CN109207480A - Aptamer and its application of the specificity for egg-shaped pompano nervous necrosis virus - Google Patents
Aptamer and its application of the specificity for egg-shaped pompano nervous necrosis virus Download PDFInfo
- Publication number
- CN109207480A CN109207480A CN201811123360.5A CN201811123360A CN109207480A CN 109207480 A CN109207480 A CN 109207480A CN 201811123360 A CN201811123360 A CN 201811123360A CN 109207480 A CN109207480 A CN 109207480A
- Authority
- CN
- China
- Prior art keywords
- ssdna aptamer
- supernatant
- library
- egg
- aptamer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Virology (AREA)
- Plant Pathology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Cell Biology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
SsDNA aptamer and its application, the nucleotides sequence of the ssDNA aptamer the invention discloses a species specificity for egg-shaped pompano nervous necrosis virus are classified as 5 '-GTCTGAAGTAGACGCAGGAGAACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCC CTATCTAACATCACAGTCACACCTGAGTAAGCGT-3 ' (SEQ ID NO:1) or 5 '-AACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCAC-3 ' (SEQ ID NO:2).SsDNA aptamer of the invention has specificity and high sensitivity, and non-immunogenicity to egg-shaped pompano source nervous necrosis virus infection cell.The ssDNA aptamer high specific, no cytotoxicity, stablizes easily modification, convenient for synthesizing and saving at high-affinity, can carry out fast and accurately detection and diagnosis to egg-shaped pompano source nervous necrosis virus infection cell.
Description
Technical field
The present invention relates to a kind of ssDNA aptamer and its screening techniques, detection method and application, more particularly to one
Aptamer and its application of the species specificity for egg-shaped pompano nervous necrosis virus.
Background technique
China is as aquaculture big country, and the 70% of the world aquaculture Liang Zhan aquaculture total amount.Guangxi is China
The big province of aquaculture, main breed variety includes egg-shaped pompano, grass carp, channel catfish, grouper, prawn, oyster, geneva
Nacre and various food plants.However, with urbanization, industrialization, the quickening for cultivating scale process, Guangxi aquaculture
Environment is worsening, and various diseases are frequently broken out, and causes huge economic losses.Beihai Fisheries Base Guangxi Province coastal waters cage culture in 2017
Egg-shaped pompano breaks out viral nerve necrosis fish disease, by identifying that separation obtains to pathogenic microorganism in illness egg-shaped pompano
Egg-shaped pompano source nervous necrosis virus is obtained, and is named as Guangxi Trachinotus ovatus nervous
necrosis virus(GTONNV).It is reported that.Nerve necrosis syndrome virus will lead to the brain tissue and eye retina group of fish
It knits Vacuole formation, the especially prelarva to the Seedling production phase and juvenile fish harm is very big, outburst speed is fast, and lethality is up to
95%-100%.According to the disease prevention principle of " putting prevention first and combining prevention with control ", early stage is infected in nervous necrosis virus,
By quickly detecting, Precise Diagnosis, implement efficient prevention and control measure with a definite target in view rapidly, for control virus large-scale outbreak
It is popular most important.It but is mainly at present polymerase chain reaction detection skill for the diagnostic method of fish nervous necrosis virus
Art (polymerase chain reation, PCR) etc..PCR testing result is accurately reliable, but there are cumbersome, time-consuming,
The deficiencies of instrument reagent is expensive is unable to satisfy the requirement of live quick and precisely checkout and diagnosis.Therefore should put forth effort development operation it is convenient, at
This is low, time-consuming is short, accuracy is high, can be used for the egg-shaped pompano source nervous necrosis virus Fast Detection Technique of cultivation site, this for
Find early, determine cause of disease, so formulate with a definite target in view therapeutic scheme come control cause of disease diffusion, reduce loss it is most important.
Aglucon phyletic evolution technology (the Systematic Evolution of Ligands by of index concentration
Exponential Enrichment technology, SELEX) it is a kind of biological libraries screening technique, which uses capacity
The up to random oligonucleotide library of 1014-1015, finally obtaining by multi-turns screen in vitro being capable of specific recognition target
The single-stranded oligonucleotide of matter, i.e. aptamer.There is aptamer easily screening to obtain, is at low cost, easy modification, stability
By force, many advantages, such as high specific identifies and combines target substance, have evolved at present a kind of novel detection being widely noticed and
Treatment tool also shows that wide application prospect in the biomedical basic research of major disease, medical diagnosis on disease field.
Summary of the invention
The invention reside in provide a kind of high specific, high sensitivity, non-immunogenicity and stablize easily modification, convenient for synthesis
With preservation for detecting the ssDNA aptamer of egg-shaped pompano source nervous necrosis virus, at least to solve existing biology
Learn the problem of detection technique quickly cannot carry out accurate detection and diagnosis to egg-shaped pompano source nervous necrosis virus at the scene.
Be to mesh of the invention to provide it is a kind of can specific recognition nervous necrosis virus ssDNA aptamer, institute
The nucleotides sequence for stating ssDNA aptamer is classified as 5 '-GTCTGAAGTAGACGCAGGAGAACTGTATTAGCCTCTGGGTGC
CGCACCGTAGTGCCCTATCTAACATCACAGTCACACCTGAGTAAGCGT-3 ' (SEQ ID NO:1) or 5 '-AACTGTA
TTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCAC-3’(SEQ ID NO:2)。
Further, any position can be carried out phosphorylation, sulfydryl on the nucleotide sequence of the ssDNA aptamer
Change, methylate, amination or isotopologue are reacted.
Further, marker is combined on the nucleotide sequence of the ssDNA aptamer.
Further, the marker is selected from one of biotin, enzyme, luminophore or a variety of.
Further, the luminophore is selected from fluorescein isothiocynate, carboxyl tetramethylrhodamine, hydroxyl fluorescein
One of or it is a variety of.
Another mesh of the invention it is to provide a kind of screening technique of above-mentioned ssDNA aptamer, comprising the following steps:
Step 1: synthesize single-stranded DNA banks shown in following sequence and primer:
Random library Library50:
5’-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT
5 ' primers: 5 '-FAM-GTCTGAAGTAGACGCAGGAG-3 '；
3 ' primers: 5 '-Biotin-ACGCTTACTCAGGTGTGACT-3 '；
Step 2: take the above-mentioned random library of 10nmol to be dissolved in 500 μ l PBS, the water bath with thermostatic control 5min at 92 DEG C, then
Carry out ice bath rapidly, ice bath 10min, the random library that takes that treated and GTONNV infection cell are incubated for 1h on ice；Wait be incubated for
In conjunction with after the completion, being centrifuged and removing supernatant, the PBS of 10mL is taken to wash GTONNV infection cell, and the water bath with thermostatic control at 92 DEG C
10min is centrifuged 1-20min under conditions of 12000g, and collects supernatant, and the supernatant is specific recognition GTONNV
The ssDNA aptamer library of infection cell；
Step 3: the ssDNA aptamer library for the identification GTONNV infection cell for taking 100ul to screen carries out PCR expansion
Increase, it is specific to expand a program are as follows: 94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min are recycled, 72 DEG C by 20 wheels
5min；
Step 4: by the resulting double-stranded DNA of PCR amplification in the magnetic bead of 100 μ l streptavidins label and step 3 in room temperature
Double-stranded DNA is integrated to by lower incubation 20min using the affinity interaction of streptavidin on the biotin and magnetic bead on double-stranded DNA
Magnetic bead surfaces wash magnetic bead with 2mL PBS, 200ul then are added in EP pipe using supernatant is removed on magnetic separator
NaOH solution (200mM), normal-temperature reaction 10min recycle to obtain supernatant using magnetic separation rack；
Step 5: except salt plug carries out salinity separation after taking step 4 gained supernatant that sterile water washing is added, in gravity
It is lower to drip off naturally, 500 μ l PBS are added into the liquid being collected into, obtain the solution containing the single-stranded library DNA；
Step 6: taking the single-stranded library DNA obtained in step 5 to replace the random library in step 2, and step 2-5 is repeated
8 times；
Step 7: the DNA library for taking the screening of step 6 to obtain dissolves, after 92 DEG C of waters bath with thermostatic control, ice baths, just with egg-shaped pompano
Normal cell is incubated for 1h on ice, and supernatant solution is collected by centrifugation after the completion of being incubated for；Then this supernatant solution and egg-shaped pompano is normally thin
Born of the same parents carry out ice bath combination；After the completion of hatching combination, supernatant is collected, the supernatant being collected into is the nucleic acid library library by negative screening；
Step 8: gained supernatant solution in step 7 is taken, successively according to step 3, step 4, step 5, step 7, step 2, step
Rapid 3, the experimental implementation of step 4 and step 5 sequence is repeated 8 times, and final acquired solution is ssDNA aptamer.
Another mesh of the invention it is to provide a kind of bad using the egg-shaped pompano source nerve of above-mentioned ssDNA aptamer
The rapid detection method (AFMP) of dead virus, comprising the following steps:
Step 1: biotin labeling is carried out to ssDNA aptamer；
Step 2: taking sample to be tested 1-100mg and step 1 gained concentration mixed for the ssDNA aptamer of 100-200nM
It closes, and supernatant is removed in hatching combination 40min on ice, 1000g centrifugation；After hatching combination, sample to be tested is cleaned, is mixed in 200 μ
It in l PBS solution, is detected using flow cytometer, detects in sample to be tested whether have oval silvery pomfret according to the variation of fluorescent value
The source Scad nervous necrosis virus infection cell.
The present invention is to provide there are also a mesh a kind of above-mentioned ssDNA aptamer of application in detection egg-shaped pompano source mind
Through the purposes in necrosis virus.
The aptamer that the present invention is obtained by SELEX technology screening has higher compared with existing protein antibodies
Affinity and specificity, but also have the characteristics that not available for protein antibodies, including non-immunogenicity；Short preparation period,
Favorable reproducibility；Molecular weight is small, synthesizes convenient for iii vitro chemical；Convenient for label；It is easy to repair the different parts of aptamer
Decorations and substitution；Sequence is stable and easy to transport and save etc..Using the egg-shaped pompano source nerve of the invention based on aptamer
It is easy to operate rapid when the rapid detection method (AFMP) of necrosis virus detects fish nervous necrosis virus, it is combinable
Microplate reader, flow cytometer, fluorescence microscope etc. develop relevant quick detection kit.This is for fish nervous necrosis virus
Quick diagnosis be of great significance, have good application prospect in the detection field of fish nervous necrosis virus.
In addition, the rapid detection method of the egg-shaped pompano source nervous necrosis virus provided by the invention based on aptamer
(Aptamer-Based Fluorescent Molecular Probe detective aasay, AFMP), by egg-shaped pompano source
The egg-shaped pompano cell and hydroxyl fluorescein (6-carboxy-fluorescein, FAM) of nervous necrosis virus infection mark upper
After stating ssDNA aptamer hatching combination shown in SEQ ID NO:1 or SEQ ID NO:2 and cleaning, laser co-focusing is used
Microscope is detected, and detects egg-shaped pompano source nervous necrosis virus according to the fluorescence signal of cell surface.AFMP technology can answer
For developing the quick detection kit of the fish nervous necrosis virus based on aptamer, be suitable for diagnosis fish whether by
The high-volume that fish nervous necrosis virus infects quickly detects, and has time-consuming is short, easy to operate, stability is strong, sensitivity is high etc.
Advantage.
Detailed description of the invention
Fig. 1 be the embodiment of the present invention 1, in reference examples 1 ssDNA aptamer flow cytomery fluorescence intensity pair
Than figure；
Fig. 2 be the embodiment of the present invention 1, in reference examples 1 ssDNA aptamer laser confocal microscope shooting figure；
Fig. 3 is the secondary structure prediction figure of 3SEQ of embodiment of the present invention ID NO:1 aptamer.
Specific embodiment
It in order to enable those skilled in the art to better understand the solution of the present invention, below will be to the skill in the embodiment of the present invention
Art scheme is clearly and completely described, it is clear that and the described embodiment is only a part of the embodiment of the present invention, without
It is whole embodiments.
Embodiment 1
1 ssDNA aptamer of embodiment the preparation method is as follows:
Step 1: synthesize single-stranded DNA banks shown in following sequence and primer:
Random library Library50:
5’-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT
5 ' primers: 5 '-FAM-GTCTGAAGTAGACGCAGGAG-3 '；
3 ' primers: 5 '-Biotin-ACGCTTACTCAGGTGTGACT-3 '；
Step 2: take the above-mentioned random library of 10nmol to be dissolved in 500 μ l PBS, the water bath with thermostatic control 5min at 92 DEG C, then
Carry out ice bath rapidly, ice bath 10min, the random library that takes that treated and GTONNV infection cell are incubated for 1h on ice；Wait be incubated for
In conjunction with after the completion, being centrifuged and removing supernatant, the PBS of 10mL is taken to wash GTONNV infection cell, and the water bath with thermostatic control at 92 DEG C
10min is centrifuged 1-20min under conditions of 12000g, and collects supernatant, and the supernatant is specific recognition GTONNV
The ssDNA aptamer library of infection cell；
Step 3: the ssDNA aptamer library for the identification GTONNV infection cell for taking 100ul to screen carries out PCR expansion
Increase, it is specific to expand a program are as follows: 94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min are recycled, 72 DEG C of 5min by 20 wheels；
Step 4: by the resulting double-stranded DNA of PCR amplification in the magnetic bead of 100 μ l streptavidins label and step 3 in room temperature
Double-stranded DNA is integrated to by lower incubation 20min using the affinity interaction of streptavidin on the biotin and magnetic bead on double-stranded DNA
Magnetic bead surfaces wash magnetic bead with 2mL PBS, 200ul then are added in EP pipe using supernatant is removed on magnetic separator
NaOH solution (200mM), normal-temperature reaction 10min recycle to obtain supernatant using magnetic separation rack；
Step 5: except salt plug carries out salinity separation after taking step 4 gained supernatant that sterile water washing is added, in gravity
It is lower to drip off naturally, 500 μ l PBS are added into the liquid being collected into, obtain the solution containing the single-stranded library DNA；
Step 6: taking the single-stranded library DNA obtained in step 5 to replace the random library in step 2, and step 2-5 is repeated 8 times；
Step 7: the DNA library for taking the screening of step 6 to obtain dissolves, after 92 DEG C of waters bath with thermostatic control, ice baths, just with egg-shaped pompano
Normal cell is incubated for 1h on ice, and supernatant solution is collected by centrifugation after the completion of being incubated for；Then by this supernatant solution and egg-shaped pompano normal cell
Carry out ice bath combination；After the completion of hatching combination, supernatant is collected, the supernatant being collected into is the nucleic acid library library by negative screening；
Step 8: gained supernatant solution in step 7 is taken, successively according to step 3, step 4, step 5, step 7, step 2, step
Rapid 3, the experimental implementation of step 4 and step 5 sequence is repeated 8 times, and final acquired solution is ssDNA aptamer.
Step 7: the supernatant solution that will be collected into step 6, the single stranded DNA text of PCR amplification and step 4 by step 3
It after the preparation of library, is repeated in and carries out step 6, step 2, the process of step 3 and step 4, utilize text obtained by flow cytomery
Library is to the enhancing situation of GTONNV infection cell recognition capability, and after 8 wheel screenings, nucleic acid library knows GTONNV infection cell
Other ability reaches most strong.By gained amplified production after cloning and sequencing is analyzed, finally obtaining, which can be used in the present embodiment, detects mind
SsDNA aptamer through necrosis virus, 5 '-GTCTGAAGTAGACGCAGGAGAACTGTATTAGCCTCTGGG of sequence
TGCCGCACCGTAGTGCCCTATCTAACATCACAGTCACACCTGAGTAAGCGT-3’(SEQ ID NO:1)。
The AFMP detection method of 1 ssDNA aptamer of embodiment is as follows:
Step 1: biotin labeling is carried out to embodiment 1ssDNA aptamer；
Step 2: by the 1st wheel of 200nM hydroxyl fluorescein (FAM) label, the 3rd wheel, the 5th wheel, the 6th wheel, the 7th wheel, the 8th
Wheel, the 9th wheel screening library are dissolved in 500 μ l PBS, then with nervous necrosis virus viable bacteria hatching combination 40min on ice,
Supernatant is removed in 1000g centrifugation, three times with 10mLPBS centrifuge washing, finally mixes in 200 μ l PBS nervous necrosis virus, uses
In 50000 cells of flow cytomery.Egg-shaped pompano source nervous necrosis virus is detected according to the variation of fluorescent value.Such as Fig. 1
Shown, 1st, 3rd, 5th, 6th, 7th, 8th, 9th are respectively flow cytomery hydroxyl fluorescein (FAM) in embodiment 1
The 1st wheel, the 3rd wheel, the 5th wheel, the 6th wheel, the 7th wheel, the 8th wheel, the 9th wheel screening library and the egg-shaped pompano source nervous necrosis of label
The combination situation of poison.
Embodiment 2
Embodiment 2ssDNA aptamer the preparation method is as follows:
Step 1: synthesize single-stranded DNA banks shown in following sequence and primer:
Random library Library50:
5’-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT
5 ' primers: 5 '-FAM-GTCTGAAGTAGACGCAGGAG-3 '；
3 ' primers: 5 '-Biotin-ACGCTTACTCAGGTGTGACT-3 '；
Step 2: take the above-mentioned random library of 10nmol to be dissolved in 500 μ l PBS, the water bath with thermostatic control 5min at 92 DEG C, then
Carry out ice bath rapidly, ice bath 10min, the random library that takes that treated and GTONNV infection cell are incubated for 1h on ice；Wait be incubated for
In conjunction with after the completion, being centrifuged and removing supernatant, the PBS of 10mL is taken to wash GTONNV infection cell, and the water bath with thermostatic control at 92 DEG C
10min is centrifuged 1-20min under conditions of 12000g, and collects supernatant, and the supernatant is specific recognition GTONNV
The ssDNA aptamer library of infection cell；
Step 3: the ssDNA aptamer library for the identification GTONNV infection cell for taking 100ul to screen carries out PCR amplification,
Specific amplification program are as follows: 94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min are recycled, 72 DEG C of 5min by 20 wheels；
Step 4: by the resulting double-stranded DNA of PCR amplification in the magnetic bead of 100 μ l streptavidins label and step 3 in room temperature
Double-stranded DNA is integrated to by lower incubation 20min using the affinity interaction of streptavidin on the biotin and magnetic bead on double-stranded DNA
Magnetic bead surfaces wash magnetic bead with 2mL PBS, 200ul then are added in EP pipe using supernatant is removed on magnetic separator
NaOH solution (200mM), normal-temperature reaction 10min recycle to obtain supernatant using magnetic separation rack；
Step 5: except salt plug carries out salinity separation after taking step 4 gained supernatant that sterile water washing is added, in gravity
It is lower to drip off naturally, 500 μ l PBS are added into the liquid being collected into, obtain the solution containing the single-stranded library DNA；
Step 6: taking the single-stranded library DNA obtained in step 5 to replace the random library in step 2, and step 2-5 is repeated 8 times；
Step 7: the DNA library for taking the screening of step 6 to obtain dissolves, after 92 DEG C of waters bath with thermostatic control, ice baths, just with egg-shaped pompano
Normal cell is incubated for 1h on ice, and supernatant solution is collected by centrifugation after the completion of being incubated for；Then this supernatant solution and egg-shaped pompano is normal
Cell carries out ice bath combination；After the completion of hatching combination, supernatant is collected, the supernatant being collected into is the nucleic acid text by negative screening
Kuku；
Step 8: gained supernatant solution in step 7 is taken, successively according to step 3, step 4, step 5, step 7, step 2, step
Rapid 3, the experimental implementation of step 4 and step 5 sequence is repeated 8 times, and final acquired solution is ssDNA aptamer.
Step 7: the supernatant solution that will be collected into step 6, the single stranded DNA text of PCR amplification and step 4 by step 3
It after the preparation of library, is repeated in and carries out step 6, step 2, the process of step 3 and step 4, utilize text obtained by flow cytomery
Library is to the enhancing situation of GTONNV infection cell recognition capability, and after 8 wheel screenings, nucleic acid library knows GTONNV infection cell
Other ability reaches most strong.By gained amplified production after cloning and sequencing is analyzed, finally obtaining, which can be used in the present embodiment, detects mind
SsDNA aptamer through necrosis virus, 5 '-AACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTA of sequence
TCTAACATCAC-3’(SEQ ID NO:2)。
The AFMP detection method of 2 ssDNA aptamer of embodiment is as follows:
Step 1: biotin labeling is carried out to embodiment 1ssDNA aptamer；
Step 2: by the 1st wheel of 200nM hydroxyl fluorescein (FAM) label, the 3rd wheel, the 5th wheel, the 6th wheel, the 7th wheel, the 8th
Wheel, the 9th wheel screening library are dissolved in 500 μ l PBS, then with nervous necrosis virus viable bacteria hatching combination 40min on ice,
Supernatant is removed in 1000g centrifugation, three times with 10mLPBS centrifuge washing, finally mixes in 200 μ l PBS nervous necrosis virus, uses
In 50000 cells of flow cytomery.Egg-shaped pompano source nervous necrosis virus is detected according to the variation of fluorescent value.Such as Fig. 1
Shown, 1st, 3rd, 5th, 6th, 7th, 8th, 9th are respectively flow cytomery hydroxyl fluorescein (FAM) in embodiment 1
The 1st wheel, the 3rd wheel, the 5th wheel, the 6th wheel, the 7th wheel, the 8th wheel, the 9th wheel screening library and the egg-shaped pompano source nervous necrosis of label
The combination situation of poison.
Reference examples 1
1 ssDNA aptamer of reference examples the preparation method is as follows:
Synthesize random single-stranded DNA banks shown in following sequence and primer
Random library Library50:
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC
5 ' primers: 5 '-FAM-GACGCTTACTCAGGTGTGACTCG-3 '；
3 ' primers: 5 '-Biotin-GAGACTTCATCTGCGTCCTTCG-3 '；
Above-mentioned random single-stranded DNA banks are reference examples ssDNA aptamer.
The AFMP detection method of 1 ssDNA aptamer of reference examples is as follows:
Step 1: biotin labeling is carried out to reference examples 1ssDNA aptamer；
Step 2: the random single-stranded DNA banks that 200nM hydroxyl fluorescein (FAM) marks being dissolved in 500 μ l PBS, then
Supernatant is removed in hatching combination 40min, 1000g centrifugation on ice with nervous necrosis virus viable bacteria, three times with 10mLPBS centrifuge washing,
Finally nervous necrosis virus is mixed in 200 μ l PBS, is used for 50000 cells of flow cytomery.According to fluorescent value
Variation detect egg-shaped pompano source nervous necrosis virus.As shown in Figure 1, Library is flow cytomery hydroxyl in reference examples
The 1st wheel, the 3rd wheel, the 5th wheel, the 6th wheel, the 7th wheel, the 8th wheel, the 9th wheel screening library and the oval silvery pomfret of base fluorescein (FAM) label
The combination situation of the source Scad nervous necrosis virus.
By the screening of 9 wheels, it was demonstrated that the 8th wheel screening library reaches highest to the specific recognition capability of nervous necrosis virus.
Embodiment 3
Utilize the secondary structure of MFOLD software on-line prediction aptamer.
The secondary structure prediction result of SEQ ID NO:1 aptamer as shown in figure 3, aptamer formed it is special
Loop-stem structure and hairpin structure.
Embodiment 4
2 gained ssDNA aptamer of embodiment 1 or embodiment is taken, the assembling of AFMP kit is carried out, forms a kind of use
In the AFMP detection kit whether diagnosis fish are infected by nervous necrosis virus.
As shown in Figure 1, the ssDNA aptamer and nervous necrosis virus of the flow cytomery embodiment of the present invention 1
The case where spy's property led combines, testing result fluorescent value with higher can be carried out, and reference examples compare embodiment 1, fluorescent value
It is lower, without the ability specifically bound with nervous necrosis virus, specific recognition can not be carried out to nervous necrosis virus.
As shown in Fig. 2, detecting the ssDNA aptamer and mind of the embodiment of the present invention 1 by laser confocal microscope
The case where spy's property led combines can be carried out through necrosis virus infection cell, by can be seen that in figure, the egg-shaped pompano source mind of reference examples
Fluorescence is not shown in fluorescence detection through necrosis virus infection cell, illustrates that reference examples ssDNA aptamer can not be with
Egg-shaped pompano source nervous necrosis virus infection cell is specifically bound, and cannot be carried out to egg-shaped pompano source nervous necrosis virus
Effectively detection, and there is nervous necrosis virus infection cell position in egg-shaped pompano source in the fluorescence detection of embodiment 1
Fluorescence display illustrates that the ssDNA aptamer of embodiment 1 can be had with egg-shaped pompano source nervous necrosis virus infection cell
Effect combines.
Based on Fig. 1 and 2 as a result, can prove that ssDNA aptamer shown in the embodiment of the present invention 1 is glimmering through perhydroxyl radical
After the fluorescent materials such as light element or luminescent material label modification, it can still be carried out with egg-shaped pompano source nervous necrosis virus infection cell special
The opposite sex combines, and can be used in the detection of egg-shaped pompano source nervous necrosis virus.
The ssDNA aptamer that the embodiment of the present invention 1 is obtained by SELEX technology screening have preferable affinity and
Specificity, and the ssDNA aptamer stable structure of the embodiment of the present invention still have after carrying out group label and modification
Preferable affinity and specificity, can be applied in AFMP detection kit, and the ssDNA nucleic acid adaptation of the embodiment of the present invention 1
Body has the characteristics that short preparation period, favorable reproducibility, molecular weight are small compared to protein antibodies, convenient for external synthesis, in oval silvery pomfret
The detection field of the source Scad nervous necrosis virus has good application prospect.
Finally it should be noted that the above embodiments are merely illustrative of the technical scheme of the present invention and are not intended to be limiting thereof, to the greatest extent
Invention is explained in detail referring to above-described embodiment for pipe, it should be understood by a person of ordinary skill in the art that technology
Personnel read present specification after still can with modifications or equivalent substitutions are made to specific embodiments of the invention, but this
A little modifications are changed within all without departing from the present patent application accompanying claims protection scope.
SEQUENCE LISTING
<110>Guangxi Academy Of Sciences
<120>aptamer and its application of the specificity for egg-shaped pompano nervous necrosis virus
<130> 2018
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 90
<212> DNA
<213>artificial synthesized
<400> 1
gtctgaagta gacgcaggag aactgtatta gcctctgggt gccgcaccgt agtgccctat 60
ctaacatcac agtcacacct gagtaagcgt 90
<210> 2
<211> 50
<212> DNA
<213>artificial synthesized
<400> 2
aactgtatta gcctctgggt gccgcaccgt agtgccctat ctaacatcac 50
Claims (9)
1. a kind of ssDNA aptamer, which is characterized in that the nucleotides sequence of the ssDNA aptamer is classified as 5 '-GTC
TGAAGTAGACGCAGGAGAACTGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCACAGTCACACC
TGAGTAAGCGT-3’(SEQ ID NO:1)。
2. a kind of ssDNA aptamer, which is characterized in that the nucleotides sequence of the ssDNA aptamer is classified as 5 '-AAC
TGTATTAGCCTCTGGGTGCCGCACCGTAGTGCCCTATCTAACATCAC-3’(SEQ ID NO:2)。
3. ssDNA aptamer according to claim 1 or 2, which is characterized in that the ssDNA aptamer
Any position can be carried out phosphorylation, sulfhydrylation, methylation, amination or isotopologue reaction on nucleotide sequence.
4. ssDNA aptamer according to claim 1 or 2, which is characterized in that the ssDNA aptamer
Marker is combined on nucleotide sequence.
5. ssDNA aptamer according to claim 4, which is characterized in that the marker be selected from biotin, enzyme,
One of luminophore is a variety of.
6. ssDNA aptamer according to claim 5, which is characterized in that the luminophore is selected from isothiocyanic acid
One of fluorescein, carboxyl tetramethylrhodamine, hydroxyl fluorescein are a variety of.
7. a kind of screening technique of ssDNA aptamer as claimed in claim 1 or 2, which is characterized in that including following step
It is rapid:
Step 1: synthesize single-stranded DNA banks shown in following sequence and primer:
Random library Library50:
5’-GTCTGAAGTAGACGCAGGAG(50N)AGTCACACCTGAGTAAGCGT
5 ' primers: 5 '-FAM-GTCTGAAGTAGACGCAGGAG-3 '；
3 ' primers: 5 '-Biotin-ACGCTTACTCAGGTGTGACT-3 '；
Step 2: take the above-mentioned random library of 10nmol to be dissolved in 500 μ l PBS, the water bath with thermostatic control 5min at 92 DEG C, then rapidly
Carry out ice bath, ice bath 10min, the random library that takes that treated and GTONNV infection cell are incubated for 1h on ice；To hatching combination
After the completion, it is centrifuged and is removed supernatant, the PBS of 10mL is taken to wash GTONNV infection cell, and the water bath with thermostatic control 10min at 92 DEG C,
It is centrifuged 1-20min under conditions of 12000g, and collects supernatant, the supernatant is that specific recognition GTONNV infection is thin
The ssDNA aptamer library of born of the same parents；
Step 3: the ssDNA aptamer library for the identification GTONNV infection cell for taking 100ul to screen carries out PCR amplification,
Specific amplification program are as follows: 94 DEG C of 5min, 94 DEG C of 1min, 56 DEG C of 30sec, 72 DEG C of 1min are recycled, 72 DEG C by 20 wheels
5min；
Step 4: the magnetic bead that 100 μ l streptavidins mark is incubated at normal temperature with the resulting double-stranded DNA of PCR amplification in step 3
20min is educated, using the affinity interaction of streptavidin on the biotin and magnetic bead on double-stranded DNA, double-stranded DNA is integrated to magnetic bead
Magnetic bead is washed with 2mL PBS using supernatant is removed on magnetic separator in surface, and it is molten that 200ul NaOH is then added in EP pipe
Liquid (200mM), normal-temperature reaction 10min recycle to obtain supernatant using magnetic separation rack；
Step 5: except salt plug carries out salinity separation after taking step 4 gained supernatant that sterile water washing is added, under the effect of gravity certainly
It so drips off, 500 μ l PBS is added into the liquid being collected into, obtain the solution containing the single-stranded library DNA；
Step 6: taking the single-stranded library DNA obtained in step 5 to replace the random library in step 2, and step 2-5 is repeated 8 times；
Step 7: the DNA library for taking the screening of step 6 to obtain dissolves, after 92 DEG C of waters bath with thermostatic control, ice baths, normally thin with egg-shaped pompano
Born of the same parents are incubated for 1h on ice, and supernatant solution is collected by centrifugation after the completion of being incubated for；Then by this supernatant solution and egg-shaped pompano normal cell
Carry out ice bath combination；After the completion of hatching combination, supernatant is collected, the supernatant being collected into is the nucleic acid library by negative screening
Library；
Step 8: take in step 7 gained supernatant solution, successively according to step 3, step 4, step 5, step 7, step 2, step 3,
The experimental implementation of step 4 and step 5 sequence is repeated 8 times, and final acquired solution is ssDNA aptamer.
8. a kind of egg-shaped pompano source nervous necrosis virus for applying ssDNA aptamer as claimed in claim 1 or 2 is quick
Detection method, which comprises the following steps:
Step 1: biotin labeling is carried out to ssDNA aptamer；
Step 2: take sample to be tested 1-100mg to mix with the ssDNA aptamer that step 1 gained concentration is 100-200nM, and
Supernatant is removed in hatching combination 40min on ice, 1000g centrifugation；After hatching combination, sample to be tested is cleaned, is mixed in 200 μ l PBS
It in solution, is detected using flow cytometer, detects in sample to be tested whether have egg-shaped pompano source according to the variation of fluorescent value
Nervous necrosis virus.
9. purposes of the ssDNA aptamer as described in claim 1 in detection egg-shaped pompano source nervous necrosis virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811123360.5A CN109207480B (en) | 2018-09-26 | 2018-09-26 | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811123360.5A CN109207480B (en) | 2018-09-26 | 2018-09-26 | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109207480A true CN109207480A (en) | 2019-01-15 |
| CN109207480B CN109207480B (en) | 2021-08-27 |
Family
ID=64981575
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811123360.5A Active CN109207480B (en) | 2018-09-26 | 2018-09-26 | Aptamer specific for trachinotus ovatus nervous necrosis virus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109207480B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110257386A (en) * | 2019-07-04 | 2019-09-20 | 广西科学院 | The aptamer and its construction method of anti-I virus of grass carp GCRV and application |
| CN110257385A (en) * | 2019-07-04 | 2019-09-20 | 广西科学院 | Anti- grass carp exhales aptamer and its construction method and the application of the lonely I type virus of intestines |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858359A (en) * | 2017-12-01 | 2018-03-30 | 广西科学院 | It is a kind of can specific recognition vibrio alginolyticus aptamer and its application |
-
2018
- 2018-09-26 CN CN201811123360.5A patent/CN109207480B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858359A (en) * | 2017-12-01 | 2018-03-30 | 广西科学院 | It is a kind of can specific recognition vibrio alginolyticus aptamer and its application |
Non-Patent Citations (2)
| Title |
|---|
| LI P等: "First identification of the nervous necrosis virus isolated from cultured golden pompano (Trachinotus ovatus) in Guangxi, China", 《JOURNAL OF FISH DISEASES》 * |
| 蔡小辉等: "卵形鲳鲹一例疑似神经性病毒病的初步分析", 《水产科学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110257386A (en) * | 2019-07-04 | 2019-09-20 | 广西科学院 | The aptamer and its construction method of anti-I virus of grass carp GCRV and application |
| CN110257385A (en) * | 2019-07-04 | 2019-09-20 | 广西科学院 | Anti- grass carp exhales aptamer and its construction method and the application of the lonely I type virus of intestines |
| CN110257385B (en) * | 2019-07-04 | 2022-06-17 | 广西科学院 | Aptamer for resisting grass carp reovirus I, and construction method and application thereof |
| CN110257386B (en) * | 2019-07-04 | 2022-06-21 | 广西科学院 | Aptamer for resisting grass carp GCRV I virus as well as construction method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109207480B (en) | 2021-08-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111073892B (en) | Nucleic acid aptamer for identifying garrupa iridovirus infected cells, construction method and application thereof | |
| CN108034659A (en) | A kind of ssDNA aptamers and its vibrio alginolyticus quickly detection in application | |
| CN111073891B (en) | Aptamer for detecting grouper iridovirus as well as construction method and application thereof | |
| CN109161547A (en) | A kind of aptamer and its application in the pathogenic vibrio alginolyticus of detection | |
| CN105385691B (en) | For detecting the aptamer and detection kit of people's height transfer colon cancer cell line LoVo | |
| CN109136229A (en) | The aptamer of specific recognition egg-shaped pompano source nervous necrosis virus and its application | |
| CN107858358A (en) | A kind of ssDNA aptamers that can be identified and combine vibrio alginolyticus and its application | |
| CN113215167B (en) | Aptamer and application thereof in detecting cells infected by largemouth black bass iridovirus | |
| CN113249499B (en) | Salmonella typhi detection kit, and preparation method and application thereof | |
| CN104789568A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN110643611A (en) | Aptamer, construction method thereof and application thereof in detection of grouper iridovirus | |
| CN107858359A (en) | It is a kind of can specific recognition vibrio alginolyticus aptamer and its application | |
| CN109207480A (en) | Aptamer and its application of the specificity for egg-shaped pompano nervous necrosis virus | |
| Wang et al. | Simultaneous visual diagnosis of acute hepatopancreatic necrosis disease and Enterocytozoon hepatopenaei infection in shrimp with duplex recombinase polymerase amplification | |
| CN101381767B (en) | Universal real time fluorescent PCR detection method of trichinella | |
| CN109439801A (en) | A kind of honeybee Israel acute paralysis virus real-time fluorescent RT-PCR detection reagent box and its detection method | |
| CN109161548A (en) | Aptamer and its application in detection egg-shaped pompano source nervous necrosis virus | |
| CN109187970B (en) | It is a kind of quickly to detect aquatic products disease gold mark nucleic acid test strip and preparation method thereof | |
| CN113462693B (en) | Application of ssDNA aptamer in identifying largemouth black bass iridovirus infected cells | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| CN111454956B (en) | Nucleic acid aptamer for Chinese soft-shelled turtle iridovirus as well as construction method and application thereof | |
| CN111363749B (en) | Nucleic acid aptamer for detecting Chinese softshell turtle iridovirus as well as construction method and application thereof | |
| CN104789570B (en) | A kind of DNA aptamers for being used to detect grouper irido virus infection and its screening technique and application | |
| CN111363748B (en) | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus | |
| CN108004240A (en) | SsDNA aptamer and its application of one species specificity for vibrio alginolyticus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |