WO2017122897A1 - Genetic marker for detecting causative virus of red sea bream iridoviral disease, and causative virus detection method using same - Google Patents

Abstract

The present invention relates to a genetic marker for discriminating and detecting a causative virus of a marine creature infectious disease, i.e., the causative virus of red sea bream iridoviral disease, and a causative virus discrimination and detection method using same and, more specifically, to a method comprising: selecting and amplifying a DNA base sequence for coding (I) a particular gene of red sea bream iridovirus (RSIV)/infectious spleen and kidney necrosis virus (ISKNV) or (ii) a particular gene which discriminates RSIV from RSIV/RSKNV; then hybridizing a peptide nucleic acid (PNA) which specifically recognizes the amplified product; obtaining a temperature-based melting curve by controlling the temperature of the hybridized product; and determining a virus type from a melting temperature through the analysis of the obtained melting curve, or detecting the status of infection of fishes with the virus type.

Description

Genetic markers for detecting causative viruses of red sea bream iridovirus, and methods for detecting causal viruses using the same

The present invention relates to a gene marker for the identification and detection of the causative virus of sea bream iridovirus disease, which is the causative virus of aquatic organisms, and to a method for discriminating and detecting the causal virus using the same. Iridovirus (RSIV) / specific genes of Infectious Spleen and Kidney Necrosis Virus (ISKNV); Or (ii) selecting and amplifying a DNA sequence encoding a specific gene that distinguishes RSIV from RSIV / RSKNV, and then hybridizing and hybridizing a peptide nucleic acid (PNA) that specifically recognizes the amplification product. The present invention relates to a method of obtaining a melting curve for each temperature by controlling a temperature of a product, and determining a virus type from a melting temperature or analyzing whether a fish is infected with the virus type by analyzing the obtained melting curve.

Red sea bream iridoviral disease (RSIVD) is a viral disease that causes serious damage in major marine fish farming in Korea.

Various molecular diagnostic methods and kits have been developed as a method for diagnosing fish viral diseases, and after performing a general polymerase chain reaction (PCR) method, an amplification product of the reaction is confirmed by electrophoresis or a TaqMan probe. Or, the method of confirming with real-time PCR using SYBR Green is mainly used.

Currently, conventional PCR (conventional PCR) method, which is a general gene diagnosis method, is designated as a standard diagnosis method for statutory infectious diseases. In the case of RSIV / ISKNV, a real-time PCR-based diagnostic method has not been developed. Therefore, PCR amplification products have been confirmed by electrophoresis by performing conventional PCR method, and then the World Organization for Animal Health (OIE) It is prescribed to carry out the diagnosis according to the criteria of the Aquatic Animal Health Code. In order to diagnose RSIVD, RSIV, which is a DNA virus due to the nature of these viruses, has a disadvantage of separating DNA from infected tissue and proceeding with PCR. Therefore, no diagnostic method for simultaneously analyzing RSIV / ISKNV has been reported.

Red sea bream iridovirus disease (RSIVD) not only occurs mainly in cultured red snapper, but is also an important cause of death in more than 30 marine cultured fishes, and is known to occur mainly in perch and flounder. The first occurrence of RSIVD was recorded in 1990 from aquaculture red snapper on Shikoku Island, Japan, and RSIVD has become a major cause of mass mortality in red snapper.

Recently, the infectious spleen and Kidney Necrosis Virus (ISKNV) of the Iridovirus family has been identified as the causative virus of RSIVD. Therefore, RSIV and ISKNV should be simultaneously analyzed for accurate diagnosis of RSIVD. There is. For the diagnosis of RSIV / ISKNV, serological methods such as staining using tissue smear samples and IFAT using MAbs are used.In the case of molecular diagnosis, conventional PCR using two types of primers is performed according to OIE standard. do.

For the diagnostic PCR of RSIV / ISKNV according to the OIE standard, primer pairs, OIE protocol 1 (OIE 1), OIE protocol 2 (OIE 4) (Kurita et al., 1998) are secured, and RSIV / ISKNV is used when OIE 1 is used. While all can be detected, only RSIV can be detected when using OIE 4. Therefore, for the diagnosis and determination of RSIV / ISKNV, two PCR steps should be performed according to the OIE standard.

Under this technical background, the present inventors discriminate fish disease virus without sequencing step or before sequencing step whether RSIV / ISKNV or PCR product for identifying or detecting RSIV / ISKNV or RSIV, which is the causative virus of aquatic biological infection, Efforts have been made to develop methods for detecting virus-infected individuals (e.g. fish), resulting in fish disease-causing Red Sea Bream Iridovirus (RSIV) / Infectious Spleen and Kidney Necrosis Virus. , ISKNV) or a nucleotide sequence of a specific gene that distinguishes RSIV from RSIV / RSKNV is selected as a gene marker for virus type discrimination and / or detection, using peptide nucleic acid and primer pairs specific for the gene marker. Different virus types show different amplification and melting curves of fluorescence By ensuring that the effect of a simple, rapid, accurate determination of the type of fish diseases causing virus, and have completed the present invention.

Summary of the Invention

An object of the present invention is to provide a genetic marker, primer pair, and PNA probe for the identification or detection of the causative virus of sea bream iridovirus disease which is a marine organism infectious disease causative virus.

Another object of the present invention is to provide a composition and kit for discriminating or detecting a causative virus of red seabream iridovirus disease comprising the primer pair and the PNA probe.

Another object of the present invention is to determine the type of the causal virus or cause the individual by obtaining the Tm value according to hybridization of the PNA probe to the region of the virus marker gene specific virus markers amplified using the primer pair The present invention provides a method for detecting a virus infection.

In order to achieve the above object, the present invention is to determine or detect the Red Sea Bream Iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV), a causative agent of aquatic organisms infectious disease represented by the nucleotide sequence of SEQ ID NO: 7 Provide a genetic marker for

The present invention also provides a genetic marker for the identification or detection of Red Sea Bream Iridovirus (RSIV), which is a causative agent of aquatic organisms infectious disease represented by the nucleotide sequence of SEQ ID NO: 8.

The present invention is also used for the identification or detection of Red Sea Bream Iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV), a causative agent of aquatic organisms infectious diseases represented by the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 Provide primer pairs.

The present invention also provides a primer pair for the identification or detection of Red Sea Bream Iridovirus (RSIV), which is a causative agent of aquatic organisms infectious diseases represented by the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6.

The present invention also provides a PNA probe for the identification or detection of Red Sea Bream Iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV), a causative agent of aquatic organisms infectious disease represented by the nucleotide sequence of SEQ ID NO: 1 do.

The present invention also provides a PNA probe for discriminating or detecting red sea bream iridovirus (RSIV), which is a causative agent of aquatic organisms infectious disease represented by the nucleotide sequence of SEQ ID NO: 2.

The present invention also provides a composition and kit for discriminating or detecting a causative virus of aquatic infectious diseases comprising the primer pair and the PNA probe.

The present invention also provides

(a) extracting a target nucleic acid from a sample sample;

(b) amplifying a gene marker sequence of the aquatic infectious agent causative virus included in the target nucleic acid using the primer pairs, and hybridizing the PNA probe to the amplified gene marker sequence fragment;

(c) obtaining a melting curve for each temperature while increasing the temperature of the product hybridized with the PNA probe in step (b); And

(d) determining the virus type of the causative virus of aquatic organisms infectious diseases from the melting temperature or detecting whether the fish is infected with the virus type by analyzing the melting curve obtained in step (c);

It provides a method for determining or detecting aquatic infectious diseases causal virus comprising a.

1 is a conceptual diagram showing the technical characteristics of the step of obtaining the amplification curve for determining the virus type or virus infection of the individual.

2 is a schematic diagram showing a step of obtaining a melting curve according to hybridization of peptide nucleic acids in a virus type determination method and an individual virus infection detection method.

Figure 3 is a gene position diagram for explaining the nucleotide sequence region included in the primer and peptide nucleic acid in the amplification product derived by the detection "PCR protocol 1 (OIE 1)" method according to the OIE standard of RSIV / ISKNV.

Figure 4 is a gene position diagram for explaining the nucleotide sequence region contained in the primer and peptide nucleic acid in the amplification product derived by the detection "PCR protocol 2 (OIE 4)" method according to the OIE standard of RSIV

5 and 6 show amplification curves and melting curves according to the RSIV / ISKNV detection method using primers and peptide nucleic acids for each virus type described in FIGS. 1 to 4.

Detailed description of the invention and preferred Embodiment

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

In one aspect, the present invention provides a marker for identifying RSIV / ISKNV, which is a causative agent of red snapper virus, and developing a method for detecting an individual (eg, a fish) infected with the causative virus. And a causal virus of aquatic organism infectious disease using a primer pair and a peptide nucleic acid probe (PNA probe) for determining the virus type corresponding to the marker, and the type of each causal virus could be determined.

In more detail, the cause virus can be identified / detected by type,

(1) an oligomer mixture comprising a PNA probe for RSIV / ISKNV detection (SEQ ID NO: 1) and a primer pair (SEQ ID NO: 3 and SEQ ID NO: 4) capable of simultaneously detecting RSIV and ISKNV; And

(2) oligomer mixtures comprising a detection PNA probe (SEQ ID NO: 2) and a primer pair (SEQ ID NO: 5 and SEQ ID NO: 6) specific for RSIV;

Using the composition or kit comprising a red sea bream iridovirus causative virus was able to detect and determine the type of each causal virus.

Accordingly, the present invention, in one aspect, for the identification or detection of Red Sea Bream Iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV), which is the causative agent of aquatic organisms infectious disease represented by the nucleotide sequence of SEQ ID NO: 7 It relates to genetic markers.

In another aspect, the present invention relates to a genetic marker for identifying or detecting red sea bream iridovirus (RSIV), which is a causative agent of aquatic organisms infectious disease represented by the nucleotide sequence of SEQ ID NO: 8.

In another aspect, the present invention, the determination of the Red Sea Bream Iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV), a causative agent of aquatic organisms infectious diseases represented by the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 Or to a primer pair for detection.

In another aspect, the present invention relates to a pair of primers for the identification or detection of Red Sea Bream Iridovirus (RSIV), a causative agent of aquatic organisms infectious diseases represented by the nucleotide sequences of SEQ ID NOs: 5 and 6.

In another aspect, the present invention provides a PNA for the determination or detection of Red Sea Bream Iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV), which is a causative agent of aquatic organisms infectious disease represented by the nucleotide sequence of SEQ ID NO: 1 Relates to a probe.

In still another aspect, the present invention relates to a PNA probe for discriminating or detecting red sea bream iridovirus (RSIV), which is a causative agent of aquatic biological infectious disease represented by the nucleotide sequence of SEQ ID NO: 2.

In the PNA probe of the present invention, a reporter and a fluorescent material of a quencher capable of quenching the reporter fluorescence may bind to both ends. The reporter is reported as FAM (6-carboxyfluorescein), Texas red, HEX (2 ', 4', 5 ', 7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3 and Cy5. At least one selected from the group consisting of, the quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl, but is not limited thereto, preferably Dabcyl You can use (FAM-labeled).

Peptide nucleic acid (PNA) was first synthesized by Nielsen et al. In 1991 as a similar DNA in which nucleic acid bases are linked by peptide bonds rather than phosphate bonds. PNA is not found in nature but is artificially synthesized by chemical methods.

Peptide nucleic acid is artificially synthesized as one of the gene recognition materials, such as LNA (Locked nucleic acid) or MNA (Mopholino nucleic acid), the basic skeleton is composed of polyamide (polyamide). PNA has very high affinity and selectivity, and has high stability against nucleases, so that it is not degraded by existing restriction enzymes. In addition, there is an advantage that the thermal properties and chemical properties are high and easy to store and not easily decomposed.

PNAs form double strands through hybridization with native nucleic acids of complementary base sequences. PNA / DNA double strands are more stable than DNA / DNA double strands and PNA / RNA double strands are more stable than DNA / RNA double strands. In addition, PNA has a greater ability to detect single nucleotide polymorphism (SNP) than natural nucleic acid because of its large degree of double strand instability due to single base mismatch.

In addition, the PNA-DNA binding ability is much better than the DNA-DNA binding force, so that there is a difference of about 10 to 15 ° C even in one nucleotide miss match. By using the difference in binding force, it is possible to detect SNP (Single-nucleotide polymorphism) and change in nucleotides of In / Del.

The length of the PNA sequence according to the present invention is not particularly limited, but may be produced in a length of 12 to 18mer so as to include a specific sequence (eg, nucleotide variation or single nucleotide polymorphism (SNP)) according to the virus type. have. In this case, the PNA probe may be designed to have a desired Tm value by adjusting the length of the PNA probe, or even a PNA probe of the same length may be adjusted by changing the base sequence. In addition, PNA probes have a higher binding force than DNA and have a higher basic Tm value, so that the PNA probe can be designed with a shorter length than DNA, so that even neighboring base mutations or SNPs can be detected. According to the existing High Resolution Melt (HRM) method, the difference in Tm value is very small, about 0.5 ° C, which requires additional analysis program or detailed temperature change or correction. Therefore, when two or more base mutations or SNPs appear, the analysis is performed. Although it was difficult, the PNA probe according to the present invention is not affected by the sequence and SNP of the PNA probe, and thus can be easily analyzed.

As in the present invention, when the PNA probe includes 14 base sequences, it is preferable to have a sequence corresponding to the base mutation or SNP region of the virus at one or more positions of the center sequences. In addition, the PNA probe may have a structural modification including a sequence corresponding to a nucleotide variation or SNP site of the virus in the center of the base sequence, through which the melting temperature with the perfect nucleic acid (perfect match) Tm) can make the difference even larger.

In still another aspect, the present invention relates to a composition and kit for determining or detecting aquatic infectious agent causative virus comprising the primer pair and the PNA probe.

In one aspect, the present invention provides a composition for detecting a red seabream iridovirus causative virus comprising a primer pair represented by a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, and a PNA probe represented by a nucleotide sequence of SEQ ID NO: 1 Can provide.

In another embodiment, Red Sea Bream Iridovirus (RSIV) comprising a primer pair represented by the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 2 It is possible to provide a kit for discrimination or detection.

According to another aspect of the present invention, there is provided a kit for detecting a red snapper virus causing virus comprising a primer pair represented by a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, and a PNA probe represented by a nucleotide sequence of SEQ ID NO: 1. Can provide.

In another embodiment, Red Sea Bream Iridovirus (RSIV) comprising a primer pair represented by the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 2 The composition for determination or detection of can be provided.

The kits of the present invention may optionally include reagents necessary to conduct target nucleic acid amplification reactions (eg, PCR reactions) such as buffers, DNA polymerase cofactors and deoxyribonucleotide-5-triphosphates. Optionally, the kits of the present invention may also include various polynucleotide molecules, reverse transcriptases, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. In addition, the optimum amount of reagent used in a particular reaction of the kit can be easily determined by those skilled in the art having learned the disclosure herein. Typically, the equipment of the present invention can be manufactured in a separate package or compartment containing the aforementioned components.

The kit may consist of a PNA-based multiple assay kit capable of detecting and / or discriminating gene sequences for distinguishing RSIV / ISKNV, comprising one 2x qPCR premix tube and one oligomer mix tube. tube), wherein the oligomer mixture may be characterized by comprising one or more TaqMan probes, PNA probes of SEQ ID NO: 1 or SEQ ID NO: 2 and primers selected from two or more primers of SEQ ID NO: 3 to SEQ ID NO: 6 (See Table 1).

Using the kit, a single base mutation of a target nucleic acid and a mutation due to a deletion or insertion of a base can be effectively detected through a lysis curve analysis by a PNA probe, and thus the species of a virus can be determined.

On the other hand, the present invention (i) specific genes of Red Sea Bream Iridovirus (RSIV) / Infectious Spleen and Kidney Necrosis Virus (ISKNV); Or (ii) performing detection PCR according to OIE criteria for RSIV and / or RSKNV for identification or detection according to a specific gene that distinguishes RSIV from RSIV / RSKNV, and then sequenced the gene sequence corresponding to the PCR product. Comparative analysis was performed to prepare a PNA probe represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, PNA to the PCR amplification products synthesized using the primers represented by the PNA and the nucleotide sequence of SEQ ID NO: 3 to SEQ ID NO: 6 From the melting curve obtained by hybridizing the probe, the melting temperature (Tm) was confirmed to determine and detect RSIV and / or RSKNV.

Therefore, in another aspect, the present invention,

(a) extracting a target nucleic acid from a sample sample;

(b) a primer pair represented by a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 or a primer pair represented by SEQ ID NO: 5 and SEQ ID NO: 6 Amplifying using a pair, and hybridizing the PNA probe of any one of claims 4 to 8 to the amplified gene marker sequence fragment;

(c) obtaining a melting curve for each temperature while increasing the temperature of the product hybridized with the PNA probe in step (b); And

(d) determining the virus type of the causative virus of aquatic organisms infectious diseases from the melting temperature or detecting whether the fish is infected with the virus type by analyzing the melting curve obtained in step (c);

It relates to a method for determining or detecting aquatic infectious agent virus comprising a.

In one aspect of the present invention,

(a) extracting a target nucleic acid from a sample sample;

(b) amplifying the gene marker sequence of the red snapper virus causing virus included in the target nucleic acid using a primer pair represented by the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, and amplified the gene marker sequence fragment Hybridizing the PNA probe represented by SEQ ID NO: 1;

(c) obtaining a melting curve for each temperature while increasing the temperature of the product hybridized with the PNA probe in step (b); And

(D) through the analysis of the melting curve obtained in the step (c) it can provide a method for detecting a red seabream iridovirus causal virus comprising the step of detecting whether or not the sea urchin seaweed virus causing virus from the melting temperature.

In another aspect of the present invention,

(a) extracting a target nucleic acid from a sample sample;

(b) amplifying the gene marker nucleotide sequence of the red snapper idoidovirus included in the target nucleic acid using a primer pair represented by the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, and sequence number 2 to the amplified gene marker sequence fragment Hybridizing a PNA probe represented by;

(c) obtaining a melting curve for each temperature while increasing the temperature of the product hybridized with the PNA probe in step (b); And

(d) detecting red sea bream iridovirus (RSIV) from the melting temperature by analyzing the melting curve obtained in step (c) or determining whether the virus is infected with red sea bream iridovirus (red) Sea Bream Iridovirus (RSIV) can be provided for the identification or detection method.

In the present invention, in the step (b), the amplification curve may be obtained by additionally including a TaqMan probe when amplifying the gene marker sequence using the primer pair.

In the present invention, two or more target nucleic acids are used, and the reporter labeled on the PNA probe is different for each target nucleic acid, thereby determining or detecting the virus type of at least one aquatic infectious agent causative virus through detection of the two or more target nucleic acids. You can do

In the present invention, the amplification may be performed by a real-time polymerase chain reaction (PCR) method.

In the present invention, a "sample sample" includes various samples, and preferably, a biosample is analyzed using the method of the present invention. More preferably, the sample may be a sample mixed with the virus species described in the present invention or a sample of an individual infected with the virus (for example, fish, etc.), and may be a plant, animal, human, fungus, bacteria, or organism of viral origin. Samples can be analyzed. When analyzing a sample of mammalian or human origin, the sample may be derived from a specific tissue or organ. Representative examples of tissues include connective, skin, muscle or nerve tissue. Representative examples of organs include eyes, brain, lungs, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testes, ovaries, uterus, rectum, nervous system, Glands and internal vessels are included. The biosample to be analyzed includes any cell, tissue, fluid from a biological source, or any other medium that can be well analyzed by the present invention, which is the consumption of humans, animals, humans or animals. Samples obtained from food prepared for use are included. In addition, the biological sample to be analyzed includes a bodily fluid sample, which includes blood, serum, plasma, lymph, breast milk, urine, feces, ocular fluid, saliva, semen, brain extracts (e.g., brain grinds), spinal fluid, appendix, spleen And tonsil tissue extracts, but is not limited thereto.

'Target nucleic acid', 'synthetic DNA' or 'synthetic oligo' of the present invention means a nucleic acid sequence (including base mutation or SNP) to be detected or not, and encodes a protein having a physiological and biochemical function. A specific site of the nucleic acid sequence of the target gene 'and is annealed or hybridized with a primer or probe under hybridization, annealing or amplification conditions.

By 'hybridization' of the present invention is meant that complementary single stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur when the complementarity between two nucleic acid strands is perfect or even when some mismatch base is present. The degree of complementarity required for hybridization may vary depending on the hybridization conditions, and may be particularly controlled by temperature.

In the present invention, the melting curve analysis may be performed by a method of Fluorescence Melting Curve Analysis (FMCA).

The PNA probe including the reporter and the quencher of the present invention hybridizes with the target nucleic acid and generates a fluorescence signal, and as the temperature increases, the PNA probe rapidly melts with the target nucleic acid at an appropriate melting temperature of the probe, thereby extinguishing the fluorescent signal. By analyzing the high-resolution melting curve obtained from the fluorescent signal according to the presence or absence of base denaturation (including base mutation or SNP) of the target nucleic acid can be detected. The PNA probe shows the expected melting temperature (Tm) value when it is in perfect hybridization with the target nucleic acid sequence, but is incompletely mismatched with the target nucleic acid in which the base mutation is present. It is characterized by showing (Tm) value.

The 'base mutation' of the present invention is a mutation in the nucleotide sequence of the target nucleic acid, characterized in that it comprises a single nucleotide polymorphism (SNP), as well as a mutation occurs by substitution, deletion or insertion of the base In addition, the PNA probe of the present invention may be analyzed through a melting curve analysis that a mutation occurs due to substitution, deletion or insertion of the SNP of the target nucleic acid or the base of the target nucleic acid.

In the PNA probe of the present invention, a reporter and a fluorescent material of a quencher capable of quenching the reporter fluorescence may bind to both ends. The reporter is reported as FAM (6-carboxyfluorescein), Texas red, HEX (2 ', 4', 5 ', 7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3 and Cy5. At least one selected from the group consisting of, the quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl, but is not limited thereto, preferably Dabcyl You can use (FAM-labeled).

The Tm value is also changed according to the difference between the nucleotides of the PNA probe and the nucleotides of the DNA complementarily binding thereto, thereby facilitating the development of an application using the same. PNA probes are analyzed using a hybridization method that is different from the hydrolysis method of TaqMan probes. Probes that play similar roles include molecular beacon probes and scorpion probes. There is.

For analysis of specific sequences (e.g., nucleotide or SNP) using PNA probes, all you need is a probe containing a base (s) that recognizes a particular sequence and a set of forward / reverse primers for PCR. Do. The PCR conditions can be used in the conventional method, after the completion of the PCR (melting) process is required and each time the increase in 0.5 ℃ to obtain the Tm value by measuring the intensity of fluorescence. In particular, the general real-time PCR (real-time PCR) device is widely spread and has the advantage that does not require additional program purchase or minute temperature changes, such as high resolution melting (HRM).

The melting curve analysis of the present invention is a method for analyzing the melting temperature of a double-stranded nucleic acid formed of a target nucleic acid DNA or RNA and a probe. Such a method is called a melting curve analysis because it is performed by Tm analysis or analysis of the said double chain melting curve, for example. Using a probe complementary to a particular nucleotide sequence (including base mutation or SNP) of the detection target (target), a hybrid (double chain DNA) of the target single-stranded DNA of the detection sample with the probe is formed. Subsequently, heat processing is performed to this hybrid formation body, and the dissociation (fusion) of a hybrid with temperature rise is detected by the change of signals, such as absorbance. Then, the Tm value is determined based on the detection result to determine the presence or absence of a specific nucleotide sequence. The Tm value is higher as the homology of the hybrid body is higher, and lower as the homology is lower. For this reason, the Tm value (evaluation reference value) is calculated | required beforehand about the hybrid formation of the specific base sequence of a detection object, and the probe complementary to it, and the Tm value (measured value) of the target single-stranded DNA of a detection sample and the said probe is measured previously. If the measured value is about the same as the evaluation reference value, it can be determined that there is a match, that is, a specific sequence exists in the target DNA, and if the measured value is lower than the evaluation reference value, there is a mismatch, that is, a mutation in the target DNA. You can judge that you do not.

Fluorescence melting curve analysis of the present invention is a method of analyzing the melting curve using a fluorescent material, more specifically, the melting curve can be analyzed using a probe containing a fluorescent material. The fluorescent material may be a reporter and a quencher, and may be an intercalating fluorescent material.

The Real-Time Polymerase Chain Reaction (PCR) method of the present invention allows the fluorescent material to be interchelated with a double strand DNA chain during the PCR process and increases the temperature with the amplification of the PCR product. By releasing the double strands, the pattern of the melting curve that reduces the amount of fluorescent material present between the double strands of DNA, in particular the temperature (Tm) at which the DNA is fused (denatured) is analyzed to determine the specific sequence (base mutation, including SNP). With or without virus types can be detected and / or determined.

1 or 2 is a conceptual diagram illustrating the technical features of the peptide nucleic acid for virus detection or detection according to an embodiment, as shown here, the PNA probe may generate a fluorescent signal after hybridization with a target nucleic acid. As the temperature increases, it rapidly melts from the target nucleic acid at the proper melting temperature of the probe, thereby extinguishing the fluorescent signal. The present invention is capable of detecting the presence or absence of base mutation of the target nucleic acid through high resolution fluorescence melting curve analysis (FMCA) obtained from the fluorescence signal according to the temperature change. The PNA probe according to the present invention shows the expected melting temperature (Tm) value when it is in perfect hybridization with the target nucleic acid sequence, but is incompletely mismatched with the target nucleic acid in which the base mutation is present. It may be characterized by showing a low melting temperature (Tm) value.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example 1: Gene marker for discrimination or detection of causative virus of sea bream iridovirus, and primer and PNA probe specific for the virus

1-1: Red Sea Bream Iridovirus (RSIV) / Infectious Spleen and Kidney Necrosis Virus (ISKNV)

The sequence of the gene fragment synthesized by the "PCR protocol 1 (OIE 1)" method for detecting the OIE standard of RSIV / ISKNV is transferred to the nucleotide database (nucleotide database) of the National Center for Biotechnology Information (NCBI). By comparing with the registered nucleotide sequence, we tried to secure the nucleotide sequence of the gene for each virus type.

As a result, a common nucleotide sequence of RSIV / ISKNV represented by 5'-CCATGTACAACATGCTC-3 '(SEQ ID NO: 7) was secured, and the nucleotide sequence was selected as a gene marker for identifying or detecting RSIV / ISKNV.

In addition, a primer pair (Forward primer 1, Reverse primer 1) represented by SEQ ID NO: 3 and SEQ ID NO: 4 as a primer for DNA amplification of the genetic marker and PNA 1 represented by SEQ ID NO: 1 as a hybridization probe of the genetic marker Produced.

3 is a nucleotide sequence diagram showing a part of the gene of RSIV / ISKNV, a base sequence for discrimination / detection, and a base sequence of PNA derived therefrom, and the base sequence of the PNA probe is indicated in blue.

1-2: Causes of Sea Bream Iridovirus Virus: RSIV

The sequence of the gene fragment synthesized by the "PCR protocol 2 (OIE 4)" method for detecting the OIE standard of RSIV / ISKNV is transferred to the nucleotide database (nucleotide database) of the National Center for Biotechnology Information (NCBI). By comparing with the registered nucleotide sequence, we tried to secure the nucleotide sequence of the gene for each virus type.

As a result, a base sequence having a single nucleotide polymorphism (SNP) of RSIV capable of discriminating between RSIV and ISKNV represented by 5'-ACCAAGTTCATCATCT-3 '(SEQ ID NO: 8) is obtained, and the base sequence is RSIV. As a genetic marker for the determination or detection of.

In addition, a primer pair (Forward primer 2, Reverse primer 2) represented by SEQ ID NO: 5 and SEQ ID NO: 6 as a primer for DNA amplification of the genetic marker and PNA 2 represented by SEQ ID NO: 2 as a hybridization probe of the genetic marker Produced.

4 is a nucleotide sequence diagram showing an example of a part of the gene of RSIV / ISKNV and a base sequence for discrimination / detection and a PNA derived therefrom, and the base sequence of the PNA probe is indicated in blue.

As such, the PNA probe and primer sequences according to the present invention were determined and shown in Table 1.

division	name	SEQ ID NO:	Sequence (5 '-> 3')	Deformation (Fluorescent Reporter)	target
PNA probe		PNA 1	SEQ ID NO: 1	CCATGTACAACATGCTC	TexasRed, Dabsyl	RSIV, ISKNV
	PNA 2	SEQ ID NO: 2	AGATGATGAACTTGGT	Cy5, Dabsyl	RSIV
primer		Forward primer 1	SEQ ID NO: 3	CTCAAACACTCTGGCTCATC	ㅡ	RSIV, ISKNV
	Reverse primer 1	SEQ ID NO: 4	GCACCAACACATCTCCTATC	ㅡ	RSIV, ISKNV
	Forward primer 2	SEQ ID NO: 5	CGGGGGCAATGACGACTACA	ㅡ	RSIV
Reverse primer 2	SEQ ID NO: 6	CCGCCTGTGCCTTTTCTGGA	ㅡ	RSIV
Virus markers		VM 1	SEQ ID NO: 7	CCATGTACAACATGCTC	ㅡ	RSIV / ISKNV
	VM 2	SEQ ID NO: 8	ACCAAGTTCATCATCT	ㅡ	RSIV

TaqMan and PNA probes were prepared by combining FAM, TexasRed and Cy5, respectively, so that the same fluorescence was not included. Then, PNA probes were prepared using the nucleotide sequences, reporters, and quenchers as shown in Table 1. The PNA probe used in the present invention was designed using PNA probe designer (Applied biosystems, USA), PNA probe was synthesized by HPLC purification method in Panazine (Panagene, Korea), the purity of all synthesized probes using mass spectrometry (Needed to avoid unnecessary secondary structures of the probe for more effective binding with the target nucleic acid).

Example 2 Establishment of Real-Time PCR for Discrimination or Detection of Viruses

Using the PNA probe and primer prepared in Example 1, amplification curves and lysis curves were derived for DNA samples of red snapper Iridovirus disease causative virus, and analyzed for the identification or detection of causal viruses. In this case, a TaqMan probe (and corresponding primer set) for identifying or detecting the causative virus according to the OIE (Office of International Epizootics) standard may be used.

PCR was performed using the CFX96 ™ Real-Time System (BIO-RAD, USA), and all PCR conditions used asymmetric PCR to generate single stranded target nucleic acids.

The composition of the reactants for asymmetric PCR is shown in Table 2. After the PCR master mix was made, real-time PCR was performed by adding 1 μl viral DNA. In order to simultaneously identify or detect different virus types, 1 μl of the template DNA of each virus was added, followed by PCR.

Furtherance	Volume
2X qRT PCR Premix (for TaqMan)	10 μL
RSIV / ISKNV Oligomer Mix	8.5 μL
RSIV, ISKNV	PNA probe (5 pmole)
	Forward primer (1 pmole)
	Reverse primer (10 pmole)
RSIV	PNA probe (5 pmole)
	Forward primer (20 pmole)
	Reverse primer (2 pmole)
Template DNA	ㅡ
Distilled water	up to 20μL

Table 3 shows the amplification conditions and hybridization conditions of the reactants, and shows the process of amplifying and hybridizing the viral DNA sample and then raising the temperature of the hybridized product. The procedure was performed by real-time PCR.

step	Temperature (℃)	Response time and cycle
UDG incubation	50	5 min (optional)
Initial denaturation	95	10 min
35-40 cycles	95	30 sec
	56	60 sec (FAM, TexasRed)
	74	60 sec
Re-denaturation	95	5 min
Probe binding	75	30 sec
	75	30 sec
Melting	35 to 80	Increment 1.0 ° C, 5 sec (HEX, TexasRed, Cy5)

Example 3 Method of Detecting or Detecting Virus According to Amplification Curve and Fusion Curve of Real-time PCR

When a multi-detection sample containing one or more viruses is performed by performing real-time PCR by the determination or detection method according to the present invention, various fluorescent reporters may be combined with PNA probes as shown in Table 1 below.

For example, as shown in Table 4, the virus-specific fluorescence amplification curve is confirmed so that the virus type can be determined by the fluorescent reporter (RSIV / ISKNV detection by TexasRed fluorescence).

Fluorescent reporter	Virus types
TexasRed	RSIV / ISKNV

In addition, when the determination of the RSIV and the ISKNV by real-time PCR by the determination or detection method according to the present invention, it is possible to prepare the melting temperature and the fluorescence score table as shown in Table 5 in advance, and utilize them. .

The melting curve analysis was performed as in Example 2, and then the resulting fluorescent signal and Tm value were digitized to the perfect match temperature. That is, a range of ± 2 ° C. of the perfect match temperature is made, and if the Tm value for an unknown viral DNA sample is within the above range, the virus type can be determined and specified.

5 and 6 show amplification curves and fusion curves for each fluorescence obtained by applying peptide nucleic acid of SEQ ID NO: 1 or SEQ ID NO: 2 to a viral DNA sample according to the present invention. Or it was shown that it can be detected.

Fluorescent reporter	Tm (℃)	virus
TexasRed, Cy5	64, 67	RSIV
TexasRed	64	ISKNV

 The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

The present invention selects genetic markers for the identification and / or detection of causative viruses of red seabream iridovirus disease, and (i) Red Sea Bream Iridovirus (RSIV) / Infectious Spleen and Kidney Necrosis Virus. , ISKNV) specific genes; Or (ii) using a peptide nucleic acid and primer pair specific for a specific gene marker that distinguishes RSIV from RSIV / RSKNV, resulting in amplification and melting curves of different fluorescence for each virus type. There is an effect capable of accurately determining and detecting whether the fish is infected with the virus.

Electronic file attached.

Claims (15)

1. Gene marker for the detection of the causative virus of sea bream iridovirus disease represented by the nucleotide sequence of SEQ ID NO: 7.
2. According to claim 1, wherein the red sea bream iridovirus causative virus is Red sea Bream Iridovirus (RSIV); Or infectious spleen and kidney necrosis virus (ISKNV).
3. Gene marker for the identification or detection of red sea bream iridovirus (RSIV), a causative agent of aquatic organisms infectious diseases represented by the nucleotide sequence of SEQ ID NO: 8.
4. PNA probe for the detection of the causative virus of sea bream iridovirus disease represented by the nucleotide sequence of SEQ ID NO: 1.
5. The PNA probe according to claim 4, wherein at least one of a reporter and a quencher is coupled.
6. 5. The PNA probe of claim 4, wherein the causative agent of the sea bream iridovirus disease is Red Sea Bream Iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV).
7. PNA probe for the identification or detection of red sea Bream Iridovirus (RSIV), which is a causative agent of aquatic organisms infectious disease represented by the nucleotide sequence of SEQ ID NO: 2.
8. 8. The PNA probe according to claim 7, wherein at least one of a reporter and a quencher is coupled.
9. Composition for detecting red sea bream iridovirus causative virus comprising a primer pair represented by the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 1.
10. Red sea Bream Iridovirus (RSIV) composition for the identification or detection comprising a primer pair represented by the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 2.
11. Kit for detecting red sea bream iridovirus causative virus comprising a primer pair represented by the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 1.
12. Kit for determination or detection of Red Sea Bream Iridovirus (RSIV) comprising a primer pair represented by the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 2.
13. Methods for determining or detecting aquatic infectious agent virus comprising the following steps:

    (a) extracting a target nucleic acid from a sample sample;

    (b) a primer pair represented by a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 or a primer pair represented by SEQ ID NO: 5 and SEQ ID NO: 6 Amplifying using a pair, and hybridizing the PNA probe of any one of claims 4 to 8 to the amplified gene marker sequence fragment;

    (c) obtaining a melting curve for each temperature while increasing the temperature of the product hybridized with the PNA probe in step (b); And

    (d) determining the virus type of the causative virus of aquatic organisms infectious diseases from the melting temperature or detecting whether the fish is infected with the virus type by analyzing the melting curve obtained in step (c).
14. The method of claim 13, wherein the amplification curve is obtained by additionally including a TaqMan probe when amplifying the gene marker sequence using the primer pair in the step (b).
15. The method according to claim 13, wherein using two or more target nucleic acids, and reporting a reporter labeled on a PNA probe different for each target nucleic acid, determining or detecting the virus type of the at least one aquatic infectious agent virus through detection of the two or more target nucleic acids. How to feature.

Images