptamers, comprising the steps of:
step 1: synthesizing a single-stranded DNA library and primers shown in the following sequences:
random Library 50:
5’-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT
5' primer: 5 '-FAM-GTCTGAAGTAGACGCAGGAG-3';
3' primer: 5 '-Biotin-ACGCTTACTCAGGTGTGACT-3';
step 2: dissolving 10nmol of the random library in 500 μ l of PBS, performing constant-temperature water bath at 92 ℃ for 5min, then rapidly performing ice bath for 10min, and incubating the treated random library and GTONNV infected cells on ice for 1 h; after incubation and combination are completed, centrifuging and removing a supernatant, washing GTONNV infected cells by 10mL PBS, carrying out constant-temperature water bath for 10min at 92 ℃, centrifuging for 1-20min under the condition of 12000g, and collecting the supernatant, wherein the supernatant is a ssDNA aptamer library for specifically identifying the GTONNV infected cells;
and step 3: taking 100ul of ssDNA aptamer library obtained by screening and identifying GTONNV infected cells for PCR amplification, wherein the specific amplification strip program is as follows: 5min at 94 ℃, 1min at 94 ℃, 30sec at 56 ℃, 1min at 72 ℃, 5min at 72 ℃ after 20 cycles of circulation;
and 4, step 4: incubating 100 mu l of streptavidin-labeled magnetic beads and the double-stranded DNA obtained by PCR amplification in the step 3 for 20min at normal temperature, binding the double-stranded DNA to the surfaces of the magnetic beads by utilizing the affinity action of biotin on the double-stranded DNA and the streptavidin on the magnetic beads, removing supernatant by utilizing a magnetic separator, washing the magnetic beads by using 2mL of PBS, adding 200ul of NaOH solution (200mM) into an EP (ultraviolet) tube, reacting for 10min at normal temperature, and recovering by utilizing a magnetic separation frame to obtain supernatant;
and 5: adding the supernatant obtained in the step (4) into sterile water, washing, then carrying out salt separation by a desalting column, naturally dripping under the action of gravity, and adding 500 mu l of PBS into the collected liquid to obtain a solution containing the DNA single-strand library;
step 6: replacing the random library in the step 2 with the DNA single-stranded library obtained in the step 5, and repeating the step 2-5 for 8 times;
and 7: dissolving the DNA library obtained by screening in the step 6, incubating the DNA library with normal cells of trachinotus ovatus for 1h on ice after thermostatic water bath and ice bath at the temperature of 92 ℃, and centrifugally collecting a supernatant solution after incubation is finished; then combining the supernatant solution with normal cells of trachinotus ovatus in an ice bath; after incubation and combination are finished, collecting supernatant, wherein the collected supernatant is a nucleic acid library subjected to negative screening;
and 8: and (3) taking the supernatant solution obtained in the step (7), and repeating the experimental operation sequence of the step (3), the step (4), the step (5), the step (7), the step (2), the step (3), the step (4) and the step (5) for 8 times in sequence, wherein the finally obtained solution is the ssDNA aptamer.
Another objective of the present invention is to provide a rapid detection method (AFMP) for trachinotus ovatus-derived nervous necrosis virus using the ssDNA aptamer, comprising the following steps:
step 1: biotin labeling the ssDNA aptamer;
step 2: mixing 1-100mg of a sample to be detected with the ssDNA aptamer with the concentration of 100-; after incubation and combination, washing a sample to be detected, uniformly mixing the sample to be detected in 200 mu l of PBS solution, detecting by using a flow cytometer, and detecting whether the trachinotus ovatus derived nervous necrosis virus infected cells exist in the sample to be detected according to the change of the fluorescence value.
The invention also aims to provide an application of the ssDNA aptamer in detecting trachinotus ovatus-derived nervous necrosis virus.
Compared with the existing protein antibody, the aptamer obtained by screening through the SELEX technology has higher affinity and specificity, and has the characteristics that the protein antibody does not have, including no immunogenicity; the preparation period is short, and the reproducibility is good; the molecular weight is small, and the in vitro chemical synthesis is convenient; the marking is convenient; the different parts of the nucleic acid aptamer are easy to modify and replace; the sequence is stable and easy to transport and store, etc. When the aptamer-based rapid detection method (AFMP) for the trachinotus ovatus-derived nervous necrosis virus is used for detecting the fish nervous necrosis virus, the operation is simple and rapid, and a related rapid detection kit can be developed by combining an enzyme labeling instrument, a flow cytometer, a fluorescence microscope and the like. The method has important significance for the rapid diagnosis of the fish nervous necrosis virus, and has good application prospect in the field of detection of the fish nervous necrosis virus.
In addition, according to the Aptamer-Based rapid detection method (Aptamer-Based Molecular Probe detected assay, AFMP) for trachinotus ovatus-derived nervous necrosis virus, after the trachinotus ovatus cells infected by the trachinotus ovatus-derived nervous necrosis virus are incubated, combined and cleaned with ssDNA nucleic acid aptamers marked by hydroxyfluorescein (FAM) and shown in SEQ ID NO. 1 or SEQ ID NO. 2, a laser confocal microscope is used for detection, and the trachinotus ovatus-derived nervous necrosis virus is detected according to a Fluorescent signal on the cell surface. The AFMP technology can be applied to developing a rapid detection kit for the fish nervous necrosis virus based on the aptamer, is suitable for large-scale rapid detection for diagnosing whether the fish is infected by the fish nervous necrosis virus, and has the advantages of short time consumption, simplicity and convenience in operation, high stability, high sensitivity and the like.
Drawings
FIG. 1 is a graph comparing fluorescence intensity measured by flow cytometry for ssDNA aptamers of example 1 and comparative example 1 of the present invention;
FIG. 2 is a confocal laser microscope image of ssDNA aptamers of example 1 and comparative example 1;
FIG. 3 is a diagram showing the prediction of the secondary structure of the aptamer of SEQ ID NO. 1 according to example 3 of the present invention.
Detailed Description
In order to make the technical solutions of the present invention better understood by those skilled in the art, the technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments.
Example 1
Example 1 preparation of ssDNA aptamers is as follows:
step 1: synthesizing a single-stranded DNA library and primers shown in the following sequences:
random Library 50:
5’-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT
5' primer: 5 '-FAM-GTCTGAAGTAGACGCAGGAG-3';
3' primer: 5 '-Biotin-ACGCTTACTCAGGTGTGACT-3';
step 2: dissolving 10nmol of the random library in 500 μ l of PBS, performing constant-temperature water bath at 92 ℃ for 5min, then rapidly performing ice bath for 10min, and incubating the treated random library and GTONNV infected cells on ice for 1 h; after incubation and combination are completed, centrifuging and removing a supernatant, washing GTONNV infected cells by 10mL PBS, carrying out constant-temperature water bath for 10min at 92 ℃, centrifuging for 1-20min under the condition of 12000g, and collecting the supernatant, wherein the supernatant is a ssDNA aptamer library for specifically identifying the GTONNV infected cells;
and step 3: taking 100ul of ssDNA aptamer library obtained by screening and identifying GTONNV infected cells for PCR amplification, wherein the specific amplification strip program is as follows: 5min at 94 ℃, 1min at 94 ℃, 30sec at 56 ℃, 1min at 72 ℃, 5min at 72 ℃ after 20 cycles of circulation;
and 4, step 4: incubating 100 mu l of streptavidin-labeled magnetic beads and the double-stranded DNA obtained by PCR amplification in the step 3 for 20min at normal temperature, binding the double-stranded DNA to the surfaces of the magnetic beads by utilizing the affinity action of biotin on the double-stranded DNA and the streptavidin on the magnetic beads, removing supernatant by utilizing a magnetic separator, washing the magnetic beads by using 2mL of PBS, adding 200ul of NaOH solution (200mM) into an EP (ultraviolet) tube, reacting for 10min at normal temperature, and recovering by utilizing a magnetic separation frame to obtain supernatant;
and 5: adding the supernatant obtained in the step (4) into sterile water, washing, then carrying out salt separation by a desalting column, naturally dripping under the action of gravity, and adding 500 mu l of PBS into the collected liquid to obtain a solution containing the DNA single-strand library;
step 6: replacing the random library in the step 2 with the DNA single-stranded library obtained in the step 5, and repeating the step 2-5 for 8 times;
and 7: dissolving the DNA library obtained by screening in the step 6, incubating the DNA library with normal cells of trachinotus ovatus for 1h on ice after thermostatic water bath and ice bath at the temperature of 92 ℃, and centrifugally collecting a supernatant solution after incubation is finished; then combining the supernatant solution with normal cells of trachinotus ovatus in an ice bath; after incubation and combination are finished, collecting supernatant, wherein the collected supernatant is a nucleic acid library subjected to negative screening;
and 8: and (3) taking the supernatant solution obtained in the step (7), and repeating the experimental operation sequence of the step (3), the step (4), the step (5), the step (7), the step (2), the step (3), the step (4) and the step (5) for 8 times in sequence, wherein the finally obtained solution is the ssDNA aptamer.
And 7: and (3) after PCR amplification in the step (3) and preparation of the single-stranded DNA library in the step (4), sequentially repeating the steps of the step (6), the step (2), the step (3) and the step (4), and detecting the enhancement condition of the obtained library on the identification capability of the GTONNV infected cells by using a flow cytometer until the identification capability of the nucleic acid library on the GTONNV infected cells is strongest after 8 rounds of screening. After the obtained amplification product is subjected to clone sequencing analysis, the ssDNA aptamer with the sequence of 5'-GTCTGAAGTAGACGCAGGAGAACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCACAGTCACACCTGAGTAAGCGT-3' (SEQ ID NO:1) which can be used for detecting the nervous necrosis virus in the embodiment is finally obtained.
Example 1 AFMP detection method for ssDNA aptamers as follows:
step 1: biotin labeling of the ssDNA aptamer of example 1;
step 2: 200nM hydroxyfluorescein (FAM) -labeled screening libraries at round 1, round 3, round 5, round 6, round 7, round 8, and round 9 were dissolved in 500. mu.l PBS, incubated with live neuro-necrosis virus on ice for 40min, centrifuged at 1000g to remove supernatant, centrifuged and washed three times with 10mLPBS, and finally the neuro-necrosis virus was mixed in 200. mu.l PBS for 50000 cells in flow cytometry. And detecting the trachinotus ovatus source nervous necrosis virus according to the change of the fluorescence value. As shown in fig. 1, 1st, 3rd, 5th, 6th, 7th, 8th and 9th represent binding of the flow cytometer library for detecting binding of hydroxyfluorescein (FAM) labeled neuro-necrosis virus from trachinotus ovatus in example 1, round 3, round 5, round 6, round 7, round 8 and round 9, respectively.
Example 2
Example 2 preparation of ssDNA aptamers is as follows:
step 1: synthesizing a single-stranded DNA library and primers shown in the following sequences:
random Library 50:
5’-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT
5' primer: 5 '-FAM-GTCTGAAGTAGACGCAGGAG-3';
3' primer: 5 '-Biotin-ACGCTTACTCAGGTGTGACT-3';
step 2: dissolving 10nmol of the random library in 500 μ l of PBS, performing constant-temperature water bath at 92 ℃ for 5min, then rapidly performing ice bath for 10min, and incubating the treated random library and GTONNV infected cells on ice for 1 h; after incubation and combination are completed, centrifuging and removing a supernatant, washing GTONNV infected cells by 10mL PBS, carrying out constant-temperature water bath for 10min at 92 ℃, centrifuging for 1-20min under the condition of 12000g, and collecting the supernatant, wherein the supernatant is a ssDNA aptamer library for specifically identifying the GTONNV infected cells;
and step 3: taking 100ul of ssDNA aptamer library obtained by screening and identifying GTONNV infected cells for PCR amplification, wherein the specific amplification strip program is as follows: 5min at 94 ℃, 1min at 94 ℃, 30sec at 56 ℃, 1min at 72 ℃, 5min at 72 ℃ after 20 cycles of circulation;
and 4, step 4: incubating 100 mu l of streptavidin-labeled magnetic beads and the double-stranded DNA obtained by PCR amplification in the step 3 for 20min at normal temperature, binding the double-stranded DNA to the surfaces of the magnetic beads by utilizing the affinity action of biotin on the double-stranded DNA and the streptavidin on the magnetic beads, removing supernatant by utilizing a magnetic separator, washing the magnetic beads by using 2mL of PBS, adding 200ul of NaOH solution (200mM) into an EP (ultraviolet) tube, reacting for 10min at normal temperature, and recovering by utilizing a magnetic separation frame to obtain supernatant;
and 5: adding the supernatant obtained in the step (4) into sterile water, washing, then carrying out salt separation by a desalting column, naturally dripping under the action of gravity, and adding 500 mu l of PBS into the collected liquid to obtain a solution containing the DNA single-strand library;
step 6: replacing the random library in the step 2 with the DNA single-stranded library obtained in the step 5, and repeating the step 2-5 for 8 times;
and 7: dissolving the DNA library obtained by screening in the step 6, incubating the DNA library with normal cells of trachinotus ovatus for 1h on ice after thermostatic water bath and ice bath at the temperature of 92 ℃, and centrifugally collecting a supernatant solution after incubation is finished; then combining the supernatant solution with normal cells of trachinotus ovatus in an ice bath; after incubation and combination are finished, collecting supernatant, wherein the collected supernatant is a nucleic acid library subjected to negative screening;
and 8: and (3) taking the supernatant solution obtained in the step (7), and repeating the experimental operation sequence of the step (3), the step (4), the step (5), the step (7), the step (2), the step (3), the step (4) and the step (5) for 8 times in sequence, wherein the finally obtained solution is the ssDNA aptamer.
And 7: and (3) after PCR amplification in the step (3) and preparation of the single-stranded DNA library in the step (4), sequentially repeating the steps of the step (6), the step (2), the step (3) and the step (4), and detecting the enhancement condition of the obtained library on the identification capability of the GTONNV infected cells by using a flow cytometer until the identification capability of the nucleic acid library on the GTONNV infected cells is strongest after 8 rounds of screening. After the obtained amplification product is subjected to clone sequencing analysis, the ssDNA aptamer with the sequence of 5'-AACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCAC-3' (SEQ ID NO:2) which can be used for detecting the nervous necrosis virus in the embodiment is finally obtained.
Example 2 AFMP detection method for ssDNA aptamers as follows:
step 1: biotin labeling of the ssDNA aptamer of example 1;
step 2: 200nM hydroxyfluorescein (FAM) -labeled screening libraries at round 1, round 3, round 5, round 6, round 7, round 8, and round 9 were dissolved in 500. mu.l PBS, incubated with live neuro-necrosis virus on ice for 40min, centrifuged at 1000g to remove supernatant, centrifuged and washed three times with 10mLPBS, and finally the neuro-necrosis virus was mixed in 200. mu.l PBS for 50000 cells in flow cytometry. And detecting the trachinotus ovatus source nervous necrosis virus according to the change of the fluorescence value. As shown in fig. 1, 1st, 3rd, 5th, 6th, 7th, 8th and 9th represent binding of the flow cytometer library for detecting binding of hydroxyfluorescein (FAM) labeled neuro-necrosis virus from trachinotus ovatus in example 1, round 3, round 5, round 6, round 7, round 8 and round 9, respectively.
Comparative example 1
Comparative example 1 preparation of ssDNA aptamers was as follows:
synthesis of random Single-stranded DNA libraries and primers shown in the following sequence
Random Library 50:
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC
5' primer: 5 '-FAM-GACGCTTACTCAGGTGTGACTCG-3';
3' primer: 5 '-Biotin-GAGACTTCATCTGCGTCCTTCG-3';
the random single-stranded DNA library described above was used as a control ssDNA aptamer.
Comparative example 1 AFMP detection method of ssDNA aptamers was as follows:
step 1: biotin labeling of the ssDNA aptamer of control example 1;
step 2: 200nM of a random single-stranded DNA library labeled with hydroxyfluorescein (FAM) was dissolved in 500. mu.l PBS, incubated with live neuro-necrosis virus on ice for 40min, centrifuged at 1000g to remove supernatant, centrifuged and washed three times with 10ml PBS, and finally mixed in 200. mu.l PBS for 50000 cells in flow cytometry. And detecting the trachinotus ovatus source nervous necrosis virus according to the change of the fluorescence value. As shown in fig. 1, Library is a control example of flow cytometry for detecting binding of the hydroxyfluorescein (FAM) -labeled 1st, 3rd, 5th, 6th, 7th, 8th and 9th screening libraries with trachinotus ovatus-derived nervous necrosis virus.
After 9 rounds of screening, the 8th round of screening library is proved to have the highest specific recognition capability on the nervous necrosis virus.
Example 3
The MFOLD software was used to predict the secondary structure of aptamers on-line.
The secondary structure prediction results of the aptamer of SEQ ID NO. 1 are shown in FIG. 3, and the aptamer forms a special stem-loop structure and hairpin structure.
Example 4
And (3) taking the ssDNA aptamers obtained in the example 1 or the example 2, and assembling an AFMP kit to form the AFMP detection kit for diagnosing whether the fish is infected by the nervous necrosis virus.
As shown in fig. 1, the flow cytometry method for detecting the specific binding between the ssDNA aptamer of example 1 of the present invention and the nervous necrosis virus has a higher fluorescence value, whereas the flow cytometry method for detecting the specific binding between the ssDNA aptamer of example 1 of the present invention and the nervous necrosis virus has a lower fluorescence value than example 1, does not have the ability of specific binding to the nervous necrosis virus, and cannot specifically recognize the nervous necrosis virus.
As shown in fig. 2, the situation that the ssDNA aptamer of example 1 of the present invention and the cells infected with the neuro-necrosis virus can be specifically bound by confocal laser microscopy is detected, and it can be seen from the figure that the cells infected with the trachinotus ovatus-derived neuro-necrosis virus of the control example do not show fluorescence in the fluorescence detection process, which indicates that the ssDNA aptamer of the control example cannot specifically bind to the cells infected with the trachinotus ovatus-derived neuro-necrosis virus and cannot effectively detect the trachinotus ovatus-derived neuro-necrosis virus, and the positions of the cells infected with the trachinotus ovatus-derived neuro-necrosis virus in the fluorescence detection process of example 1 show fluorescence, which indicates that the ssDNA aptamer of example 1 can effectively bind to the cells infected with the trachinotus ovatus-derived neuro-necrosis virus.
Based on the results shown in fig. 1 and 2, it can be proved that the ssDNA aptamer shown in example 1 of the present invention, after being labeled and modified by fluorescent substances or luminescent materials such as oxyfluorescein, can still specifically bind to trachinotus ovatus derived nervous necrosis virus infected cells, and can be used for detection of trachinotus ovatus derived nervous necrosis virus.
The ssDNA aptamer obtained by SELEX screening has good affinity and specificity, is stable in structure, has good affinity and specificity after being subjected to group marking and modification, can be applied to an AFMP detection kit, has the characteristics of short preparation period, good reproducibility and small molecular weight compared with a protein antibody, is convenient for in vitro synthesis, and has good application prospect in the field of detection of trachinotus ovatus derived nervous necrosis viruses.
Finally, it should be noted that the above-mentioned embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the same, and although the present invention is described in detail with reference to the above-mentioned embodiments, it should be understood by those skilled in the art that the modifications and equivalents of the specific embodiments of the present invention can be made by those skilled in the art after reading the present specification, but these modifications and variations do not depart from the scope of the claims of the present application.
SEQUENCE LISTING
<110> Guangxi academy of sciences
<120> aptamer specific for trachinotus ovatus neuronecrosis virus and application thereof
<130> 2018
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 90
<212> DNA
<213> Artificial Synthesis
<400> 1
gtctgaagta gacgcaggag aactgtatta gcctctgggt gccgcaccgt agtgccctat 60
ctaacatcac agtcacacct gagtaagcgt 90
<210> 2
<211> 50
<212> DNA
<213> Artificial Synthesis
<400> 2
aactgtatta gcctctgggt gccgcaccgt agtgccctat ctaacatcac 50
Claims (5)
1. A ssDNA aptamer having a nucleotide sequence of 5'-GTCTGAAGTAGACGCAGGAGAACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCACAGTCACACCTGAGTAAGCGT-3'.
2. A ssDNA aptamer having a nucleotide sequence of 5'-AACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCAC-3'.
3. The ssDNA aptamer according to claim 1 or 2, wherein a marker is bound to the nucleotide sequence of the ssDNA aptamer.
4. The ssDNA aptamer according to claim 3, wherein the label is selected from one or more of biotin, an enzyme, and a luminescent group.
5. The ssDNA aptamer according to claim 4, wherein the luminescent group is selected from one or more of fluorescein isothiocyanate, carboxytetramethylrhodamine, hydroxyfluorescein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811123360.5A CN109207480B (en) | 2018-09-26 | 2018-09-26 | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811123360.5A CN109207480B (en) | 2018-09-26 | 2018-09-26 | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109207480A CN109207480A (en) | 2019-01-15 |
| CN109207480B true CN109207480B (en) | 2021-08-27 |
Family
ID=64981575
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811123360.5A Active CN109207480B (en) | 2018-09-26 | 2018-09-26 | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109207480B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110257385B (en) * | 2019-07-04 | 2022-06-17 | 广西科学院 | Aptamer for resisting grass carp reovirus I, and construction method and application thereof |
| CN110257386B (en) * | 2019-07-04 | 2022-06-21 | 广西科学院 | Aptamer for resisting grass carp GCRV I virus as well as construction method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858359A (en) * | 2017-12-01 | 2018-03-30 | 广西科学院 | It is a kind of can specific recognition vibrio alginolyticus aptamer and its application |
-
2018
- 2018-09-26 CN CN201811123360.5A patent/CN109207480B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858359A (en) * | 2017-12-01 | 2018-03-30 | 广西科学院 | It is a kind of can specific recognition vibrio alginolyticus aptamer and its application |
Non-Patent Citations (2)
| Title |
|---|
| First identification of the nervous necrosis virus isolated from cultured golden pompano (Trachinotus ovatus) in Guangxi, China;Li P等;《JOURNAL OF FISH DISEASES》;20180731;第41卷(第7期);第1177-1180页 * |
| 卵形鲳鲹一例疑似神经性病毒病的初步分析;蔡小辉等;《水产科学》;20121015;第31卷(第10期);第597-601页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109207480A (en) | 2019-01-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109161547B (en) | Nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus | |
| CN111073892B (en) | Nucleic acid aptamer for identifying garrupa iridovirus infected cells, construction method and application thereof | |
| CN109136229B (en) | Aptamer for specifically recognizing trachinotus ovatus-derived nervous necrosis virus and application thereof | |
| CN108034659B (en) | ssDNA aptamer and application thereof in vibrio alginolyticus rapid detection | |
| CN111073891B (en) | Aptamer for detecting grouper iridovirus as well as construction method and application thereof | |
| CN104789569A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN104789696A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN104789568A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN113215167A (en) | Aptamer and application thereof in detection of cells infected by iridovirus of micropterus salmoides | |
| CN107858359B (en) | Nucleic acid aptamer capable of specifically recognizing vibrio alginolyticus and application thereof | |
| CN110643611A (en) | Aptamer, construction method thereof and application thereof in detection of grouper iridovirus | |
| CN109207480B (en) | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof | |
| CN109161548B (en) | Aptamer and application thereof in detection of trachinotus ovatus-derived nervous necrosis virus | |
| CN107937404B (en) | Nucleic acid aptamer and application thereof in identification and detection of vibrio alginolyticus | |
| CN113462693B (en) | Application of ssDNA aptamer in identifying largemouth black bass iridovirus infected cells | |
| CN111363749B (en) | Nucleic acid aptamer for detecting Chinese softshell turtle iridovirus as well as construction method and application thereof | |
| CN111363748B (en) | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| CN111454956B (en) | Nucleic acid aptamer for Chinese soft-shelled turtle iridovirus as well as construction method and application thereof | |
| CN115992143A (en) | High-flux drug screening method for resisting nervous necrosis virus | |
| CN104789570B (en) | A kind of DNA aptamers for being used to detect grouper irido virus infection and its screening technique and application | |
| CN109161546B (en) | Aptamer and application thereof in detection of trachinotus ovatus source pathogenic vibrio alginolyticus | |
| CN108004240B (en) | ssDNA nucleic acid aptamer specific to vibrio alginolyticus and application thereof | |
| CN110257387B (en) | Aptamer for identifying grass carp hemorrhagic disease virus as well as construction method and application thereof | |
| CN110257386B (en) | Aptamer for resisting grass carp GCRV I virus as well as construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |