CN113215167A

CN113215167A - Aptamer and application thereof in detection of cells infected by iridovirus of micropterus salmoides

Info

Publication number: CN113215167A
Application number: CN202110566859.9A
Authority: CN
Inventors: 李鹏飞; 余庆; 刘明珠; 苏美珍; 卓晓菲; 王浩; 王高学
Original assignee: Guangxi Academy of Sciences
Current assignee: Guangxi Academy of Sciences
Priority date: 2021-05-24
Filing date: 2021-05-24
Publication date: 2021-08-06
Anticipated expiration: 2041-05-24
Also published as: CN113215167B

Abstract

The invention discloses a nucleic acid aptamer and application thereof in detecting cells infected by iridovirus of Lateolabrax japonicus, wherein the nucleotide sequence of the ssDNA nucleic acid aptamer is 5'-CACGGGGGGGATCGATATTGACTTGGTTCTGACTCACACCGTTACCTCTT-3' (SEQ ID NO: 1) or 5'-GACGCTTACTCAGGTGTGACTCGCACGGGGGGGATCGATATTGACTTGGTTCTGACTCACACCGTTACCTCTTCGAAGGACGCAGATGAAGTCTC-3' (SEQ ID NO: 2). The aptamer of the invention has specificity and high sensitivity to cells infected by the iridovirus of micropterus salmoides and has no immunogenicity. The aptamer has a stable structure, is easy to modify, is convenient to synthesize and store, and can be used for quickly and accurately detecting cells infected by the iridovirus of the micropterus salmoides.

Description

Aptamer and application thereof in detection of cells infected by iridovirus of micropterus salmoides

Technical Field

The invention relates to a nucleic acid aptamer and application thereof, in particular to a nucleic acid aptamer and application thereof in diagnosis, identification and detection of cells infected by largemouth black bass iridovirus.

Background

The largemouth black perch has become an important variety for freshwater aquaculture in China due to the fast growth speed and delicious meat quality, and the annual yield reaches 47 ten thousand tons. In recent years, with the increase of the culture density and the expansion of the culture scale of the micropterus salmoides, the problem of culture diseases is increasingly severe, and huge economic losses are caused. The outbreak of largemouth black bass cultured in ponds in spots such as Guangxi Nanning, Bai-Sha, Liuzhou, Hezhou and the like in 2019 shows that the symptoms of diseased fish are mainly manifested as body color blacking, large fester on the body surface, muscle necrosis with bleeding, red swelling and fester at the bases of pectoral fin, tail fin and dorsal fin, and swelling of the tissues of liver, spleen and kidney of the diseased fish. The iridovirus LMBV of the largemouth bass is proved to be the main pathogenic pathogen by analyzing and identifying the pathogenic microorganisms in the sick largemouth bass by Polymerase Chain Reaction (PCR). The LMBV virus is a highly pathogenic fish infectious virus, generally expressed as explosive infection, which can lead to mass death of fish in a very short time and cause huge loss to the largemouth black bass breeding industry.

The prevention and control of the aquatic epidemic disease should adhere to the principle of 'prevention is the main and the prevention and control are combined'. The core of disease prevention and control lies in deeply researching the pathogenic molecular mechanism of pathogen infection, and aiming at the rapid detection technology and the rapid detection kit which are convenient to develop and operate, low in cost, short in time consumption and high in accuracy for the pathogen, disease monitoring in the breeding process is enhanced, and the purposes of timely intervention and pathogen outbreak probability reduction are achieved by combining and using efficient disease-resistant medicines. At present, scientific researchers in China have developed various detection technologies aiming at iridovirus of micropterus salmoides, including a Polymerase Chain Reaction (PCR) technology based on molecular biology, a loop-mediated isothermal amplification (LAMP) technology, an immunoassay technology based on antibodies and the like, and the operability, the technical level and the like of partial products reach higher levels. The PCR technology is the most common pathogen detection technology in laboratories at present based on high sensitivity and high accuracy, but the PCR technology has various defects of complex operation, expensive instrument, long detection time consumption, harsh reagent storage conditions and the like, so that the PCR technology is only suitable for detecting a small amount of samples by professional technicians under laboratory conditions, and cannot meet the requirement of performing on-site high-flux rapid detection on LMBV virus in the culture process of the largemouth bass. Therefore, the method is important for developing a LMBV virus rapid detection technology and a functional product which are convenient to operate, low in cost, short in time consumption and high in accuracy and can be used for a culture site, and is used for discovering and determining pathogens as soon as possible and further purposefully formulating a treatment scheme to control pathogen diffusion and reduce loss.

The ligand phylogenetic Evolution technology (SELEX) of Exponential Enrichment is a biological library screening technology based on the knowledge of molecular biology: the specific interaction between nucleic acid molecule and protein molecule in vivo is the guarantee of orderly progress of a series of basic life activities such as gene transcription, nucleic acid replication, protein expression, etc. Basic principles of SELEX technology: artificially synthesizing single-stranded nucleic acid library (single-stranded DNA or RNA) containing about 40nt random sequences, wherein the possible sequences can reach 4 in theory⁴⁰And (4) seed preparation. The diversity of the primary sequence also results in the diversity of the secondary and tertiary structures of single-stranded DNA or RNA. Through multiple cycles of screening, various target substances, such as organic molecules of proteins, nucleic acids, small peptides, amino acids and the like, even metal ions, can theoretically find the nucleic acid sequence specifically and firmly combined with the different sequences and the nucleic acids with different spatial structures. After multiple rounds of circular screening and amplification of PCR/RT-PCR technology, and then clone sequencing identification, the nucleic acid chain-ligand of the section of specific sequence combined with the target substance can be obtained through mass production and purification, and the nucleic acid chain-ligand is also called as a nucleic acid aptamer or aptamer.

Aptamers are capable of binding specifically and strongly to a target substance and thus can act largely as antibodies and also in areas where some antibodies are not yet available. The aptamers can be used as diagnostic reagents, can be applied to various diagnostic modes alone or in combination with antibodies, and can also be applied to clinical treatment and the like.

The aptamer has the advantages of easy screening, easy modification, strong stability, high specificity, target molecule recognition and the like, and is developed into a novel detection and treatment tool which is widely concerned. First, the SELEX technique requires a short screening cycle, and usually, screening of aptamers requires 6 to 30 SELEX cycles, about 3 to 8 weeks. The time for screening and preparing specific biological antibodies aiming at target molecules is 3-8 months, and the antibodies have the problems of high cost, easy survival, rigorous storage conditions, different antibody qualities among batches and the like. Secondly, the SELEX technology is a chemical screening process performed in vitro, and therefore, target molecules range widely from simple systems such as metal ions and organic dyes to complex systems such as viruses, cells and tissues, and can be used as target molecules for SELEX screening, and particularly target molecules with cytotoxicity, non-immunogenicity or weak immunogenicity can be screened in vitro by using the SELEX technology. Therefore, the research of the aptamer is receiving wide attention from researchers in biochemistry, biomedicine, nano materials, protein science and other multiple subjects at home and abroad. At present, the aptamer has been developed into a class of novel detection and treatment tools which are of great interest, and the aptamer has wide application prospects in the fields of biomedical basic research and disease diagnosis of major diseases.

Disclosure of Invention

The invention aims to provide a nucleic acid aptamer for detecting cells infected by iridovirus of micropterus salmoides, which has high specificity, high sensitivity, no immunogenicity, stability and easy modification and is convenient to synthesize and store, so as to at least solve the problem that the existing biological detection technology can not quickly and accurately detect the cells infected by iridovirus of micropterus salmoides on site.

The invention aims to provide an aptamer capable of specifically identifying and detecting cells infected by largemouth black bass iridovirus, wherein the nucleotide sequence of the aptamer is 5'-CACGGGGGGGATCGATATTGACTTGGTTCTGACTCACACCGTTACCTCTT-3' (SEQ ID NO: 1).

Further, the nucleotide sequence of the aptamer is 5' -GACGCTTACTCAGGTGTGACTCGCACGG GGGGGATCGATATTGACTTGGTTCTGACTCACACCGTTACCTCTTCGAAGGACGCAGATGAAGTCTC-3’(SEQ ID NO：2)。

Still further, the nucleic acid aptamer has a label bound to its nucleotide sequence.

Still further, the label is selected from one or more of biotin, enzyme, and a luminescent group.

Further, the luminescent group is selected from one or more of fluorescent substances or luminescent materials such as Fluorescein Isothiocyanate (FITC), hydroxyfluorescein (6-methoxy-fluorescein, FAM), CY5 fluorescein (CY5 fluorescent dye), CY3 fluorescein (CY3 fluorescent dye), Carboxytetramethylrhodamine (TAMRA), and a Quencher for fluorescence (Black Hole Quencher, BHQ).

The invention also aims to provide a Fluorescent Molecular Probe (Aptamer LBVA1-Based Fluorescent Molecular Probe, LBVA1-AFMP) for quickly detecting cells infected by pathogenic largemouth bass iridovirus, which is Based on the Aptamer and is characterized in that the Molecular Probe contains the Aptamer. The iridovirus-infected cells of Lateolabrax japonicus were mixed with hydroxyfluorescein (6-methoxy-fluorescein, FAM) labeled SEQ ID: 1 or SEQ ID: 2, and detecting by using a flow cytometer after the aptamer shown in the figure is incubated, combined and cleaned, and detecting the cells infected by the iridovirus of the largemouth black bass according to the change of the fluorescence value. The LBVA1-AFMP can be applied to the development of a rapid detection kit for cells infected by the iridovirus of the micropterus salmoides based on the aptamer, is suitable for the large-scale rapid detection for diagnosing whether the micropterus salmoides are infected by the iridovirus of the micropterus salmoides, and has the advantages of short time consumption, simple and convenient operation, strong stability, high sensitivity and the like.

The invention also aims to provide the application of the aptamer in detecting cells infected by the iridovirus of the micropterus salmoides.

Compared with the prior art, the invention has the advantages that: the aptamer obtained by screening through the SELEX technology can identify cells infected by the iridovirus of the micropterus salmoides with high affinity and specificity, and the aptamer has no immunogenicity; the molecular weight is small, and the in vitro chemical synthesis is convenient; the preparation period is short; the reproducibility is good; the chemical group modification and substitution of different parts of the nucleic acid aptamer are easy to carry out; stable sequence, easy transportation and storage, etc. When the rapid detection method (LBVA1-AFMP) based on the aptamer is used for detecting the cells infected by the iridovirus of the micropterus salmoides, the operation is simple and rapid, and the method can be used for developing a related rapid detection kit. The method has important significance for the rapid detection of the cells infected by the iridovirus of the micropterus salmoides, and has good application prospect in the field of the detection of the iridovirus of the micropterus salmoides.

Drawings

FIG. 1 is a diagram of SEQ ID NO: 1 secondary structure prediction map of nucleic acid aptamers;

FIG. 2 is a schematic diagram of an embodiment of the present invention, which is a schematic diagram of a laser confocal microscope for detecting a hydroxyl Fluorescein (FAM) -labeled SEQ ID NO: 1 binding to iridovirus LMBV-infected cells of micropterus salmoides, control Library: hydroxyfluorescein (FAM) -labeled SEQ ID NO: 1 binding to normal cells;

fig. 3 is a flow cytometer for detecting hydroxyfluorescein (FAM) -labeled SEQ ID NO: 1 and iridovirus LMBV infected cells of Lateolabrax micropterus, control group 1: hydroxyfluorescein (FAM) -labeled SEQ ID NO: 1 binding to normal cells; control group 2: hydroxyfluorescein (FAM) -labeled SEQ ID NO: 1 binding to SGIV-infected cells of Epinephelus iridovirus; control group 3: hydroxyfluorescein (FAM) -labeled SEQ ID NO: 1 binding to a neurturin NNV-infected cell; control group 4: hydroxyfluorescein (FAM) -labeled SEQ ID NO: 1 and the combination of the gene and the cells infected by the Chinese softshell turtle iridovirus STIV.

Detailed Description

In order to make the technical solutions of the present invention better understood by those skilled in the art, the technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments.

Example 1 screening of aptamers

Step 1: synthesis of random Single-stranded DNA libraries and primers shown in the following sequence

Random initiation of single-stranded ssDNA Library:

5’-GACGCTTACTCAGGTGTGACTCG-N50-CGAAGGACGCAGAGAAGTCTC-3’

5' primer: 5 '-FAM-GACGCTTACTCAGGTGTGACTCG-3';

3' primer: 5' -Biotin-GAGACTTCATCTGCGTCCTTCG-3;

step 2: nucleic acid aptamer for specifically recognizing aquatic pathogenic bacteria largemouth bass iridovirus obtained by SELEX screening

2.1 dissolving 10nmol of the random library in 500 μ l PBS, carrying out thermostatic water bath at 92 ℃ for 5min, then quickly inserting into ice, carrying out ice bath for 10min, and incubating the treated random library and the iridovirus LMBV infected cells of the largemouth bass on the ice for 40 min;

2.2 after the incubation and combination are finished, centrifuging to remove the supernatant, washing the iridovirus LMBV infected cells of the micropterus salmoides by using 3mL of PBS, carrying out constant-temperature water bath at 92 ℃ for 10min, and centrifuging at 3000g to collect the supernatant, thus obtaining the single-stranded nucleic acid library for specifically identifying the iridovirus LMBV infected cells of the micropterus salmoides.

And step 3: PCR amplification screening library

The supernatants obtained after the first round of screening were all used for PCR amplification, and the specific amplification protocol was: 5min at 94 ℃, 1min at 94 ℃, 30sec at 56 ℃, 1min at 72 ℃ and 5min at 72 ℃ after 20 cycles. The second round and thereafter the obtained supernatants were screened, and 100. mu.l of the supernatants were used for PCR amplification.

And 4, step 4: preparation of DNA Single-stranded library

Incubating 100 mu l of streptavidin-labeled magnetic beads and the double-stranded nucleic acid library obtained by PCR amplification in the step 3 for 20min at normal temperature, utilizing the affinity action of biotin on double-stranded DNA and streptavidin on the magnetic beads to combine the double-stranded DNA to the surfaces of the magnetic beads, utilizing a magnetic separator to remove supernatant, washing the magnetic beads with 2mL of PBS, then adding 200ul of NaOH solution (200mM) into an EP (ultraviolet) tube, reacting for 10min at normal temperature, and recovering by utilizing a magnetic separation frame to obtain supernatant; and purifying and recovering the positive ssDNA single-stranded nucleic acid in the supernatant by using a PCR purification and recovery kit, and collecting a solution containing the ssDNA single-stranded library. :

and 5: screening was repeated as above

And (3) replacing the random library in the step (2) with the DNA single-stranded library obtained in the step (4), and repeating the positive screening process, the PCR amplification and the single-stranded DNA library preparation process shown in the step (2-4) for 9 times.

Step 6: negative selection

And in the second round and the subsequent rounds of screening, using normal FHM cells as a control, and carrying out negative screening on the ssDNA single-stranded library obtained by screening after the step 5 so as to improve the screening efficiency. The specific negative screening process is as follows: and dissolving the ssDNA library obtained by screening, incubating the ssDNA library with normal FHM cells for 1h on ice after thermostatic water bath and ice bath at the temperature of 92 ℃, centrifugally collecting a supernatant solution after incubation is finished, wherein the collected supernatant is the nucleic acid library subjected to negative screening.

Step 7: 10 rounds of screening

And (3) after the PCR amplification in the step (3) and the preparation of the single-stranded DNA library in the step (4) are carried out on the supernatant solution collected in the step (6), the steps of the step (6), the step (2), the step (3) and the step (4) are sequentially repeated, the change condition of the single-stranded DNA library on the identification capacity of the iridovirus LMBV infected cells of the micropterus salmoides is detected by using a flow cytometer, and the identification capacity of the nucleic acid library on the iridovirus LMBV infected cells of the micropterus salmoides reaches the strongest after 9 rounds of screening. And (3) after the obtained amplification product is subjected to clone sequencing analysis, finally obtaining the ssDNA aptamer which can be used for detecting the iridovirus LMBV infected cells of the largemouth bass in the embodiment, wherein the sequence is shown as SEQ ID NO: 1 is shown.

And 8: MFOLD software (http:// MFOLD. rna. albany. edu/: 1 secondary structure of the aptamer.

SEQ ID NO: 1 aptamer secondary structure prediction results are shown in fig. 1, aptamer SEQ ID NO: 1 form a special stem-loop structure.

And step 9: the method for detecting the molecular marker of the hydroxyfluorescein (FAM) labeled SEQ ID NO: 1 or SEQ ID NO: 2 binding effect and specificity of aptamer on Micropterus salmoides iridovirus LMBV infected cells

Aptamer SEQ ID NO: 1 and LMBV infected cells of largemouth black bass iridovirus as shown in the figure, and the results of confocal laser microscopy as shown in the figure 2 prove that, compared with the normal FHM cells of the control group, the results of the fluorescence labeling with hydroxyfluorescein (FAM) of SEQ ID NO: 1 or SEQ ID NO: 2 has high specific recognition capability on the iridovirus LMBV infected cells of the micropterus salmoides.

Step 10: flow cytometry was used to detect the hydroxyfluorescein (FAM) -labeled SEQ ID NO: 1 or SEQ ID NO: 2 binding effect and specificity of aptamer on Micropterus salmoides iridovirus LMBV infected cells

The incubation and combination process of the aptamer and the LMBV infected cells of the largemouth black bass iridovirus is shown as above, the detection result of the flow cytometry is shown in figure 3, and the result proves that compared with the cells of four groups of control groups, the expression of the aptamer labeled by hydroxyfluorescein (FAM) shown in SEQ ID NO: 1 or SEQ ID NO: 2 has high specific recognition capability on the iridovirus LMBV infected cells of the micropterus salmoides.

Example 2

The embodiment of the invention takes the SEQ ID NO: 1 or SEQ ID NO: 2 Aptamer, and assembling a Fluorescent Molecular Probe (Aptamer LBVA1-Based Fluorescent Molecular Probe, LBVA1-AFMP) kit to form the LBVA1-AFMP detection kit for the iridovirus-infected cells of the largemouth bass. The molecular probe contains the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 an aptamer.

The aptamer obtained by screening through the SELEX technology in the embodiment of the invention has good affinity and specificity, is stable in structure, still has good affinity and specificity after group marking and modification, can be applied to a fluorescent molecular probe detection kit, has the characteristics of short preparation period, good reproducibility and small molecular weight compared with a protein antibody, is convenient for in vitro synthesis, and has good application prospect in the field of detection of aquatic pathogenic bacteria largemouth bass iridovirus.

Finally, it should be noted that the above-mentioned embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the same, and although the present invention is described in detail with reference to the above-mentioned embodiments, it should be understood by those skilled in the art that the modifications and equivalents of the specific embodiments of the present invention can be made by those skilled in the art after reading the present specification, but these modifications and variations do not depart from the scope of the claims of the present application.

Sequence listing

<110> Guangxi academy of sciences

<120> aptamer and application thereof in detection of cells infected by iridovirus of micropterus salmoides

<130> 2021

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 50

<212> DNA

<213> Artificial sequence

<400> 1

cacgggggggatcgatattgacttggttctgactcacaccgttacctctt 50

<210> 2

<211> 95

<212> DNA

<213> Artificial sequence

<400> 2

gacgcttactcaggtgtgactcgcacgggggggatcgatattgacttggttctgactcac 60

accgttacctcttcgaaggacgcagatgaagtctc 95

Claims

1. An aptamer for identifying and detecting cells infected by largemouth black bass iridovirus, wherein the nucleotide sequence of the aptamer is 5'-CACGGGGGGGATCGATATTGACTTGGTTCTGACTCACACCGTTACCTCTT-3'.

2. An aptamer for identifying and detecting cells infected by largemouth black bass iridovirus, wherein the nucleotide sequence of the aptamer is 5'-GACGCTTACTCAGGTGTGACTCGCACGGGGGGGATCGATATTGACTTGGTTCTGACTCACACCGTTACCTCTTCGAAGGACGCAGATGAAGTCTC-3'.

3. The aptamer according to claim 1 or 2, wherein a label is bound to the nucleotide sequence of the aptamer.

4. The aptamer according to claim 3, wherein the label is selected from one or more of biotin, an enzyme, and a luminescent group.

5. The aptamer according to claim 4, wherein the luminescent group is selected from one or more of fluorescein isothiocyanate, hydroxyfluorescein, CY5 fluorescein, CY3 fluorescein and carboxytetramethylrhodamine.

6. A kit for identifying and detecting iridovirus-infected cells of Lateolabrax japonicus, said kit comprising the aptamer according to any one of claims 1 to 5.

7. A method for detecting a fluorescent molecular probe using the aptamer according to claim 1 or 2, comprising the steps of:

step 1: carrying out hydroxyl fluorescein labeling on the aptamer;

step 2: mixing 1-100mg of a sample to be detected with the aptamer with the concentration of 100-; centrifuging to remove supernatant, washing a sample to be detected, and detecting by using a flow cytometer.

8. Use of the aptamer according to claim 1 or 2 for detecting iridovirus-infected cells of micropterus salmoides.