KR20180041331A - The method and kit of the selection of Molecule-Binding Nucleic Acids and the identification of the targets, and their use - Google Patents

Abstract

The present invention relates to a method for selecting a molecule-binding nucleic acid and identifying a target molecule which can be more efficiently used in the analysis of biological meaning of a sample composed of multiple molecules, and uses thereof. More specifically, the present invention relates to a method and kit for analyzing base sequences and frequencies of occurrence of molecule-binding nucleic acids constituting a library of molecule-binding nucleic acids binding to multiple molecules constituting a sample, and a normalization molecule-binding nucleic acid library, a subtraction molecule-binding nucleic acid library, suppression subtractive hybridization molecule-binding nucleic acid library, or a normalization-subtraction molecule-binding nucleic acid library produced therefrom; selecting molecule-binding nucleic acids contributing to the analysis of biological meaning; and isolating, identifying and quantifying a target molecule that binds to the selected molecule-binding nucleic acids. In addition, the present invention relates to uses thereof.

Description

The present invention relates to a method and a kit for identifying a molecular-binding nucleic acid, a method for identifying the target molecule,

The present invention relates to a method for identifying a molecular-binding nucleic acid, a method for identifying a target molecule, and a use thereof, which can be more efficiently used for analyzing a biological meaning of a sample comprising multiple molecules, and more particularly, Molecular binding nucleic acid library bound to a molecule and a normalization molecular binding nucleic acid library prepared therefrom, a subtraction molecular binding nucleic acid library, an SSH (Suppression Subtractive Hybridization) molecular binding nucleic acid library, or an equalization- A method for analyzing the nucleotide sequence and occurrence frequency of molecular binding nucleic acids constituting the nucleic acid library, selecting a molecular binding nucleic acid that contributes to the analysis of the biological meaning, and isolating, identifying and quantifying the target molecule binding to the selected molecular binding nucleic acid Kits and their uses.

Techniques for analyzing multiple molecules constituting a sample, techniques for producing a profile of molecules, and information for synthesizing the quantitative and quantitative states of the molecules contained in the sample, are described in physics, biochemistry, and biology Although it has been widely developed due to the development of information science, there is a great need for efficient new methods and devices due to the problem of the use and maintenance cost, ease of use, accuracy, sensitivity, inspection time and process automation.

Recently, 2-D gel electrophoresis and mass spectrometric assays have been developed which enable the measurement of the least abundant plasma components. However, samples must be prepared by performing labor-intensive preliminary classification protocols that remove plasma / serum of proteins present at high concentrations. Anderson, Proteomics (2005); Anderson and Anderson, Electrophoresis (1991); Gygi and Aebersold, Curr Opin Chem Biol (2000); Liotta, et al., JAMA (2001); Yates, Trends Genet (2000); and Adkin, et al., Mol Cell Proteomics (2002). In addition, these tests are time consuming and costly to purchase and maintain essential equipment to perform these methods.

While proteomes of biological samples, such as plasma proteomes, are very promising as a convenient sample for disease diagnosis and therapeutic monitoring, existing assays and techniques have been used in a variety of ways, including sensitivity limitations, time and efficiency limitations, . In addition, existing assays and techniques do not fully utilize biological samples as raw materials for biomarkers. For example, both electrophoresis and mass spectrometry have separated plasma proteins based on protein size and charge, but lacked assays and techniques based on other physical properties of proteins. There is a need in the art for a method of obtaining and utilizing a proteomic profile of a sample, and efforts are made to overcome the disadvantages of the existing techniques mentioned above.

An aptamer is a ligand that is a specific single-stranded nucleic acid for a target compound or molecule that has high specific binding to target molecules. As a method of producing platamer, the "SELEX" (Systematic Evolution of Ligands by Exponential Enrichment) method is widely used. The SELEX (CELEX) method is a method for in vitro expansion of a nucleic acid molecule having high specific binding to a target molecule (U.S. Patent No. 5,475,096, entitled "Nucleic Acid Ligands") and U.S. Patent No. 5,270,163 (entitled " : "Nucleic Acid Ligands").

The SELEX method is a method in which the nucleic acid acts as a ligand (i. E., Forms a specific binding pair) against the ability to form a variety of two- and three-dimensional structures and substantially any chemical compound Based on having sufficient chemical versatility available in the monomer. Molecules having any size or composition may be used as the target molecule. Although aptamers have been extensively studied as very useful ligands, the general screening method of platamer is limited to a target molecule or substance.

The present inventors have proposed a method of selecting a single-stranded nucleic acid (molecule-bound nucleic acid) bound to a molecule and quantifying a target molecule bound to the molecule-bound nucleic acid in a complex sample containing unknown molecules or known molecules. That is, reverse-SELEX (see Korean Patent Registration No. 10-0670799) which produces a profile for a proteome, biochip based on molecular binding nucleic acid (Korean Patent Registration No. 10-0464225), biological semantic analysis using molecular binding nucleic acid based biochip (See Korean Patent No. 10-0923048), and a method of selecting a molecular-binding nucleic acid bound to multiple molecules constituting a biological sample .

In order to overcome the limitations of existing technologies for analyzing proteomes, existing reverse-SELEX and molecular-binding nucleic acid selection methods, the present invention is directed to a method for efficiently producing a molecular-binding nucleic acid library, And a method for efficiently selecting an analytical molecular binding nucleic acid that contributes to the analysis of biological significance and further identifying a target molecule binding to the selected molecular binding nucleic acid.

It is an object of the present invention to provide a method for analyzing SSH, homogenization, homologation and purification from a single-stranded nucleic acid library for more efficient analysis of molecules constituting a sample composed of multiple molecules from a molecular-binding nucleic acid primary library binding to multiple molecules constituting the sample, And to provide a kit and a method for analyzing the nucleotide sequence and the frequency of molecular binding nucleic acids constituting a molecular binding nucleic acid secondary library which is a subtracted or equalized-subtracted molecular binding nucleic acid library.

It is an object of the present invention to provide a method for producing a molecular binding nucleic acid primary library reflecting the composition and diversity of molecules constituting a sample from a single-stranded nucleic acid library.

It is an object of the present invention to provide a molecular binding nucleic acid library (analytical sample-molecular binding nucleic acid library) which binds to an analytical sample to be analyzed and a molecular binding nucleic acid library (comparative sample- Subtracted, SSH, or homogenized-subtracted molecular binding nucleic acid library with improved analytical efficiency for the desired analytical sample by applying equalization, subtraction, SSH, or equalization-subtraction procedures to the library Molecular binding nucleic acid secondary libraries and molecular binding nucleic acids.

It is an object of the present invention to provide a database of binding data of molecules and molecular binding nucleic acids of analytes and comparative samples using the nucleotide sequence and frequency of molecular binding nucleic acids constituting the libraries, The present invention aims to provide a method for selecting a molecular binding nucleic acid, which improves the analytical efficiency of a target analytical sample and a comparative sample, and contributes to the analysis of biological significance by applying a process of selecting molecularly bound nucleic acids.

It is an object of the present invention to provide a method for separating and identifying target molecules from a sample by applying a process of isolating and identifying target molecules using the selected molecular binding nucleic acids, and their uses.

This specification efficiently selects the molecular binding nucleic acids that bind to the molecules constituting the sample and contribute to the analysis of the biological meaning to overcome the limitations of the existing proteome, the SELEX and the conventional reverse-SELEX method, Methods, apparatuses, reagents and kits for the detection and / or quantification of analytical molecular binding nucleic acids that bind to multiple target molecules that may be present in the sample, such as those for separating, identifying and quantifying target molecules binding to the binding nucleic acids and their uses .

The following terms used in this specification mean, unless otherwise stated,

A "test sample" refers to any substance, solution or mixture comprising a plurality of molecules, and may comprise at least one target molecule. The sample includes a biological sample and a sample that can be used, for example, to conduct an environmental or poison inspection, such as, for example, water that may be contaminated or contaminated and industrial wastewater. The sample may also be an end product, an intermediate product or a by-product in the preparation process, such as, for example, a manufacturing process. The sample may comprise any suitable assay medium, buffer or diluent to which a substance, solution or mixture derived from an organism or any other source (e.g., an environment or an industrial worker) has been added.

"Biological sample" refers to any substance, solution or mixture obtained from a biological organism. It can be used to remove blood (whole blood, white blood cells, peripheral blood mononuclear cells, plasma and serum), sputum, breath, urine, semen, saliva, meningeal fluid, amniotic fluid, glandular fluid, lymph fluid, nipple aspirate, bronchial aspirate, synovial fluid, joint aspirate, , Cells, cell extracts, and cerebrospinal fluid. This also typically includes separate fragments of everything mentioned above. The term "biological sample" also encompasses a mixture comprising, for example, a material such as a stool sample, a tissue sample or a tissue biopsy, a solution or an equalized solid material. The term "biological sample" also includes materials, solutions or mixtures derived from tissue reactions, cell reactions, bacterial reactions or viral reactions.

"Molecule " refers to any molecule of interest, other than nucleic acids, that can bind to a molecule-bound nucleic acid with high affinity and specificity and may be present in the sample. "Molecule " refers to one or more such sets of molecules. Representative molecules include proteins, polypeptides, carbohydrates, lipids, polysaccharides, glycoproteins, hormones, receptors, antigens, affibodies, antibody mimics, viruses, pathogens, toxins, substrates, metabolites, Includes any fragment or portion of transition state analogs, cofactors, inhibitors, drugs, dyes, nutrients, growth factors, cells, tissues and any of the foregoing. "Molecule of interest" means, in the case of a protein, for example minor variations in amino acids, disulfide bond formation, glycosylation, lipidation, but also any slight variations of a particular molecule, such as acetylation, phosphorylation, or any other manipulation or modification, such as binding to a marker component that does not substantially alter the nature of the molecule . "Molecule" is a duplicate set of one type or kind of molecule or multimolecular structure capable of binding to a molecule-bound nucleic acid.

"Protein" is used interchangeably to refer to a polymer of amino acids of any length. The polymer may be linear or branched, may contain modified amino acids, and may be interrupted by non-amino acids. The terms also include amino acid polymers that are naturally modified or that have any other variation such as, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or conjugation with labeled components. Also included within the definition are, for example, polypeptides comprising one or more analogs of amino acids (including, for example, unnatural amino acids, etc.) as well as other variations known in the art. Polypeptides can be single chains or associated chains.

A " target molecule "is a molecule that binds to a molecule-bound nucleic acid and may be present in the sample in one or more of the following ways: The affinity interaction of the molecule is known to be a matter of degree, The "specific binding affinity" of a binding nucleic acid means that the molecule-bound nucleic acid binds to the target molecule with generally higher affinity than binding to other molecules of the sample.

A "non-target molecule" is used interchangeably to refer to a molecule contained in a sample capable of forming a nonspecific complex with a molecule-bound nucleic acid. A non-target molecule is a replica set of one type or kind of molecule or complex molecular structure capable of binding to a molecule-bound nucleic acid. Non-target molecules refer to one or more such sets of molecules. The non-target molecule for the first molecular binding nucleic acid may be a target molecule for the second molecular binding nucleic acid. Likewise, the target molecule for the first molecular binding nucleic acid may be a non-target molecule for the second molecular binding nucleic acid.

"Non-specific complex" refers to a non-covalent bond between two or more molecules other than the molecule of interest corresponding to the molecule-bound nucleic acid. Because nonspecific complexes are not selected on the basis of affinity interactions between their constituent molecules, but exhibit interactions between molecular species, molecules bound to nonspecific complexes will generally exhibit very low affinity to each other, and molecular binding nucleic acids Will have a corresponding lower affinity than the corresponding target molecules. Nonspecific complexes include molecularly-bound nucleic acids and non-target molecules, competitors and non-target molecules, competitors and target molecules, and complexes formed between target molecules and non-target molecules.

"Abtamer" is a nucleic acid that binds to a specific molecule. Specifically, the nucleic acid refers to a nucleic acid having a dissociation constant (Kd) with the specific molecule of less than 2.0 × 10 ^-9 and a specificity of 5 or more, which is the ratio of the dissociation constant to other dissociation constants. (See PCT / US1992 / 001383), a substance contained in a molecule-bound nucleic acid.

"Reverse-SELEX" generally refers to (1) the production of a molecular-binding nucleic acid library consisting of, for example, nucleic acids binding in a desirable manner to a high affinity for multiple molecules constituting a sample, and (2) Is used to refer to a process of selecting an analytical molecular binding nucleic acid that contributes to the analysis of biological significance by examining the mode of corresponding molecules in the sample using nucleic acids selected from the library.

"Molecule Binding Nucleic Acid (MBNA)" is a nucleic acid that binds to a molecule selected by the Reverse-SELEX process and includes the above-mentioned abtamer, and includes a molecule-bound nucleic acid and a sample composed of multiple molecules Based on the results obtained by the multivariate analysis, the degree of contribution of molecular binding nucleic acids to the analytical sample can be determined. In the present invention, a nucleic acid that contributes to the analysis of biological significance in the molecular-binding nucleic acids selected by the reverse-SELEX process is called "analytical molecular binding nucleic acid ". Molecular binding nucleic acids are a set of nucleic acid molecules of one type or type having a specific nucleotide sequence. The molecular binding nucleic acid may comprise any suitable number of nucleotides. The different molecular binding nucleic acids may have the same or different numbers of nucleotides. Also, there may be two or more molecularly-bonded nucleic acids that specifically bind to the same molecule. Molecule-bound nucleic acids can be developed using any known method including conventional Reverse-SELEX processes. Reverse-SELEX (Korean Patent No. 10-0670799) which produces a profile for a proteome, biochip based on molecular binding nucleic acids (Korean Patent Registration No. 10-0464225), biological semantic analysis technology using molecular binding nucleic acid based biochips Registration No. 10-0923048). Molecular binding nucleic acids can be prepared or synthesized according to any known method, including chemical synthesis methods and enzymatic synthesis methods.

"Molecule-Molecule Binding Nucleic Acid Complex" or "Molecule Binding Nucleic Acid Complex" refers to a non-conjugate complex formed by the interaction of a specific molecule and a molecular binding nucleic acid. The molecule-bound nucleic acid complex is a complex of one type or kind formed by a molecular-binding nucleic acid that binds to a corresponding molecule. Molecular binding nucleic acid complexes can generally be converted or separated by, for example, increasing temperature, increasing salt concentration, or changing in environmental conditions, such as the addition of a denaturant.

"Competitor molecule" and "competitor" are used interchangeably to refer to any molecule capable of forming a nonspecific complex with a non-target molecule. Non-target molecules include, for example, free molecular binding nucleic acids that are capable of inhibiting molecular binding nucleic acids from being bound (recombined) with non-target molecules that are nonspecifically used by competitors. A "competing molecule" or "competitor" is a duplicate set of molecules of one type or type. A "competing molecule" or "competitor" refers to one or more such sets of molecules. Competitive molecules include, but are not limited to, oligonucleotides, polyanions (such as heparin, herring sperm DNA, salmon sperm DNA, tRNA, dextran sulfate, polydextran, non-basic phosphodiester polymers, dNTPs and pyrophosphates ). In many aspects, a combination of one or more competitors may be used.

"Nucleic acid "," oligonucleotide ", and "polynucleotide" are used interchangeably to refer to a polymer of nucleotides of any length and such nucleotides may be deoxyribonucleotides, ribonucleotides and / or analogs or chemically modified 0.0 > ribonucleotides < / RTI > or ribonucleotides. The terms "polynucleotide "," oligonucleotide "and" nucleic acid "include double or single stranded molecules as well as triple helix molecules.

A "template" is a nucleic acid molecule that is to be copied by a nucleic acid polymerase. The template may be single stranded, double stranded or partially double stranded depending on the polymerase. The synthesized radiation is complimentary to the template or at least complementary to one strand of the double strand or partial double strand template. Both RNA and DNA are synthesized in the 5 'to 3' direction and the two strands of the nucleic acid double strand are always at the opposite ends of the double strand 5 'ends.

A "primer" is an oligonucleotide complementary to a template, which forms a primer / template complex that binds (hybridizes or hybridizes) with a template to initiate synthesis by a DNA polymerase. In the DNA synthesis step, Lt; RTI ID = 0.0 > 3 ' end. ≪ / RTI > As a result, a primer extension product is produced. All previously known DNA polymerases (including reverse transcriptase) require oligonucleotide binding to a single strand template to initiate DNA synthesis. DNA polymerase requires a forward primer and a reverse primer in order to perform PCR (Polymerase Chain Reaction), which is a method of mass-amplifying only a desired part of the DNA chain. The name of nucleic acid synthesis adopts and classifies terms that refer to two complementary strands of a double strand. In general, the strand that encodes the sequence used to produce the protein or structural RNA is called the (+) strand, and the complementary strand is called the (-) strand. The forward primer is a base sequence binding to the (+) strand and the reverse primer is a base sequence binding to the (-) strand.

"Next Generation Sequencing (NGS)" refers to massive parallel sequencing, and the basic idea of this method is similar to massively parallel processing, which means performing a task simultaneously in computer science. To divide the genome into numerous pieces, read each piece simultaneously, and then combine the obtained data with bioinformatic techniques to quickly decode large genome information. Currently, it is a technology in which hundreds of thousands to billions of different large-scale sequencing reactions are simultaneously proceeded and read by the development of NGS technology corresponding to the second generation. NGS refers to a technology that sculpts a full-length genome in a chip-based and PCR-based paired end format and performs sequencing at very high speeds based on chemical hybridization of the fragments. NGS stands for sequencing technology such as illumina, Roche, and Toronto, and broadly includes third-generation technologies Pacificbio, RainDance, and fourth-generation technologies. The difference between these technologies is the next generation technology based on the chemical reaction of oligo on a chip or bead basis and the 3rd generation or the 4th generation when the speed and sequencing technology are dramatically improved in the way of decoding DNA .

&Quot; Sequencing Library " is a collection of DNA or cDNA fragments of a given size range coupled with adapters at both ends capable of running sequencing by a sequencer, and the library may be DNA or cDNA Was prepared upon RNA-seq performance).

"RAD" refers to base pair information on the amount of analysis produced in a DNA or cDNA fragment contained in a library. It refers to the output data from a sequencing analysis, a fragment of a sequence (sequence) do.

"Sequencing Depth" refers to the number of times (sequential depth) of sequencing results for a particular nucleotide in the output data when a particular sample is sequenced, expressed as 10X, 20X, and so on, also referred to as coverage and depth of coverage.

The present invention relates to a single-stranded nucleic acid library for more efficient analysis of molecules constituting a sample, a molecular-binding nucleic acid primary library for binding the molecule constituting the sample from the prepared single-stranded nucleic acid library, There is provided a method and a kit for analyzing the nucleotide sequence and the nucleotide sequence of a molecular binding nucleic acid constituting a molecular binding nucleic acid secondary library which is SSH, homogenization, subtraction or homogenization-subtracted molecular binding nucleic acid library from a nucleic acid library.

The term "reference sequence" refers to a nucleotide sequence that is used to generate the entire nucleotide sequence from the above-mentioned leads. That is, in the nucleotide sequence analysis, a large number of leads output from the sequencer are mapped by referring to the reference nucleotide sequence, thereby completing the entire nucleotide sequence.

A library composed of nucleic acids which are provided from a single-stranded nucleic acid library and bind to each of a plurality of molecules constituting a sample is called a "molecular-binding nucleic acid primary library ", a normalization process, Molecular binding nucleic acid library provided by a subtraction process, an SSH (Suppression Subtractive Hybridization) process or an equalization-subtraction process is referred to as a "molecular-binding nucleic acid secondary library ".

"Normalization" means that the molecular binding nucleic acid library reflects the appearance frequency diversity of the components of the sample consisting of two or more molecules, thereby making the frequency of appearance of constituent nucleic acids of the molecular binding nucleic acid library constant do.

"Subtraction" means a step of removing constituents of the comparative sample-molecule-bound nucleic acid library from the constituents of the above-mentioned analytical sample-molecule-bound nucleic acid library, and preferably using the libraries subjected to the equalization process Thereby performing subtraction.

"SSH (Suppression Subtractive Hybridization)" is a process for selectively amplifying a constituent nucleic acid of the above-mentioned molecular-binding nucleic acid library, and is intended to be compared with a molecular-binding nucleic acid library (analytical sample- A nucleic acid molecule specifically present in the analyte-molecule-bound nucleic acid library can be amplified using a molecular-binding nucleic acid library (comparative sample-molecule-bound nucleic acid library) corresponding to the comparative sample.

In the present invention, the overall realization step of a method of more efficiently selecting a molecular binding nucleic acid binding to each of multiple molecules constituting a sample is as shown in Fig. 1, and a single-stranded nucleic acid binding to each of multiple molecules constituting the sample A molecular-binding nucleic acid primary library (analyte-molecular-binding nucleic acid primary library) that binds to a sample to be analyzed or binds to an analytical sample requiring analysis, and a molecular-binding nucleic acid primary library (a comparative sample- ), And the SSH molecule-coupled nucleic acid library, the homogenized molecule-bound nucleic acid library, and the homogenized molecule-binding nucleic acid library are obtained by performing a suppression subtraction hybridization (SSH) process, a normalization process, a subtraction process, Library, a subtracted molecular-binding nucleic acid library or an equalization-subtracted fraction A method and a kit for analyzing the nucleotide sequence and frequency of molecular binding nucleic acids constituting a molecular binding nucleic acid secondary library as a binding nucleic acid library, Methods and kits for isolating, identifying and quantifying target molecules that select nucleic acids and bind to selected molecular binding nucleic acids, and their uses.

(Structure of single-stranded nucleic acid)

The single or double stranded DNA library, the single stranded RNA library and the molecular binding nucleic acid primer library for identifying the target molecule binding to the nucleic acid and the molecular binding nucleic acids binding to each of the multiple molecules constituting the sample in the present invention and A single-stranded nucleic acid library consisting of a single-stranded nucleic acid library to produce a molecular-binding nucleic acid secondary library that is SSH, equalized, subtracted or equalized-subtracted molecular binding nucleic acid library for a primary molecule- The structure of the nucleic acid, i.e., the oligonucleotide, And includes the following elements.

The structure of the oligonucleotide is represented by the following formulas (I) and (II).

5'-5 'conserved region-variable region -3' conserved region -3 '(general formula I)

5'-variable region-3 '(formula II)

Generally, a nucleic acid library used for selecting an extramammary and an oligonucleotide constituting a single-stranded nucleic acid library used in the present invention are those having a conserved region consisting of a certain nucleotide sequence occupying more than half of the nucleotide sequence have. Such a conserved region may interact non-specifically with the variable region having an arbitrary nucleotide sequence to limit the complexity of the nucleic acid library.

In order to overcome the above problem, there has been proposed a " primer-free " selex technology which is a technique for developing an electrotamer that binds to a target molecule using a library made of a single-stranded nucleic acid having no fixed region produced by various methods such as organic synthesis ≪ General Formula II > structure.

In order to achieve the homology, subtraction, homogenization-subtraction or SSH process proposed in the present invention, a primer sequence is required. To this end, a base sequence capable of artificially adding to the single-stranded nucleic acid of the resultant product "primer-free" The required process can be performed.

Oligonucleotides were prepared from the nucleotide sequences of the 5 'conserved region and the 3' conserved region in the 5'-5 'conserved region-3' and the 5'-conserved region 3'-3 'of the <Formula I> A single-stranded nucleic acid library composed of an oligonucleotide of the above-mentioned <Formula II> structure may be prepared as a library of oligonucleotides of the <Formula I> structure by oligonucleotide addition reaction of the <Formula II> structure.

In the present invention, 5'-5 'of the general formula I is added to the molecular-binding nucleic acid of the molecular-binding nucleic acid pool separated from the molecule-molecule-bound nucleic acid complex pool formed by contacting the oligonucleotide library with the molecule constituting the sample. The oligonucleotides prepared from the nucleotide sequence of the 5 'conserved region and the nucleotide sequence of the 3' conserved region in the conserved region-3 'and the 5'-conserved region 3'-3' were divided to prepare a molecular binding nucleic acid secondary library.

Generally, the Reverse-SELEX process begins with the production of single-stranded nucleic acid libraries, which are generally nucleic acids of different sequences. Oligonucleotides constituting the single-stranded nucleic acid library generally comprise a nucleic acid sequence comprising two conserved regions (i. E., Each constituent of the candidate mixture comprises the same sequence at the same position) and a variable region. Typically, the conserved region is selected to aid in the amplification step described below, or to enhance the possibility of a given structural arrangement of the nucleic acid in the single-stranded nucleic acid library. The variable region typically provides a target binding site for each nucleic acid with respect to the molecule and the variable region is completely random (i. E., The probability of finding a base at any position is one of four) (I.e., the probability of finding a base at an arbitrary position can be selected at any level between 1 and 100 percent).

In the present invention, the 5 'terminal region of the oligonucleotide is composed of a 5' conservative region and the 3 'terminal region is composed of a 3' conservative region, and the conserved region is a position complementary to the primer To be provided.

The 5 'and 3' conserved regions are primers (DS forward and reverse primers) necessary for the preparation of a double DNA library that can be used for RNA synthesis, primers essential for the production of double stranded DNA from the single strand DNA library and RNA RS forward and reverse primers) and primers (SSH forward and reverse primers) necessary for the SSH or subtractive process of the molecular-binding single-stranded nucleic acid library.

In the case of preparing a double-stranded DNA and single-stranded RNA library from the single-stranded nucleic acid library used in the present invention, the double-stranded DNA library is prepared by PCR using a complementary primer (DS forward primer and DS reverse primer) And RNA can be prepared by an in vitro transcription reaction. The structure and primer of the oligonucleotide are shown in FIG.

In the case of preparing a double-stranded DNA library from a single-stranded DNA library and a single-stranded RNA library prepared from the single-stranded nucleic acid library from the single-stranded nucleic acid library used in the present invention, the oligonucleotide has a complementary base sequence The structures and primers of the oligonucleotide providing the complementary binding sites of the RS forward primer and the RS reverse primer are shown in FIG.

The base sequence of the DS conserved region in which the DS primer of the oligonucleotide is complementarily bound, the RS conserved region in which the RS primer is complementarily bound and the SSH conservation region in which the SSH primer is complementarily bound are all or partially overlapped, And the length of the conserved sequence is at least 10 to 60 nucleotides in length.

Preferably, a base sequence identical to that of the DS conserved region, the RS conserved region, and the SSH conserved region may be used.

An oligonucleotide in which at least 15 to 100 arbitrary nucleotide sequences of variable regions having diversity exist between the both conserved regions.

In order to synthesize a random sequence constituting the variable region of the oligonucleotide, a mixture of all four nucleotides is added to each nucleotide addition step during the synthesis process so that the nucleotides can be incorporated at random. The oligonucleotides may be modified or non-DNA, RNA or DNA / RNA hybrids. The random oligonucleotides may be entirely random or partially random and may contain sequence portions. For example, the pool contains oligonucleotides that are 100% random or partially inadvertent. Partially randomized sequences can be prepared by adding four nucleotides at different molar ratios in each additional step. Typically, the oligonucleotide has constant 5 ' and 3 ' conserved terminal sequences present on the side of the internal region of 30 to 50 random nucleotides.

Random nucleotides can be produced by a number of methods including chemical synthesis and size-specific screening of randomly truncated intracellular nucleic acids. Sequence variations in the nucleic acid can also be introduced or increased by mutagenesis prior to or during the repeated selection / amplification procedure. The random sequence portion of the oligonucleotide may have any length and may include a ribonucleotide-deoxyribonucleotide and may also include a modified or non-natural nucleotide or nucleotide analogue (see, for example, U.S. Patent No. 5,958,691 U.S. Patent No. 5,660,985; U.S. Patent No. 5,958,691; U.S. Patent No. 5,698,687; U.S. Patent No. 5,817,635; U.S. Patent No. 5,672,695; and PCT Publication No. WO 92/07065).

Random oligonucleotides can be synthesized from phosphodiester-linked nucleotides using solid state oligonucleotide synthesis techniques well known in the art (see Froehler et al., Nucl. Acid Res. 14: 5399-5467 (1986) And Froehler et al., Tet. Lett. 27: 5575-5578 (1986)). Acid Res. 4: 2557 (1977) and Hirose et al., Tet. Lett., 28 (1987)), can also be synthesized using a solution phase method such as the triester synthesis method (Sood et al., Nucl. : 2449 (1978)). Typical syntheses performed using automated DNA synthesis equipment produce 10 ¹⁴ to 10 ¹⁶ individual molecules (sufficient for most celex experiments). A sufficiently large region of random sequence in sequence design increases the likelihood that each synthetic molecule will exhibit a unique sequence.

According to the present invention, there is provided a method for preparing a single-stranded nucleic acid library and SSH, an equalization, subtraction or an equalization-subtracted molecular-binding nucleic acid library containing a random sequence and a method for selecting a molecule- There is provided a method for producing a single-stranded nucleic acid library for identifying a target molecule binding to a bound nucleic acid and a method for producing an oligonucleotide including a base sequence used in an SSH process, an equalization process, a subtraction process, or an equalization- The steps are the same as in Fig .

(Preparation of single stranded nucleic acid library)

The single-stranded nucleic acid library prepared in the single-stranded nucleic acid library of the above-mentioned <General Formula I> structure, the single-stranded nucleic acid library of the <General Formula II> structure or the above <General Formula I> To separate the molecular binding nucleic acid. The former two libraries can be synthesized by common organic synthesis methods, and the latter one can be synthesized by enzymatic methods.

A method for producing a single-stranded nucleic acid library in contact with a molecule constituting a sample from a single-stranded nucleic acid library of the general formula I by an enzymatic method is as follows.

In the case of preparing a double-stranded DNA and single-stranded RNA library from the oligonucleotide library having the structure of the general formula I used in the present invention, the PCR is performed by using a complementary primer (DS forward primer and DS reverse primer) The double-stranded DNA library and the in-vitro transcribed single-stranded RNA library can be prepared. The structure of the oligonucleotide and the necessary primers are shown in FIG .

Preferably, in the case of preparing a single stranded nucleic acid library having the structure of the general formula I in FIG. 4, the RS forward primer complementarily binding to the 5 'conservation region and the 3' conservation region of the oligonucleotide constituting the library, A single-stranded DNA library can be prepared by performing one-way PCR using primers.

Preferably, the method for preparing a single-stranded RNA library from a single-stranded DNA library having the structure of the general formula I in FIG. 5 is carried out by PCR with the DS forward primer and the DS reverse primer, using the single-stranded nucleic acid of the single- To prepare a double-stranded DNA fragment having the T7 promoter. And then in vitro transcription of the prepared double-stranded DNA fragment into a template to prepare an RNA single-stranded nucleic acid library.

All four nucleotides or modified nucleotide mixtures for the preparation of oligonucleotides constituting a single-stranded nucleic acid library are added to each nucleotide addition step during the synthesis process so that the variable region of the single-stranded nucleic acid of the single- Lt; RTI ID = 0.0 &gt; nucleotides &lt; / RTI &gt; Any modified single-stranded nucleic acid can be used in both the above-mentioned methods, apparatus and kits. Single-stranded nucleic acids containing nucleotides with modified bases differ greatly from those of standard single-stranded nucleic acids containing naturally-occurring nucleotides (i.e., unmodified nucleotides). Modifications of nucleotides include the use of amide linkages. However, other suitable modification methods may be used. It was observed that the structure of the modified single stranded nucleic acid was not entirely consistent with the structure predicted by the standard base pairing model. This phenomenon is supported by the fact that the measured melting point of a single-stranded nucleic acid does not match the melting point expected by the model. As is known, there is no association between the measured melting point of the single-stranded nucleic acid and the expected melting point. On average, the calculated melting point (Tm) is 6 [deg.] C lower than the measured Tm. The measured melting point is predicted to be more stable and novel secondary structure of the single-stranded nucleic acid containing these modified nucleotides, and that possibility exists. When the modified nucleotides are used to produce single stranded nucleic acid libraries, the single stranded nucleic acid for the target is better isolated. As described herein, "modified nucleic acid" refers to a nucleic acid sequence comprising one or more nucleotides. In some embodiments, it is desirable that the modified nucleotide and Reverse-SELEX method be compatible.

The chemical modification of the nucleotide may be a sugar modification at the 2'-position, a pyrimidine modification at the 5-position (for example, 5- (N-benzylcarboxyamide) -2'-deoxyuridine, 5- Carboxamido) -2'-deoxyuridine, 5- (N- [1- [2- (1H-indol- (3-trimethylammonium) propyl] carboxamido) -2'-deoxyuridine chloride, 5- (N-naphthylcarboxyamide) -2'-deoxyuridine, or 5- 2,3-dihydroxypropyl)] carboxamido) -2'-deoxyuridine), purine modification at the 8-position, modification in exocyclic amines, substitution of 4-thiouridine, Such as substitution of 5-bromo-or 5-iodo-uracil, backbone modification, methylation, isobases isocytidine and isoguanidine, Unusual base-pairing combinations may be included alone or in combination. . Deformation may also include 3 'and 5' modifications such as capping or pegylation. Other variants may include substitution of one or more naturally occurring nucleotides with an analogue, methyl phosphonates, phosphotriesters, phosphoamidates, and the like having uncharged linkages, and Carbamates and the like and charged linkage phosphorothioates, phosphorodithioates and the like, acridines including intercalators, such as psoralen and the like, chelating metals, radioactive metals, boron, metal oxides, and the like, including alkylators and modified alpha-anomeric nucleic acids. In addition, any hydroxyl groups normally present in the saccharide may be substituted by phosphonate groups or phosphate groups and may be protected by standard protecting groups or by addition of additional nucleotides or solids Can be activated to create additional bonds to the support. The OH groups at the 5 'and 3' termini can be phosphorylated, or can be phosphorylated with an amine, organic capping group moieties from about 1 to about 20 carbon atoms, or from about 1 to about 20 polyethylene glycols ( PEG) polymers or organic capping moieties from other hydrophilic or hydrophobic biological or synthetic polymers. If present, the nucleotide structure can be modified before or after the polymer combination. The sequence of the nucleotide can be interrupted by a non-nucleotide component. Polynucleotides can be further modified, such as by conjugation with labeling of the components after polymerization.

Polynucleotides may also be 2'-O-methyl- (2'-O-methyl-), 2'-O-allyl (2'-O-allyl), 2'- fluoro- (2'- 2'-azido-ribose, carbocyclic sugar analogs,? -Anomeric sugars, arabinose, xylose or lyxoses, Such as epimeric sugars, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs, and bases such as methyl ribose And include analogous forms of ribose or deoxyribose commonly known to those skilled in the art, including abasic nucleotide analogs. As mentioned above, one or more phosphodiester linkages may be replaced by alternative linking groups. These alternative linkages include those where the phosphate is P (O) S ("thioate"), P (S) S ("dithioate"), (O) NR2 ("amidate" Each R or R 'is independently H or an ether (-O-) bond, aryl (O) R', P (1-20C) optionally comprising an alkyl, alkenyl, cycloalkyl, cycloalkenyl, or araldyl. Not all bonds in the polynucleotide need be identical. Substitution of similar forms of sugars, purines, and pyrimidines may be advantageous in designing end products, such as, for example, alternative basic framework structures such as polyamide basic backbones.

(Molecular Binding Nucleic Acid Primary Library Preparation)

The single-stranded nucleic acids constituting the prepared single-stranded nucleic acid library are contacted with selected molecules under conditions that facilitate binding to each of the molecules constituting the sample. Under these conditions, the interaction of each molecule with a nucleic acid that constitutes a single-stranded nucleic acid library generally forms a molecule-bound nucleic acid complex with the strongest relative affinity between the pair of components. The nucleic acid having the highest affinity for each molecule can be separated from the nucleic acid having a lower affinity for each molecule. The separation process is carried out in such a way as to maintain the nucleic acid with the highest affinity. While separating to have a relatively high affinity for each molecule, the selected nucleic acids are amplified to produce a new candidate nucleic acid enhanced in a nucleic acid having a relatively high affinity for each molecule. By appropriately repeating the above separation and amplification steps, the newly formed candidate nucleic acid contains fewer unique sequences and the average degree of affinity of the nucleic acid mixture for each molecule will generally increase. In extreme terms, there are molecular binding nucleic acids containing one or more unique nucleic acids from the original oligonucleotide library with high affinity for each molecule.

In the case of a sample composed of multiple molecules, especially serum, the diversity of the molecules is very high and the variation in the appearance frequency of the molecules is also very diverse. If it is possible to produce a molecule-bound nucleic acid containing one or more unique nucleic acids for each of the multiple molecules constituting the sample by appropriate repetition of the separation and amplification steps, the reverse-SELEX process can be used to determine the diversity And a molecular binding nucleic acid primary library that reflects the frequency of occurrence.

The Reverse-SELEX process involves the production of a molecular-binding nucleic acid primary library that reflects the diversity and frequency of molecules that make up the sample from a single-stranded nucleic acid library. The preparation of the molecular binding nucleic acid primary library containing the diversity and appearance frequencies of the molecules involves the formation and separation of molecular binding nucleic acid complexes such as the reaction time of the sample and the nucleic acid pool in the reverse-SELEX process, Step. In the prepared molecular binding nucleic acid primary library, the type of the constituent nucleic acid reacts with the kind of molecules constituting the specimen, and the appearance frequency of the constituent nucleic acid is made to reflect the frequency of appearance of the corresponding sample molecule.

A step of increasing the specificity of the molecular binding nucleic acid complex and reducing the non-specific binding in the step of producing the primary nucleic acid library reflecting the diversity and frequency of the multiple molecules constituting the sample, An additional reduction in non-specific binding can be achieved either by adding the competitor to the mixture during pre-incubation or equilibrium binding, prior to the reaction of the sample and competitor with the sample and nucleic acid library, Lt; / RTI &gt; In other implementations, dynamic induction is performed by dilution.

In the reverse-SELEX process, the molecular-binding nucleic acid separation process is preferably performed so that the relative concentration of the molecule-binding nucleic acid complex having a high affinity for each of the multiple molecules is increased more rapidly than the concentration of the molecule- Quot; refers to a process of changing the relative concentration of a particular single-stranded nucleic acid component in a cell. The molecular binding nucleic acid separation process is a molecular-binding nucleic acid complex separation process having a solution-based high affinity. The solution-based molecular binding nucleic acid separation process is carried out in solution so that the target or nucleic acid forming a molecule-bound nucleic acid complex in a single-stranded nucleic acid library is not transferred onto the solid support during the molecular-binding nucleic acid separation process. The molecular binding nucleic acid separation process may include one or more steps including addition and reaction of competing molecules, dilution of the mixture, or a combination thereof (e.g., dilution of the mixture in the presence of competing molecules). Since the effect of the molecularly-coupled nucleic acid separation process is generally dependent on the rate of degradation of other molecule-bound nucleic acid complexes (i.e., molecule-bound nucleic acid complexes formed between target molecules and other nucleic acids in a single-stranded nucleic acid library) The duration of the nucleic acid separation process is selected to substantially reduce the number of molecularly-bound nucleic acid complexes with low affinity while maintaining a high proportion of molecularly-bound nucleic acid complexes with high affinity. Thus, molecular separation of nucleic acid complexes with similar affinities must be performed to ensure that the diversity of the molecules making up the biological sample is reflected. The molecular binding nucleic acid separation process may be used more than once during the Reverse-SELEX process. When dilution and competitor addition are used together, they can be carried out simultaneously or sequentially in any order.

The molecular binding nucleic acid separation process can be used when the total target (protein) concentration in the reaction solution is low. When the molecularly-coupled nucleic acid separation process comprises dilution, the reaction solution may dilute itself as much as possible, and the single-stranded nucleic acid pool containing the molecularly-bound nucleic acid may be recovered through a subsequent round of the Reverse-SELEX process . The molecular binding nucleic acid separation process involves the use of competitors as well as dilution, which can result in less dilution of the reaction solution than is necessary when the competitor is not in use. The molecular binding nucleic acid separation process comprises the addition of a competitor, wherein the competitor is a polyanion (e. G., Heparin or dextran sulfate (dextran)). Heparin or dextran has been used to separate molecular binding nucleic acids in conventional Reverse-SELEX screening processes. However, in such a method, heparin or dextran is present during the equilibrium step in which the target molecule and the molecule-bound nucleic acid bind to each other to form a complex. In this method, as the concentration of heparin or dextran is increased, the ratio of the molecule-bound nucleic acid complex having high affinity to the molecular-binding nucleic acid complex having low affinity is increased. However, high concentrations of heparin or dextran can reduce the number of molecular binding nucleic acid complexes with high affinity in equilibrium due to competition for binding targets between nucleic acid and competitor. In contrast, the methods of the present invention do not affect the number of complexes formed by forming the molecularly-bound nucleic acid complexes and then adding competitors. The equilibrium state formed between each of the multiple molecules and the molecule-bound nucleic acid creates a non-equilibrium state involving the arrival of a new equilibrium in the molecule-bound nucleic acid complex by adding the next competitor. Separation of molecularly-bound nucleic acid complexes prior to reaching a new equilibrium enriches samples for molecularly-bound nucleic acids with high affinity, since the molecule-bound nucleic acid complexes with low affinity will first be degraded.

A polyanion competitor (e. G., Dextran sulfate or another polyanion material) is used in a molecular binding nucleic acid separation process to facilitate the identification of molecular binding nucleic acids that are incompatible with the presence of multiple anions. A "polyanionic, non-mature, molecule-bound nucleic acid" refers to a nucleic acid molecule that forms a molecule-binding nucleic acid complex with a high affinity in a solution comprising a polyanion-refractory material in a solution comprising a non-polyanionic refractory material Lt; / RTI &gt; nucleic acid. In this manner, the polyanion-impermeable, molecular-binding nucleic acid can be used to carry out an analytical method for detecting the presence or concentration or the content of each of multiple molecules in a sample, wherein the detection method is a polyanion (E. G., Dextran sulfate). &Lt; / RTI &gt;

Accordingly, a method of producing a polyanion-refractory molecule-bound nucleic acid is provided. A single stranded nucleic acid library is contacted with a biological sample and then each of the multiple molecules and the nucleic acids in the single stranded nucleic acid library reach equilibrium. Introducing a polyanion competitor and allowing a majority of single-stranded nucleic acids in a single-stranded nucleic acid library in solution to react with each of the multiple molecules to react for a time sufficient to form a complex. Also, molecularly-bound nucleic acids in a single-stranded nucleic acid library that can be isolated in the presence of a polyanion competitor will be released from each of the multiple molecules. The mixture separates the single-stranded nucleic acid with high affinity remaining bound to each of the multiple molecules and separates from the solution to remove unbound single-stranded nucleic acids. The single stranded nucleic acid is then released and separated from each molecule. The isolated single-stranded nucleic acid may be amplified again and applied to additional rounds of screening to increase the total performance of the selected molecularly-bound nucleic acid. If the screening of molecularly-bound nucleic acids is not required for a particular purpose, the process may also be used with a minimized reaction time.

Thus, in order to separate a single-stranded nucleic acid that is in contact with a biological sample and a single-stranded nucleic acid library and which reacts together for a time sufficient to form equilibrium bonds between each of the multiple molecules and the nucleic acids contained in the single- Process is provided. Following equilibrium binding, an excess of competing molecules, such as a polyanion competitor, is added to the mixture and the mixture is reacted with an excess of competing molecules for a period of time. A significant portion of the single-stranded nucleic acid will be separated from each of the corresponding multiple molecules during a given reaction time than such predetermined reaction time. The recombination of these "low" affinity single-stranded nucleic acids with molecules is minimized by an excess of competing molecules that nonspecifically bind to the molecule and occupy the molecular binding site. A significant portion of the single-stranded nucleic acid, which is a higher affinity, will remain complexed to the molecule during a given reaction period. At the end of the reaction period, by separating the molecule-bound nucleic acid complex from the mixture, the low affinity population and the high affinity single-stranded nucleic acid population are separated. The separation step can be used to separate single-stranded nucleic acids, which are high affinity from the molecule, and can be used to separate single-stranded nucleic acids (of a single strand nucleic acid class or a high affinity group of single stranded nucleic acids) with high affinity and specificity for the molecule , Identify, sequence, synthesize, and amplify. As with conventional Rervine-SELEX, the single-stranded nucleic acid library isolated from a round of the reverse-SELEX process of the present invention can be used for the synthesis of a new single-stranded nucleic acid library, such as contact, equilibrium binding, The reaction, and the step of separating the single-stranded nucleic acid having high affinity, can be repeated as many times as necessary. Prior to addition of the competitor, an excess of competitor is added to the conjugate resulting in the equilibrium binding between each of the multiple molecules and the single-stranded nucleic acid library, and allowed to react with the competitor for a period of time, resulting in a much higher affinity Lt; RTI ID = 0.0 &gt; nucleic acid &lt; / RTI &gt;

To achieve equilibrium binding, the single stranded nucleic acid library is incubated for at least about 5 minutes, or at least about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 Hour or about 6 hours. The dilution is used as a molecular binding nucleic acid separation process and the reaction of the diluted single-stranded nucleic acid library, molecularly-bound nucleic acid complex is at least about 5 minutes, at least about 10 minutes, at least about 20 minutes, at least about 30 minutes, At least about 1 hour, at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 5 hours, at least about 6 hours.

The separation, production, synthesis and use of molecularly-bound nucleic acids are relevant. The Reverse-SELEX of the present invention is a molecule-bound nucleic acid having a higher rate of cleavage (t _1/2 ) from the non-covalent molecular binding nucleic acid complex than the conventional molecular-binding nucleic acid obtained by conventional reverse-SELEX. For a mixture comprising a molecular binding nucleic acid and a target non-covalent molecular binding nucleic acid complex, t _1/2 represents the half-life of the molecular binding nucleic acid dissociated from the molecular binding nucleic acid complex. T _1/2 of the molecular binding nucleic acid according to the present invention is about 30 minutes or more for about 30 minutes to about 240 minutes for about 30 minutes to about 60 minutes for about 60 minutes to about 90 minutes for about 90 minutes to about 120 minutes for about 120 minutes to about From about 150 minutes to about 180 minutes to about 180 minutes to about 210 minutes from about 210 minutes to about 240 minutes.

The characteristic of the molecular-binding nucleic acid separated by the Reverse-SELEX procedure of the present invention lies in its high affinity for its target. The molecular binding nucleic acid has a degradation constant (Kd) for its target of less than about 1 μM, less than about 100 nM, less than about 10 nM, less than about 1 nM, less than about 100 pM, less than about 10 pM, less than about 1 pM It will be selected from a kind.

Preferably, the present invention provides a method for separating a molecular binding nucleic acid primary library having a high affinity for a molecule from a single-stranded nucleic acid library, said method comprising the steps of: (a) preparing a single- And a single-stranded nucleic acid library are contacted with each other to form a molecular-binding nucleic acid complex by preferentially binding a single-stranded nucleic acid having a high affinity to the molecule, (c) Separating the molecule-binding nucleic acid complex having high affinity, and (d) separating the molecule-bound nucleic acid for the molecule.

The method further comprises amplifying a nucleic acid that binds to each of the multiple molecules to produce a single-stranded nucleic acid pool enriched with a specific single-stranded nucleic acid capable of binding to each of the multiple molecules while producing the molecule-bound nucleic acid complex with the highest affinity Step can be repeatedly included. A molecular binding nucleic acid separation process having a higher affinity comprises diluting a single-stranded nucleic acid library comprising a molecular-binding nucleic acid complex, adding at least one competitor to a single-stranded nucleic acid library comprising a molecularly-bound nucleic acid complex, and Diluting the single-stranded nucleic acid library comprising the molecular-binding nucleic acid complex and adding at least one competitor to the single-stranded nucleic acid library comprising the molecular-binding nucleic acid complex.

There is provided a method of separating a molecular binding nucleic acid primary library having a high affinity for each of a plurality of molecules constituting a biological sample, said method comprising the steps of (a) preparing a single-stranded nucleic acid library, (b) Strand nucleic acid library, wherein a single-stranded nucleic acid having increased affinity than another single-stranded nucleic acid in a single-stranded nucleic acid library binds to each of the multiple molecules to form a molecular-binding nucleic acid complex, (c) (D) adding an excess of at least one competitor molecule to the reaction solution of step (c); (e) adding an excess amount of at least one competitive molecule to the reaction solution of step Reacting a reaction solution consisting of a single-stranded nucleic acid library, a molecular-binding nucleic acid complex and a competitive molecule for a predetermined period of time, (f) (G) dissociating the molecule-bound nucleic acid complex to produce a free nucleic acid, and (h) separating the single-stranded nucleic acid capable of binding to each of the multiple molecules with increased affinity Amplifying the free single-stranded nucleic acids so as to obtain a single-stranded nucleic acid pool having a higher affinity in the nucleic acid-free nucleic acid pool, thereby separating the molecular-binding nucleic acid primary library for the corresponding multiple molecules.

There is provided a method of separating a molecular binding nucleic acid primary library having a high affinity for multiple molecules constituting a biological sample, the method comprising: (a) preparing a single-stranded nucleic acid library, wherein the single- Wherein at least one, or at least one, all, or all of the pyrimidines in each single stranded nucleic acid is chemically modified at the 5-position, (b) a plurality of molecules and a single stranded nucleic acid library Single-stranded nucleic acids in a single-stranded nucleic acid library, wherein the single-stranded nucleic acids have increased affinity over the other single-stranded nucleic acid to form a molecularly-bound nucleic acid complex; (c) Separating the single-stranded nucleic acid pool, and (d) Amplifying single-stranded nucleic acids with increased affinity so as to obtain a single-stranded nucleic acid pool with increased affinity in a single-stranded nucleic acid library capable of separating the molecule-bound nucleic acid primary library for multiple molecules .

The molecular binding nucleic acid primary library that binds to the sample should reflect the diversity of the sample as it is. Therefore, Reverse-SELEX is a process of selecting a single-stranded nucleic acid pool that specifically binds specifically to a specific molecule by repeatedly performing selection and amplification. In order to accomplish this object of Reverse-SELEX, We provide a molecular-binding nucleic acid primary library that reflects the diversity of the molecules contained in the sample by diversifying the washing steps instead of performing only the amplification.

Separation of single-stranded nucleic acid complex pools bound to the molecules constituting the sample formed in the various reaction solutions and conditions can be performed by various methods using a solid support, capillary electrophoresis, filtration and the like.

Preferably, a solid case of using a support, the reaction solution with a cellulose membrane disc (nitrocellulose membrane disc) of the sample-nitro (50 mM TrisCl (pH 7.4) , 5 mM KCl, 100mM NaCl, 1 mM MgCl 2, 0.1% NaN ₃ ) and allowed to react for 30 minutes with shaking. The disk with the molecules constituting the biological sample was treated with the single-stranded nucleic acid library or the reaction solution having the molecular binding nucleic acid pool and allowed to react for 30 minutes. Single-stranded nucleic acid complexes adhered to the disc by removing single-stranded nucleic acid or unbound molecularly-bound nucleic acid bound or unspecifically bound by a single selection process of repeating the washing process with various washing buffers after the reaction, Lt; RTI ID = 0.0 &gt; nucleic acids. &Lt; / RTI &gt; Wash buffer to ensure the molecular-single-stranded nucleic acid complexes used 0 to 1 x reaction solution or 0 to 500 mM EDTA solution. At this time, the above selection and amplification steps may be repeated many times. A molecule-bound nucleic acid library may be prepared using the washed complex.

Preferably, the method using capillary electrophoresis, the sample, was added to the reaction solution containing a single-stranded nucleic acid library or a molecular-bonded nucleic acid pool and allowed to react for 30 minutes. The reaction mixture solution is subjected to capillary electrophoresis with a buffer solution (50 mM Tris-HCl, pH 8.2). All analyzes using capillary electrophoresis of the present invention were performed using a P / ACE 5000 CE-LIF system (Beckman Coulter) equipped with a fused-silica capillary (Beckman Coulter; length 37 cm x inner diameter 75 m). The excitation of the fluorescent material with a 3 mW argon ion laser (Ar-ion) at 488 nm attached to the system and a signal emitted by a 520 nm filter are collected through a detector in the LIF system. All the solutions used for the analysis and capillary treatment were filtered through a 0.2-μm pore size filter. The capillaries were washed with 1 N NaOH and distilled water for 5 minutes each. After washing, 1N NaOH, distilled water, Wash the capillary tube for 2 minutes with buffer solution. A voltage of 10 kV was applied thereto to perform electrophoresis, and the result was analyzed. Single-stranded nucleic acid complexes are specifically generated and separated by the analysis of the formation of complexes of molecule-single-stranded nucleic acids using capillary electrophoresis. At this time, the above selection and amplification steps may be repeated many times. A molecule-bound nucleic acid library may be prepared using the washed complex.

Preferably, a filtration method using a structure of nitrocellulose and nylon and a sample are reacted in the above reaction solution having a single-stranded nucleic acid library or a molecular-bonded nucleic acid pool for 30 minutes to produce a molecule-molecule-bound nucleic acid complex. The molecular binding nucleic acid pool to be bound to the sample (molecule) is selected by treating the reaction mixture solution with a structure composed of nitrocellulose and nylon and applying pressure to the molecule-single-strand nucleic acid complex, On the cellulose filter, unbound single stranded nucleic acid is present on the nylon. Single-stranded nucleic acid complexes are removed by removing the unbound or non-specifically bound single-stranded nucleic acid in the nitrocellulose filter as a single selection process of recovering the nitrocellulose filter and repeating the washing procedure with various washing buffers . The wash buffer for securing the molecular-molecular binding nucleic acid complexes is 0 to 1 x reaction solution or 0 to 500 mM EDTA solution. At this time, the above selection and amplification steps may be repeated many times. A molecule-bound nucleic acid library may be prepared using the washed complex.

(Molecular Binding Nucleic Acid Secondary Library)

The variety of molecules in the sample, their presence, and their frequency of occurrence can be used to develop biomarkers and to identify ligands, limits of detection, and detection for the analysis of unknown and multi- There are many problems such as resolution and dynamic range. Accordingly, in order to overcome this problem, the present invention provides a molecular-binding nucleic acid primary library that reflects the types and frequencies of molecules in a biological sample, and then performs normalization, reduction, SSH and normalization- To provide a nucleic acid secondary library.

Samples can be divided into analytical samples and comparative samples. "Analytical sample" refers to any substance, solution or mixture containing a plurality of molecules and known to comprise at least one target molecule. The exact amount or concentration of any target molecule present in the assay sample may also be well known. The analytical sample includes biological samples and samples that may be used for environmental or toxin testing, such as, for example, water and industrial wastewater that may be contaminated or contaminated. The analytical sample may also be an end product, an intermediate product or a manufacturing process, for example a by-product of the preparation process. The analytical sample may comprise any suitable assay medium, buffer or diluent which may be added to the material, solution or mixture obtained from the organism or any other source (e.g., environmental source or source of business).

The preparation of the molecular-binding nucleic acid secondary library used in the present invention can be carried out by preparing a molecular-binding nucleic acid primary library (analytical sample-molecule-bound nucleic acid primary library) which binds to the molecule in the biological analysis sample to be analyzed from the prepared single- Library) and a molecular-binding nucleic acid primary library (a comparative sample-molecular-binding nucleic acid secondary library) that binds to a molecule in a biological comparison sample compared to the analytical sample, respectively.

The present invention provides a method for preparing SSH, equalization, subtraction, or equalization-subtracted molecular binding nucleic acid libraries from molecular binding nucleic acid primary libraries of samples.

The basic concept of subtraction is "to distinguish between a nucleic acid pool (tester) that contains a nucleotide sequence of interest and a nucleic acid pool (driver) that does not have a nucleotide sequence of interest in excess of the amount of the driver Hybridization ".

The tester and driver DNA clusters can be hybridized so that only DNA that is collectively present in both DNA clusters forms double strands. After the hybridization reaction is complete, the tester-driver double-stranded nucleic acid, unconjugated driver single-stranded nucleic acid is removed, and the remaining nucleic acid is used to prepare a single-stranded nucleic acid pool that is the base sequence present only in the tester.

Since the present invention is not only to equalize the DNA in the library but also to remove (subtract) the DNAs that are common to other libraries, the method according to the present invention is particularly suitable for SSH and equalization- It is efficient for the production of DNAs.

First, the structure and primers of oligonucleotides for the preparation of the preliminary tester and the tester from the molecular binding nucleic acid prepared from the oligonucleotide are shown in FIGS. 6 and 7.

Preferably, the analysis sample-RNA molecule-bound nucleic acid is reverse-transcribed to prepare an assay sample-cDNA molecule-bound nucleic acid, and then the prepared assay sample-cDNA molecule-bound nucleic acid and the assay sample- .

Preferably, the primer for the preparation of the preliminary tester 1 is a DS primer and the primer SSH primer for preparing the tester 1 is complementary to a complementary base sequence of an adapter (additional base sequence) 1 and 5 'conserved regions SSH reverse primer tester 1, which is a primer (SSH forward primer tester 1) consisting of a nucleotide sequence and a primer (DS reverse primer) that binds complementary to the 3 'conserved region. The analyte-RNA molecule-bound nucleic acid is a structure having a functional base sequence corresponding to the primer.

Preferably, the primer for the preparation of the preliminary tester 2 is a DS primer and the primer SSH primer for preparing the tester 2 is prepared by complementing the complementary base sequence of the 5 'conserved region with the analytical sample-DNA molecular binding nucleic acid as a template SSH forward primer tester 2, which is a primer binding primer (DS forward primer), and primer (SSH reverse primer tester 2), which has a base sequence complementary to the 3 'conserved region and adapter 2. The analyte-RNA molecule-bound nucleic acid is a structure having a functional base sequence corresponding to the primer.

Preferably, the base sequences of the adapter 1 and the adapter 2 should be designed so as to provide a position where the corresponding primer can be complementarily bonded so that the PCR process can be performed.

Preferably, the structure and the primer of the oligonucleotide for the manufacture of the driver are as shown in FIG. 8, the primer is a DS primer and the oligonucleotide is complementary to the DS reverse primer to reverse reverse, It has a base sequence corresponding to the DS primer with a cDNA as a template.

Preferably, a single-stranded cDNA library is prepared by reverse-transcribing the RNA molecule-bound nucleic acid constructing the comparative sample-RNA molecule-bound nucleic acid library with a DS reverse primer, and PCR is performed using the DS forward and reverse primers as a template. Double-stranded DNA molecule-bound nucleic acids can be prepared and used as preliminary testers and drivers.

The specific method for preparing the SSH molecular binding nucleic acid library according to the present invention is as shown in FIG. 9, wherein (a) the RNA constituting the molecule-binding nucleic acid library as the assay sample-RNA is reverse-transcribed with a DS reverse primer as a template, Preparing a library and preparing a double-stranded DNA preliminary tester by a standard PCR method as a pair of DS primers, (b) reverse-transcribing the RNA of the molecular-binding nucleic acid library, which is a comparative sample-RNA, as a template with a DS reverse primer, (C) dividing the preliminary tester into a preliminary tester 1 and a preliminary tester 2, and using the former as a template, an SSH forward primer tester 1 and a DS reverse primer Tester 1 and the latter using DS forward primer and 3 'SSH reverse primer _ tester 2 (D) a step of performing primary hybridization, secondary hybridization and nested PCR with the driver, the tester 1 and the tester 2, and (e) the step of obtaining the SSH molecular binding nucleic acid library, As a result, a more efficient SSH molecule-bound nucleic acid library can be prepared in comparison with the comparative sample.

Preferably, the reaction of the tester with the driver is performed by two solution hybridization.

Preferably, the tester produces two tester hybridization solutions, and the driver hybridization solution is mixed with each of the tester hybridization solutions to perform primary hybridization.

Preferably, the steps of removing the single-stranded driver from the tester / driver double strand obtained by reacting the two types of tester with the driver by a PCR process are executed.

Preferably, the driver hybridization solution containing the mineral oil is heated to the double strand separation temperature of DNA, one of the two hybridization tester hybridization solutions is added to the driver hybridization solution, and the remaining one The hybridization of the tester hybridized with the primary hybridization is added to perform the secondary hybridization.

Preferably, after the secondary hybridization is completed, DNAs capable of nest PCR can be prepared by converting both ends of a double-stranded DNA, which is a cohensive terminal formed, to a blunt end. Preferably, the DNA prepared is a DNA having an RNA polymerase binding site and a restriction enzyme recognition site.

In the present invention, by using Duplex-Specific Nuclease (DSN) (A) preparing double-stranded DNA by standard PCR using the RS DNA primer and RS reverse primer as a template for the DNA molecule-bound nucleic acid library, (b) Hybridizing the double-stranded DNA with the solution, (c) removing the double-stranded DNA using an enzyme, and (d) amplifying the remaining single-stranded DNA into a template. The analytical sample-DNA molecule-bound nucleic acid library may be a reverse transcription product of an RNA molecule-bound nucleic acid library that binds to a biological sample, or may be a DNA molecule-bound nucleic acid library that binds to a biological sample.

Using Duplex-Specific Nuclease (DSN) As shown in FIG. 10, (a) the DNA-binding nucleic acid library of the assay sample-DNA molecule was used as a template and the nucleotide sequence complementary to the complementary base sequence of the adapter 1 and the 5 'conserved region was prepared Double-stranded DNA was prepared by standard PCR using a forward primer and a reverse primer consisting of a complementary binding region to the 3 'conserved region and an adapter 2, and the single-stranded PCR was performed using the single-stranded PCR as a template. (B) preparing a driver DNA by a standard PCR process using a DS forward primer and a DS reverse primer using the above-mentioned comparative sample-DNA molecule-bound nucleic acid library as a template, and (c) The tester / driver duplex and the non-combined single strand of the driver obtained by the reaction were reacted with the enzyme In I, and the remaining includes the step of amplifying the single-stranded tester.

Preferably, the analytical sample-DNA molecule-bound nucleic acid library is a reverse transcription product of an RNA molecule-bound nucleic acid library binding to a biological sample, or may be a DNA molecule-bound nucleic acid library binding to a biological sample.

Preferably, the molecular binding nucleic acid DNA library is a molecular binding nucleic acid cDNA library prepared by reverse transcribing a molecular binding nucleic acid RNA library as a template, or a molecular binding nucleic acid DNA library.

Preferably, the base sequences of the adapter 1 and the adapter 2 should be designed so as to provide a position where the corresponding primer can be complementarily bonded so that the PCR process can be performed.

In the present invention, the above-described equalization and subtraction may be successively performed to produce a subtracted library from an equalization library to produce an equalization-subtracted library.

The present invention relates to a method for performing an SSH process, an equalization process, a subtraction process, and an equalization-subtraction process of the above-mentioned molecule-bound nucleic acid library by performing a cDNA library in order to effectively analyze mRNA in a biological sample during an experimental method of molecular biology Obtaining a library (secondary nucleic acid library) of molecular binding nucleic acids more efficient in analyzing samples from the above-mentioned molecular binding nucleic acid library (primary nucleic acid library) by the "SSH process, equalization process, subtraction process and equalization-subtraction process" The SSH process of the primary nucleic acid library, the homogenization process, the primer design optimized to perform the homogenization-subtraction process, the SSH process of the primary nucleic acid library, and the homogenization-reduction process of the primary nucleic acid library so that the oligonucleotide constituting the oligonucleotide library Process, Reduction Process and Equalization - Subtraction The present invention relates to a method of manufacturing a semiconductor device.

Equalization in cDNA libraries is the process of reducing the number of overexpressed transcripts in a cDNA library and increasing the number of rarely expressed transcripts, and subtraction is the only type of transcript that is present in a particular library of two cDNA libraries . Thus, there has been proposed a method of converting mRNA extracted from a biological sample into cDNA to equalize and subtract mRNA, and methods for equalizing and subtracting mRNA outside molecules have not been specifically proposed.

The method for preparing a molecularly-coupled nucleic acid secondary library according to the present invention is not a direct preparation of a molecular-binding nucleic acid primary library binding to an analytical sample to be analyzed. A molecular binding nucleic acid primary library that binds to a comparative sample different from the analytical sample is prepared separately from the molecular binding nucleic acid primary library that binds to the analytical sample to be analyzed. The prepared molecular binding nucleic acid primary library is subjected to an equalization and subtraction process To thereby improve the analysis efficiency of the analytical sample by the molecular binding nucleic acid by preparing a molecular binding nucleic acid secondary library specifically binding to the analytical sample or the comparative sample showing a difference between the analytical sample and the comparative sample, To be used in characterizing analytical samples bound to a molecularly-coupled nucleic acid.

The molecular binding nucleic acid secondary library which is an equalization, subtraction, homogenization-subtraction or SSH molecular-binding nucleic acid library prepared according to the present invention is a basis for confirming whether quantitative difference information can be provided, Quantitative screening technology ".

Using the selected molecular binding nucleic acids, the quantification of the molecular binding nucleic acid in the complex of the molecules of the analytical sample and the comparative sample and the molecular binding nucleic acid is detected using a method selected from the group consisting of Q-PCR, MS and hybridization Optionally quantified. The Q-PCR process may be performed using TaqMan PCR, intercalating fluorescent dye during PCR, or molecular beacon during PCR, and the hybridization process may be performed using the molecular binding nucleic acid or the above- The amplification product of the molecule-bound nucleic acid binds to the capture probe.

In the present invention, when performing the equalization process, the subtraction process, the equalization-reduction process or the SSH process, the reference material for the quality control of SSH, equalization, subtraction or equalization- Can be used as a reference material for quality control, and the degree of equalization can be evaluated by using molecules having different frequencies of occurrence, that is, molecules having a high frequency of occurrence, and low molecules as reference materials for the equalization process.

It is an object of the present invention to provide a database of binding data of molecules and molecular binding nucleic acids of analytes and comparative samples using molecular binding nucleic acids selected from the above molecular binding nucleic acid primary library and molecular binding nucleic acid secondary library, The present invention relates to a method for selecting an analytical molecular binding nucleic acid that contributes to the analysis of a biological meaning by improving the analytical efficiency of a target analytical sample and a comparative sample by applying a process of selecting molecular binding nucleic acids contributing to the analysis, will be.

(Selecting Analytical Molecule Binding Nucleic Acids)

A method for selecting a useful molecule-bound nucleic acid using the molecular-binding nucleic acid primary library and the secondary library includes analyzing the nucleotide sequence and frequency of the molecular-binding nucleic acid constituting the library to construct a database for the analysis sample and the comparative sample, And the step of selecting the molecule-bound nucleic acid is shown in FIG.

Using the molecularly-bound nucleic acid obtained from the prepared library, a binding database of the molecules of the analytical sample and the comparative sample, the molecular binding nucleic acid to be obtained, and the molecule to be obtained is inspected and a database thereof is constructed. And a method for separating and identifying the molecules using the selected analytical molecular binding nucleic acid can be suggested.

According to the present invention, there is provided a method for analyzing the nucleotide sequence and frequency of molecular binding nucleic acid used for generating a binding profile between a molecule-bound nucleic acid and a molecule, wherein the nucleotide sequence and the frequency of occurrence of the molecular- It is used to analyze the biological significance of the molecules contained in the sample.

The method for analyzing the nucleotide sequence and the frequency of the molecular binding nucleic acid according to the present invention is a method for analyzing the molecular binding nucleic acid constituting the molecular binding nucleic acid primary library or the molecular binding nucleic acid secondary library prepared in the above described Next Generation Sequencing ) Process. The NGS refers to a technique of fragmenting a full-length dielectric in a chip-based and PCR-based paired end format and performing sequencing at a very high speed based on chemical hybridization of the fragment.

Next-generation sequencing refers to sequencing technology such as illumina, Roche, and Toronto, and broadly includes third-generation technologies Pacificbio and RainDance, as well as fourth-generation technologies. The difference between these technologies is the next generation technology based on the chemical reaction of oligo on a chip or bead basis and the 3rd generation or the 4th generation when the speed and sequencing technology are dramatically improved in the way of decoding DNA .

Signal intensity refers to the value at which the color and intensity of a DNA fragment, such as an oligo, binds to a piece of DNA attached to the chip and is read by the scanner as a function of binding and base. Sequencing folds means the number of times to perform sequencing. Sequencing is generally performed at 10x, but when 20x is used, the result is usually. When sequencing is performed at a multiple of 40x, a large number of random alleles are stably acquired It is possible.

The Next Generation Sequencer replaces several weeks of DNA library construction and bacterial cloning with several hours of polymerase chain reaction amplification, compared to conventional Sanger-based sequencing, and several capillary arrays The parallel sequencing in the capillary array can sequence hundreds of thousands of clones simultaneously. In addition, high-throughput sequencing is possible because it is possible to calculate the results of multiple sequencing analyzes, and this high-density parallel sequencing is effective for detecting many target molecules simultaneously . However, due to the biasing phenomenon occurring during the polymerase chain reaction for library production, a small amount of target molecules is buried by a large amount of target molecules.

Actual clinical samples often have very small amounts of target molecules, so that it is difficult to detect very small amounts of target molecules by conventional methods. In order to solve the above problem, it is possible to solve the problem by increasing the depth (read number) of the NGS sequencing to increase the limit value.

Generally, methods and processes for isolating a nucleic acid sample from a biological sample and constructing a sequencing library can be suitably selected according to different sequencing techniques, as long as the conventional technique is employed. The detailed process can refer to a procedure provided by a sequencer manufacturer such as Illumina Company and is described, for example, in Multiplexing Sample Preparation Guide (Part # 1005361; Feb 2010) of Illumina Company, which is incorporated herein by reference, or Paired-End Sample Prep Guide (Part # 1005063, Feb 2010). The method and apparatus for extracting the nucleic acid from the biological sample are not particularly limited and can be carried out using a commercial nucleic acid extraction kit.

In the present invention, a method and a preparation method of a nucleic acid sample for constructing a sequencing library for selecting a molecular-binding nucleic acid are described in detail by referring to a plurality of molecules constituting a sample to be analyzed and a single- Forming a nucleic acid sample by separating the molecule-molecule-bound nucleic acid complex pool formed, and constructing a base sequence library from the prepared nucleic acid sample. .

The method and the process for preparing the molecule-molecule-bound nucleic acid complex pool can be designed in consideration of the binding specificity and affinity of the molecule and the molecule-bound nucleic acid, and reference may be made to a process for preparing a molecular-binding nucleic acid library.

The separation of the molecule-molecule-bound nucleic acid complex pool constituting the sample formed under the various reaction solutions and conditions can be carried out in various ways. A method of separating a molecule-molecule-bound nucleic acid complex pool by harvesting a solid-support of a molecule-molecule-bound nucleic acid complex pool attached to a solid support formed by fixing molecules constituting a sample to a solid support and contacting with a molecular binding nucleic acid library, A capillary electrophoresis method in which capillary electrophoresis is performed after contacting a molecule constituting the sample with a molecule-bound nucleic acid library, and a capillary electrophoresis method for separating the molecule-molecule-bound nucleic acid complex pool and the unbound or unbound single-stranded nucleic acid, And a filtration method in which a molecule-bound nucleic acid library is contacted, followed by treatment with a structure of nitrocellulose and nylon, followed by filtration to harvest a molecule-single-stranded nucleic acid pool, and the like.

The molecular binding nucleic acid pool can be separated from the separated molecular-molecular binding nucleic acid pool and the sequencing library can be prepared by a known method.

After the sequencing library is constructed, the obtained sequencing library is applied to the sequencer to obtain the corresponding base sequence results consisting of multiple base sequence data (reference sequences). According to embodiments of the present disclosure, methods and apparatus for sequencing include chain termination (Sanger), but are not particularly limited to this example, and a high-throughput sequencing method is preferred. Thus, by utilizing the deep sequencing and high throughput features of these devices, the efficiency can be further improved, thereby making it possible to precisely and accurately further improve subsequent analysis using sequencing data such as statistical tests. High throughput sequencing methods include, but are not limited to, next generation sequencing techniques or single sequencing techniques. The sequencing platform (Metzker ML, sequencing technologies-the next generation, Nat Rev Genet. 2010 Jan; 11 (1): 31-46) Including but not limited to Roche-454 (pyrosequencing) sequencing platform, a single sequencing platform (technology), including Helicos Company's True Single Molecule DNA sequencing, the Pacific Biosciences Company single molecule real- SMRT ^TM ), and Norpore sequencing technology from Oxford Nanopore Technologies (Rusk, Nicole (2009-04-01). Cheap Third-Generation Sequencing. Nature Methods 6 (4): 244-245) It is not limited. As the sequencing technique evolves progressively, one of ordinary skill in the art can understand other sequencing methods that can be used for all genome sequencing. According to certain examples of this disclosure, the entire genome sequencing library can be sequenced by at least one selected from Illumina-Solexa, ABI-SOLiD, Roche-454, and monomolecular sequencing devices.

After obtaining the result of molecular binding nucleic acid sequencing in the present invention, the sequencing results of the molecular binding nucleic acid primary library in the first place are such that the nucleotide sequences prepared in the analytical sample are "analytical nucleotide sequence pool" and the nucleotide sequences prepared in the comparative sample " , Determining the same base sequence (that is, the same molecular binding nucleic acid) by analyzing the Reed base sequence of the pool, determining the frequency of occurrence in the assay base sequence pool or the comparison base sequence pool for the determined base sequence , A step of selecting a base sequence (i.e., a molecular binding nucleic acid) that can compare or represent the analytical sample and the comparative sample.

The frequency of the molecular binding nucleic acid obtained from the NGS analysis means the ratio of the complex formed by the specific molecular binding nucleic acid in the molecule-molecule binding nucleic acid complex pool, that is, the ratio of the specific molecule in the multiple molecules constituting the sample It is reasonable to interpret it as doing. That is, it is reasonable to judge that the frequency of the corresponding molecule is high if the frequency of the molecular-binding nucleic acid is high, and this is proved by the embodiment of the present invention.

In the present invention, a reference material for internal quality control and measurement is determined and analyzed together with the molecules constituting the sample in the same test zone to determine the appearance frequency and the molecular weight of the reference substance in a molecular binding nucleic acid The corresponding molecule can be quantified.

Preferably, statistically significant samples of analytical samples and comparative samples with biological significance are collected and the above procedure is repeated to construct a database based on the biological meaning, and statistically compare or represent the analytical sample with the comparative sample It is also possible to determine a significant molecular binding nucleic acid.

Also, the result of sequencing of the molecular-binding nucleic acid secondary library can be obtained by comparing and comparing the analytical sample and the comparative sample with each other by comparing the analytical base sequence pool and the comparative base sequence pool with a reference sequence Including the steps of: Also, the nucleic acid of the molecule-molecule-bound nucleic acid complex pool obtained by reacting with the analytical sample or the comparative sample statistically significant with the above-mentioned molecular binding nucleic acid is analyzed by a nucleic acid analysis method, and the molecular binding nucleic acid May be further included.

The nucleic acid analysis method includes NGS, biochip technology, PCR-based analysis technique, and the like. Each recognizes a different analyte and optionally a plurality of molecular binding nucleic acids are introduced into the sample and any of the assays described above can be performed. Any suitable multi-nucleic acid detection method can be applied to isolate molecularly-bound nucleic acids and then to measure the different molecularly-bound nucleic acids separated. Can be achieved by hybridization to complementary probes that are individually arranged on a solid surface and each of the different molecular binding nucleic acids can be detected based on molecular weight using mass spectrometry. Each of the different molecular binding nucleic acids can be detected based on electrophoretic mobility, such as in capillary electrophoresis, in gels or in liquid chromatography. A unique PCR probe can be used to quantify each of the different molecular binding nucleic acids using QPCR. In another embodiment, each of the different molecular binding nucleic acids can be detected based on molecular weight using mass spectrometry.

In addition, the reference sequence can be determined by comparing the analyzed base sequence with the comparative base sequence, determining the reference sequence, and determining the nucleotide sequence of the analyzed base sequence and the comparative base sequence based on the clinical information of the reference sequence using an algorithm, The method comprising the steps of:

In the present invention, the nucleotide sequence and appearance frequency of the nucleic acid as a result of analyzing the nucleic acid of the molecular-binding nucleic acid and the molecular complex pool by NGS means the &quot; binding profile &quot; reflecting the mode of the molecule of the sample bound to the molecular- have.

The molecular binding nucleic acid according to the present invention is preferable in terms of the production cost of the sequencing and the efficiency of the analysis in order to reduce the number of molecular binding nucleic acids to be analyzed if the biological significance of the biomolecules can be analyzed with the same similar precision.

For this reason, by analyzing the contribution of each molecule-bound nucleic acid to the biological semantic analysis of the molecule and selecting the molecular-binding nucleic acids based on the analyzed contribution within the scope of analyzing the biological meaning of the molecule, And reducing the number of molecularly-bound nucleic acids.

Preferably, the molecular binding nucleic acid thus obtained is synthesized to include the molecular binding nucleic acid analysis. In order to analyze the biological significance of the molecules contained in the biological sample, Lt; RTI ID = 0.0 &gt; nucleic acids. &Lt; / RTI &gt;

Preferably, in order to analyze the biological significance of the molecules contained in the sample, characterized by consisting of the obtained SSH, equalization, subtraction, equalization-subtracted molecular binding nucleic acid and / or molecular binding nucleic acid, Lt; RTI ID = 0.0 &gt; nucleic acids &lt; / RTI &gt;

Preferably, the method further comprises preparing the obtained SSH, equalization, subtraction, equalization-subtracted molecular binding nucleic acids and / or the molecular binding nucleic acids, reacting the molecules of the molecular binding nucleic acids with the molecules of the biological sample, Nucleic acid complex pool and separating the molecule-molecule-bound nucleic acid complex pool; analyzing molecular binding nucleic acids separated from the separated molecular-molecular binding nucleic acid complex pool to obtain a binding profile; And analyzing the biological meaning of the molecules by comparing the already obtained profile data with each other, thereby providing a method for molecular analysis using molecule-bound nucleic acids.

Preferably, from the accumulated analysis results obtained by the molecular analysis method using the molecular binding nucleic acid, the specific molecular binding nucleic acids contributing to the analysis of the biological meaning of the molecule are determined. &Lt; / RTI &gt;

The molecular binding nucleic acid selection and preparation method of the present invention compares two or more characteristic physiological conditions compared to that of FIG. 12, particularly molecular binding nucleic acid libraries for cells and protein bodies, which reflects the onset tissue or organ and its physiological environment The molecular binding nucleic acids thus prepared are used to demonstrate the qualitative difference between biological samples (analytes and comparative samples), and to identify molecules contained in a biological sample Separation and identification.

Preferably, a molecule binding to the molecular binding nucleic acid is identified using a specific molecular binding nucleic acid which contributes to the analysis of the biological meaning of the molecule, from the accumulated analysis results obtained by the molecular analysis method using the molecular binding nucleic acid And a molecular analysis method using the molecule-bound nucleic acid.

Although the method using NGS is useful, it is also possible to prepare and analyze two different probes that bind to the samples by treating the molecular binding nucleic acid pool in the analytical sample and the comparative sample. One probe may have a Cy3 dye, and the other a Cy5 dye. For example, the analytical sample and the comparative sample are reacted with the same molecular binding nucleic acid pool. Each sample is treated individually in the same way. The samples can be uniformly mixed and the remaining steps of the assay can be performed. A direct comparison of any different expression between the analytical sample and the comparative sample (i. E., Different amounts or concentrations of the target in the sample) is possible by separately measuring the signal from each label reagent. This method can be integrated into any other assay. In addition, in addition to using different dyes, including the use of fluorescent dyes, other labels can be used to distinguish signals from different respective probes. Molecular binding nucleic acids used in each sample may have different staining reagents. This method is useful, for example, when the readout is a QPCR or DNA hybridization array.

The present disclosure also describes molecular-molecular binding nucleic acid complexes which facilitate the separation of the assay components from the molecular binding nucleic acid complexes and which enable the separation of molecular binding nucleic acids for detection and / or quantification.

(Determination of biological meaning)

It is also possible to determine useful molecular binding nucleic acids according to the criteria of biological significance for the data produced by many molecular binding nucleic acids with the above multiple screening techniques, the biological meaning of which is illustrative but not limited thereto.

Many of the data generated by the present invention can produce various information related to cells, tissues or diseases with information of a large amount of information having high dimensional characteristics.

A database is built according to the biological meaning by one or more molecular values for a standard sample which is a well defined biological sample, and then a feature is selected, and a step of storing a learned classifier as a selected characteristic molecule and a step The system may be configured to obtain further molecular analysis results and to determine nucleic acids that contribute to the determination of biological significance using the learned and stored classifier.

And provides a biological semantic determination system for determining the biological meaning of the one or more molecular analysis results from the object.

The clinical test values include "classification", "score", and "index" that support the process of making decisions about biological meanings for diagnosis, treatment, palliation, treatment and prevention of diseases or other conditions Clinical Information &quot; of the sample or sample from which the biological meaning has been determined, and the one or more molecular values, and then collecting the collected information from statistical techniques or machine learning algorithms It may also be a produced specific result that allows the inference or discrimination of the disease.

Further comprising a feature selection procedure for finding important molecules in the one or more molecules to reduce the dimension or to identify the main molecules through modification of the characteristics in order to calculate the clinical test value from the input molecular value You may.

The feature selection is a filter method in which learning is performed so as to give the most accurate output with the numerical values of the inputted learning group to evaluate only individual molecular values of individual features of the feature set, A wrapper method using classification performance of a specific classifier as an evaluation scale, a hybrid method in which an embedded method in which feature selection and classifier learning are simultaneously performed, or a hybrid method in which a filter method and a wrapper method are combined is selected It may be crystalline. There are two types of feature selection method according to the generation method of the feature subset. First, the filter method is used to select the subset in the feature and execute it in the classification algorithm. The evaluation of how good the selected subset is is evaluated using the unique properties between the features belonging to the subset and the classification criteria. An example of a filter method is an information gain. This is often used as a criterion for fitness of terms in the field of machine learning, and the amount of term information in each category is calculated by taking into account not only the frequency of appearance in the document but also the frequency of occurrence. Second, the wrapper method is to apply the classification algorithm to the dataset to find the best feature. Unlike the filter method, the superiority of the corresponding feature subset is evaluated by using the direct classifier, and the classifier is classified according to the feature subset every time the classifier to be used is determined in advance. The wrapper method is time consuming when the number of attributes is large. A typical example of a wrapper method is a genetic algorithm (GA).

The module for performing the learning with the pre-processed result and generating the patient's model is a procedure for classifying the selected features by each class through an appropriate classifier.

In the present invention, an artificial neural network is used, and it is applied to various fields such as pattern recognition, function approximation, and classification technique because of its characteristics of determining behavior according to input and output. An artificial neural network is composed of several layers, nodes, and neural network connection weights. The neural network interlayer connection scheme used in the present invention is a feed-forward scheme. Based on the input pattern, the neural network connection weights for each node and the activation function were used to calculate the output value. If the estimated value is different from the actual result value through the generated combination information, the process of comparing the calculated value with the actual result value is repeatedly found to reduce the error.

The filter method may be one selected from the group consisting of information gain, signal to noise ratio, t-statistic, Pearson correlation coefficient, principal component analysis, Determination of the clinical test values from the molecular values was performed in a group consisting of multilayer neural networks, k-nearest neighbors, a decsion tree, support vector machines, and Fisher's linear discriminant analysis Or may be performed with a classifier of one selected.

The wrapper method may be a genetic algorithm (GA) by applying a classification algorithm to the data set to find the optimal molecule.

The biological meaning means a physiological change of the person who took the sample or the sample. Decision making is performed for the purpose of prevention, diagnosis, treatment, relief and health management of the treatment according to the clinical test value It may be the information necessary for the process.

Based on the analysis results of each of the multiple molecules of the sample, the biological semantic determination method may be similarity of the user and the control group or the comparison group database, and the biological meaning may be determined by referring to the clinical information of the samples constituting the control group and the comparison group have. More specifically, molecular binding nucleic acids that specifically bind to multiple molecules of a pathological condition and a healthy sample and contribute to the analysis of biological significance can be selected, and such a series of processes is referred to as &quot; "to be.

(Uses of Molecular Bound Nucleic Acids)

The analytical molecular binding nucleic acid selected according to the methods described herein is a nucleic acid having a dissociation constant (Kd) with the specific molecule of less than 2.0 x 10 &lt; ^-9 &gt; and a specificity of not less than 5 which is the ratio of the dissociation constant to other dissociation constants And molecular binding nucleic acids are useful within the scope of the development, diagnosis and treatment of biomarkers.

The Reverse-SELEX process identifies target molecules for molecular-binding nucleic acids that are developed and developed on the basis of biological significance based on the respective aspects of corresponding molecules in biological samples composed of unknown or known molecules, . &Lt; / RTI &gt;

The biological meaning determination may be based on the molecular analysis results of the sample, and the user's biological meaning determination may be similarity between the user and the control group or the comparative group database. In this case, the clinical information of the samples constituting the control group and the comparative group may be referred to To determine the biological meaning. A large amount of biometric information is produced using the NGS or biochip technology proposed in the present invention and compared and analyzed.

More specifically, the present invention relates to a method of analyzing a biological sample, comprising a molecular binding nucleic acid pool specifically binding to a pathological condition and a healthy sample as shown in FIG. 12 and contributing to the analysis of a biological meaning, and a sample comprising two or more molecules Identify the molecules and provide a basis for analyzing the state of two or more physiologists that want to compare based on the results of analysis of molecular binding nucleic acids and their corresponding target molecules that contribute to the analysis of biological meanings in various ways . Thus, the present invention has the potential to be useful for discovering new therapeutic targets or diagnostic tools.

The present invention secures molecule-bound nucleic acids and identifies their characteristics and identifies molecules bound thereto. A method of isolating and identifying molecules bound to a molecule-bound nucleic acid is shown in FIG. Specific binding molecules are separated using SSH, equalization, subtraction, and equalization-subtracted molecular binding nucleic acids, and the complexes are electrophoresed on PADE-SDS gel to identify protein bands. By identifying the protein by MALTITOF-TOF after cleaving the identified protein band and extracting the protein, a molecule specifically binding to the molecule-bound nucleic acid prepared according to the present invention can be identified.

The method for producing a molecular-binding nucleic acid according to the present invention is applied to fields of biotechnology, medicine, biology and biochemistry. The application of the present invention has its ultimate purpose in human health, animal and plant management. The present invention relates to a molecular-binding nucleic acid library that binds to each of a plurality of biological biological samples (for example, an analytical sample and a comparative sample) to identify molecules for biomarker development, therapeutic means and diagnostic purposes, And identifying the biological sample using molecules that bind to it.

The present invention provides methods, apparatus, kits and reagents for multiplex analysis of samples wherein multiple molecules in a sample can be detected and / or quantified simultaneously. Ultimately, these methods and reagents can convert the target concentration (e. G., Protein target concentration in the sample) to a nucleic acid concentration that can be detected and quantified by any of a variety of nucleic acid detection and quantification methods. Once the molecule is effectively converted to the corresponding nucleic acid concentration, then standard nucleic acid amplification and detection steps can be used to increase the signal. The present specification provides a method for multiple analysis of a sample. The method according to the present disclosure can be carried out in vitro.

The present invention relates to a method and apparatus for producing nucleic acid information and protein information by simultaneously analyzing nucleic acid and protein constituting a sample in the same sample using molecular binding nucleic acid comprising platamer and next generation nucleotide sequencing technology, Kit and reagent, and the nucleic acid information includes RNA information including mRNA, miRNA and the like, and DNA information including structural variation of the gene, methylation, SNP, and the like.

Also provided are diagnostic or test devices, for example columns, test strips or biochips with molecular binding nucleic acids immobilized on the solid surface of one or more of the devices. To bind the molecular binding nucleic acid to the target molecule in contact with the solid surface forming the molecule-molecule binding nucleic acid complex adhering to the surface of the device, so as to capture and detect the target, and to quantify the target selectively can do. A series of molecularly-coupled nucleic acids (which may be the same or different) may be provided in such an apparatus.

Thus, the present invention provides kits and life sciences and analysis for a variety of detection applications, including without limitation, diagnostic kits, biomarker discovery kits, environmental test kits, biohazards or bioweapons detection kits Kits for detecting targets in chemical applications can be prepared based on the methods described herein.

Binding of the molecule-bound nucleic acid to the target is useful in diagnostic methods that can be used to detect the presence, absence, content, or concentration of extended interaction of the target molecule and the molecular-binding nucleic acid and to facilitate detection of the target. A similar advantage can be provided when the analytical molecular binding nucleic acid is used in in vitro or in vivo imaging methods. The extended correlation of molecular binding nucleic acids and targets also provides an improved therapeutic effect by longer activation or inhibition of, for example, a target molecule or downstream signaling cascade.

The present invention relates to a method for analyzing a sample composed of two or more molecules more efficiently and selecting an analytical molecular binding nucleic acid that contributes to the analysis of biological significance and further to identify a target molecule binding to the selected molecular binding nucleic acid And their uses.

Brief Description of the Drawings Figure 1 is a schematic diagram of a single-stranded nucleic acid library prepared by preparing a single-stranded nucleic acid primary library that binds to a molecule constituting a sample consisting of multiple molecules from a single-stranded nucleic acid library and performing an SSH process, an equalization process, a subtractive process, or an equalization- Molecular Binding Nucleic acid The molecular binding nucleotide sequence and the frequency of occurrence analyzed in a sequencing library prepared in a secondary library are determined by selecting a molecular binding nucleic acid useful for producing a molecular profile in a sample and separating and separating the target molecule binding to the selected molecular binding nucleic acid FIG.
2 is a structure of an oligonucleotide constituting a single-stranded nucleic acid library,
Figure 3 is a method for preparing an RNA single stranded nucleic acid library in a single stranded nucleic acid library
Figure 4 is a method for preparing a double stranded DNA oligonucleotide library in a single stranded nucleic acid library,
FIG. 5 is a flow chart of a step of preparing SSH, equalized, subtracted or equalized-subtracted molecular binding nucleic acid libraries through SSH, equalization, subtraction, or equalization-subtraction steps of a molecular binding nucleic acid primary library obtained from a single- ego,
6 is a flowchart of a step of manufacturing the tester 1,
7 is a flowchart of a step of manufacturing the tester 2,
8 is a flowchart of a step of manufacturing a driver,
Figure 9 is a flow chart of the step of preparing an SSH library in a molecular binding nucleic acid primary library,
10 is a flowchart of a step of preparing a library by performing equalization and subtraction with Duplex-Specific Nuclease (DSN) in a molecular-binding nucleic acid primary library,
11 shows a biochip prepared and fabricated on the basis of molecular binding nucleic acids selected from one or more libraries in a group consisting of a molecular-binding nucleic acid primary library, an SSH library, an equalization library, a subtraction library, and an equalization- Analyzing molecular binding nucleic acid as a result of analyzing the sample and isolating and identifying the target molecule bound to the selected molecular binding nucleic acid,
Figure 12 shows the results obtained by using a biochip prepared using a molecular binding nucleic acid selected from one or more libraries in a group consisting of a molecular-binding nucleic acid primary library, an SSH library, an equalization library, a subtraction library and an equalization- FIG. 6 is a flowchart of a step of producing a profile and building a database,
FIG. 13 is a graph showing the results of separation of a serum protein-complex by reacting a complex obtained by attaching biotin to one side of a selected molecule-bound nucleic acid and reacting with streptavidin, and then separating the band formed by electrophoresis FIG. 2 is a flow chart illustrating a procedure of identifying a target molecule,
14 is a flow chart for simultaneously examining protein and nucleic acid in a biological sample,
FIG. 15 is a diagram obtained by removing proteins rich in indan serum proteins and then electrophoresis
FIG. 16 is a graph showing the results of comparing nucleotide sequences and frequencies of molecular binding nucleic acids constituting the molecular-binding nucleic acid primary library and comparing the analyte (N) and the comparator (R)
FIG. 17 shows the results of evaluating the degree of equalization-reduction of the analytical sample and the comparative sample with the equalization-subtracted molecule-bound nucleic acid pool for the sera of patients with myocardial infarction and the sera of unstable angina patients,
FIG. 18 is a graph showing the relationship between the serum samples of the myocardial infarction analysis sample (1,149 molecular binding nucleic acids) obtained from the molecular binding nucleic acid primary library, the SSH library, the equalization library, the subtraction library and the homogenization- A graph of the distribution of 100 molecular-binding nucleic acids obtained by analyzing serum,
FIG. 19 is a graph showing the relationship between the serum samples of the myocardial infarction analysis sample and the comparative sample of unstable angina pectoris, which is an analytical sample with 1,149 molecular binding nucleic acids obtained from the above-mentioned molecular binding nucleic acid primary library, SSH library, equalization library, subtractive library and equalization- The results of clustering samples using 100 molecular binding nucleic acids obtained by analyzing serum
20 (a) is a result of analyzing serum of myocardial infarction patient, which is an analytical sample, and serum of unstable angina patient, which is a comparative sample, with an analytical molecular binding nucleic acid (serial number: 290) which contributes to bio- 15B is a graph in which the densities of the bands formed in FIG.
FIG. 21 is a graph showing the results of observing the anti-cancer substance-treated cells and the non-treated cells by analyzing the extent of binding of the anti-cancer substance-treated cells to the proteins of the non-treated cells,
FIG. 22 shows the result of confirming the specific binding of the selected hepatoma cell line specific molecule-binding nucleic acid to hepatocellular carcinoma cell line (Hep3B)
Figure 23 shows the results of analysis of cdk2 mRNA after treatment of Hep3B molecular-binding nucleic acid-siRNA cdk2 complex with liver cell line by various methods
FIG. 24 is a result of biochip analysis of bound molecularbased nucleic acid after reacting the selected 1,149 molecular binding nucleic acids with human serum proteins. FIG.

Hereinafter, the present invention will be described in more detail with reference to specific examples. The following examples are illustrative of the present invention but are not intended to limit the scope of the invention.

Example  One. Single-stranded nucleic acid  Oligonucleotides of the library and primer  rescue

(SEQ ID NO: 1) (base sequence 1) (random single-stranded nucleic acids) for preparing a single-stranded nucleic acid library to be reacted with a biological sample (analytical sample and comparative sample) (Korea, Bioneer).

As shown in FIG. 2, the oligonucleotide (base sequence 1) constituting the single-stranded nucleic acid library of the above-mentioned <General Formula I> has an oligonucleotide in the 5'-5 'conservation region-variable region- -3 '.

The nucleotide sequence of the oligonucleotide of the above <Formula I>

5'- GGGAGAGCGGAAGCGTGCTGGG CCN ₄₀ CATAACCCAGAGGTCGATGGATCCCCCC -3 (nucleotide sequence I)

(Here, the underlined nucleotide sequence is a fixed region of the single-stranded nucleic acid library, and the N ₄₀ of the variable base region, 40 bases, means that bases such as A, G, T, .)

A double-stranded DNA library is prepared by PCR using the oligonucleotide of the single-stranded nucleic acid library as a template. The primers used herein are "DS forward primer" and "DS reverse primer" of the following base sequences.

The DS forward primer (nucleotide sequence 2) is capable of base-linking with the 5 'terminus of the underlined nucleotides of the <base sequence I> of the single stranded DNA oligonucleotide having the structure of the general formula I, and the RNA polymerase of the underlined bacteriophage T7 Lt; / RTI > sequence.

The DS reverse fry (base sequence 3) used in the PCR can be base-linked with the 3 &apos; end of the underlined bases of the single stranded DNA oligonucleotide having the &lt; General Formula I &gt; structure.

DS Forward primer:

5'-GGGGC TAATACGACTCACTATAGGG AGAGCGGAAGCGTGCTGGG-3 '(nucleotide sequence 2)

DS Reverse primer:

5'-GGGGCATCGACCTCTGGGTTATG-3 '(nucleotide sequence 3)

The double-stranded DNA (nucleotide sequence 4) having the T7 promoter was amplified by PCR (Polymerase Chain Reaction) using the DS forward primer and the DS reverse primer as templates, using the thus prepared single stranded nucleic acid library of the general formula I structure as a template. Is a single stranded RNA library prepared by in vitro transcription with the following PCR products (base sequence 4).

As the primer, the nucleotide sequence of the PCR product:

5'-GGGGGC TAATACGACTCACTATAGGG AGAG CGGAAGCGTGCTGGGCC N ₄₀ CATAACCCAGAGGTCGA TCCCC-3 '(nucleotide sequence 4)

The prepared single-stranded RNA library or the prepared single-stranded RNA library is reverse-transcribed to a single-stranded RNA pool isolated from a molecule-molecule-bound nucleic acid complex pool formed by contacting molecules constituting a sample, To produce a double-stranded DNA library.

RS primer (base sequence 5) &quot; and &quot; RS reverse primer &quot; used for PCR as a target of reverse transcription cDNA and a base sequence of these primers The sequence is as follows.

RS Forward primer:

5 '- CGGAAGCGTGCTGGGCC -3' (nucleotide sequence 5)

RS reverse primer:

5'- TCGACCTCTGGGTTATG -3 '(nucleotide sequence 6)

Example  2. Single-stranded nucleic acid  Library Manufacturing

The single stranded nucleic acid library to be reacted with the biological sample (analytical sample and comparative sample) in this embodiment is an RNA library containing 2'-F-substituted pyrimidines, which are modified nucleotides, Lt; RTI ID = 0.0 > I &lt; / RTI &gt; structure of oligonucleotides and primers.

The PCR was carried out in the presence of a 1000 pmoles single stranded nucleic acid library, a 2,500 pmoles DS primer pair (DS forward primer, DS reverse primer) in 50 mM KCl, 10 mM Tris-Cl (pH 8.3), 3 mM MgCl2, 0.5 mM dNTP (dATP, dCTP, dTTP) and 0.1 U Taq DNA Polymerase (Perkin-Elmer, Foster City Calif.) and purified with a QIAquick-spin PCR purification column (QIAGEN Inc., Chatsworth Calif.). Double-stranded nucleic acid DNA with T7 promoter was prepared.

Randomly modified RNA single-stranded nucleic acids containing 2'-F-substituted pyrimidines using the double-stranded DNAs prepared above were prepared by in vitro transcription with Durascribe T7 Transcription Kit (EPICENTRE, USA) . 2 mM Tris-Cl (pH 8.0), 12 mM MgCl 2, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 5 U T7 RNA Polymerase and 1 mM (ATP, GTP) (2'F-CTP, 2'F-UTP) was reacted at 37 ° C for 6 to 12 hours and purified with a Bio-Spin 6 chromatography column (Bio-Rad Laboratories, Hercules Calif.), Were used to analyze the amount of purified nucleic acid and its purity.

Example  3. Quality management Single-stranded  Produce

The reference material consists of five plant-specific proteins, A, B, C, D and E, obtained from http://genomics.msu.edu/plant_specific/ (see Table 1).

Plant-specific protein Kinds Locus Contents Accession number A At1g65390.1 defense / immunity protein GO: 0003793 B At5g39310.1 cell elongation GO: 0009826 C At4g15910.1 Drought-Induced Protein (Di21) GO: 0009414 D At1g12860.1  Bhlh Protein GO: 0003677 E At4g02530.1 Chloroplast Thylakoid Lumen Protein GO: 0009543

The selected five plant-specific proteins were expressed using the Escherichia coli expression system, and the expressed proteins were isolated and analyzed by standard SELEX method (Ellington, AD and JW Szostak, 1990). In vitro selection of RNA molecules that bind specific L. Green, S. Macdougal, and D. Tasset, Nature, 346: 818-822; Gold, L., P. Allan, J. Binkley, D. Brown, D. Schneider, SR Eddy, 1993. RNA: the shape of things to come, pp. 497-510. In: RF Gestelend and JF Atkins (eds.), The RNA World, Cold Spring Harbor Press, Cold Spring Harbor, NY) Single stranded nucleic acid. This was named as single-stranded nucleic acid for quality control, and a capture probe corresponding to the single-stranded nucleic acid was designed as the base sequence.

Example 4. Preparation of molecularly-coupled nucleic acid primary library

4-1. Molecular Binding Nucleic Acid Primary Library Production

Molecular binding nucleic acid primary library was prepared by using serum as a biological sample consisting of multiple molecules, serum samples from patients with myocardial infarction and serum samples from unstable angina patients. The serum of the patient was prepared according to the method provided by the manufacturer (see FIG. 15). The serum protein was removed from the excess amount of protein using a MARC column (Agilent Technologies Inc. USA).

The process for preparing the molecular binding nucleic acid primary library in the Rervese-SELEX process of the present invention comprises reacting the modified RNA single-stranded nucleic acid library prepared above with a sample composed of multiple molecules to prepare a molecule-bound nucleic acid Repeating the process of reacting the modified RNA single-stranded nucleic acid pool obtained by amplifying the complex pool with the modified single stranded nucleic acid pool dissociated from the complex by RT-PCR (reverse transcription-PCR) to the biological sample again .

Rervese-SELEX reaction solution concentration to 10 to ¹⁴ of the nucleotide sequence / 1㎖ of the modified RNA from the library synthesis at the concentration of 200 pmol / 200㎕ solution (40mM HEPES, pH 7.5, 125mM NaCl, 5mM KCl, 5mM NgCl2, 1mM EDTA, 0.05% TWEEN-20) at 80 DEG C for 10 minutes, and then left on ice for 10 minutes. The reaction solution was prepared by adding 5 times yeast tRNA (yeast tRNA, Life Technologies) and 0.2% BSA (bovine serum albumin, Merck) to the single strand nucleic acid used.

60 μl of 100 mM DTT was added to the reaction solution to be used in the reaction before fixing the serum protein to a piece of Nitrocellulose membrane (NC membrane) (0.3 × 0.3 mm ² ), 100 μM DTT, 300 μl of 10% BSA Was added.

A binding reaction tube was prepared by mixing 50 mu l of binding buffer solution and 500 mu g of the prepared serum protein. After tapping, the NC membrane was immersed in the binding buffer solution by quick-spin. And the mixture was stirred at 100 rpm for 30 minutes using a stirrer.

The NC membrane was dried at room temperature for 10 minutes and placed in a new 1.5 ml tube. 200 μl of a non-specific reaction blocking buffer solution was added and mixed at 100 rpm for 30 minutes using an agitator, and then the NC membrane was transferred to a new 1.5 ml tube. 400 μl of wash buffer solution was added and mixed at 100 rpm for 10 minutes using a stirrer, and the NC membrane was transferred to a new 1.5 ml tube. 400 μl of wash buffer solution was added and mixed with a stirrer at 100 rpm for 10 minutes, and the NC membrane was transferred to a new 1.5 ml tube.

5 μl of the modified RNA single stranded nucleic acid pool (195 μl) and binding buffer (195 μl) were added and mixed using a stirrer at 200 rpm for 30 minutes. The NC membrane was transferred to a new 1.5 ml tube. 400 μl of wash buffer solution was added and mixed at 100 rpm for 10 minutes using an agitator, and the NC membrane was transferred to a new 1.5 ml tube. 400 μl of washing buffer solution was added and mixed at 100 rpm for 10 minutes using an agitator, and the NC membrane was transferred to a new 1.5 ml tube.

The NC membrane was placed on Whatman filter paper and dried at room temperature for 10 minutes. The dried NC membrane was placed in a new 1.5 ml tube and 40 DE of DEPC sterile purified water was added. The RNA is eluted by placing in a heat block at 95 ° C for 10 minutes. Rapidly spin the RNA on the membrane by tapping and place on ice. 36 ° C was transferred to the PCR tube and used for the next step, the reverse transcription reaction. Appropriate selection and amplification were performed and the molecular-molecular-binding nucleic acid complex pool constituting the sample was separated.

Or a human serum sample (molecule), the preparation of a molecular binding nucleic acid primary library is a molecular binding nucleic acid primarily binding to a human serum sample. After the reaction, washing is repeated with various washing buffers, As a selection process, a human serum protein (molecule) - single stranded nucleic acid (molecular binding nucleic acid) complex library was obtained.

The obtained human serum protein (molecule) -single strand nucleic acid (molecule-bound nucleic acid) complex library is a nucleic acid sample for producing a sequence library.

4-2. Improved Molecular Binding Nucleic Acid Primary Library Production

In a Rervese-SELEX process of the present invention, molecular binding nucleic acid primary library separation was performed while adding 10 mM of dextran sulfate as a competitor for single-stranded nucleic acid recombination during the separation process.

The molecular binding nucleic acid primary library separation process was performed in three different ways. In the second and third rounds, the samples were diluted 20-fold by the addition of 950 μl of Rervese-SELEX reaction solution (preheated to 37 ° C) and incubated for 30 min at 37 ° C prior to capturing the complexes. In the fourth and fifth rounds, the samples were diluted 20-fold by adding 950 μl of Rervese-SELEX reaction solution (preheated to 37 ° C) and reacted at 37 ° C for 30 minutes. In the sixth and seventh rounds, the samples were diluted 20-fold by adding 950 [mu] l of Rervese-SELEX buffer (preheated to 37 [deg.] C).

50 μl of each diluted sample was transferred to 950 μl of Rervese-SELEX reaction solution + 10 mM 5000 K dextran sulfate (preheated at 37 ° C) and re-diluted to obtain a 400-fold dilution, followed by reaction at 37 ° C for 60 minutes. In the eighth and ninth rounds, the samples were diluted 20-fold by the addition of 950 R of Rervese-SELEX buffer (preheated to 37 캜), and 50 각 of each sample was transferred to 950 R of Rervese-SELEX buffer (preheated to 37 캜) Re-diluted and a 400-fold dilution was obtained. Finally, 50 μl of each 400-fold diluted sample was re-diluted by transferring to 950 μl Rervese-SELEX buffer + 10 mM 5000 K dextran sulfate (pre-heated to 37 ° C) to obtain a total 8000-fold dilution and incubated at 37 ° C for 60 minutes Respectively. The complex was captured and washed in the same manner as described in Example 2 above.

The washing buffer of molecular binding nucleic acid complexes used 0 to 1x Rervese-SELEX buffer, 0-5% Tween-20 or 0-500 mM EDTA solution. At this time, the molecular binding nucleic acid primary library may be prepared by repeating the above selection and amplification steps a plurality of times.

It is ideal that the molecular binding nucleic acid primary library binding to biological biological samples should reflect the diversity of molecules contained in biological samples as they are, so that instead of performing only limited selection and amplification, Lt; RTI ID = 0.0 &gt; library. &Lt; / RTI &gt; The assay samples and the libraries prepared in the comparative samples were referred to as assay sample-molecule-molecule-bound nucleic acid and the latter as the comparative sample-molecule-molecule-bound nucleic acid primary library.

The DNA in the cleaved complex was reverse-transcribed by reverse priming with a reverse primer to prepare cDNA, and PCR was performed using a pair of forward primer and reverse primer to bind the RNA protein to the DNA single pool DNA pool Were amplified. The obtained PCR product is a nucleic acid sample for the purpose of producing a sequence library.

Example 5. Preparation of SSH molecular binding nucleic acid library

SSH molecule-bound nucleic acid library was performed as shown in FIG. DNA pools were prepared by performing RT-PCR using the analytical sample prepared in Example 3 and a comparative sample-molecule-molecular-binding nucleic acid primary library as a template. Reverse transcription was performed by transferring 36 μl of the reaction solution to a PCR tube, adding 10 μl of 5 × reverse buffer solution, 1 μl of RS reverse primer (25 pmol / μl) solution, And mixed. The mixed solution was reacted at 65 ° C for 5 minutes using a PCR machine, and then reacted at 25 ° C for 10 minutes. After completion of the reaction, a mixed solution containing 1.5 μl of DEPC-sterilized purified water, 1 μl of 20 mM dNTP, and 0.5 μl of AMV RTase (10 μl BElS, Cat. No. 3001L) was prepared. 3 μl of the prepared mixed solution was added to the reaction-terminated PCR tube to make a final volume of 50 μl. The PCR tube was reacted at 37 ° C for 30 minutes using a PCR machine, and then reacted at 95 ° C for 5 minutes.

The PCR reaction was then performed as follows. For PCR amplification of the product cDNA, firstly, 10 μl of 10 × PCR buffer solution, 1 μl of 20 mM dNTP, 1 μl of DS forward primer (25 pmol / μl), 1 μl of DS reverse primer (25 pmol / μl) 0.5 μl of pylymerase (5 u / μl) and 36.5 μl of tertiary sterilized purified water were added to prepare a PCR mixture solution having a final volume of 100 μl. The reaction was preliminarily denatured at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, binding at 55 ° C for 30 seconds, elongation at 72 ° C for 30 seconds, repeated 25 times, and final elongation at 72 ° C for 5 minutes .

The PCR product was transferred to a 1.5-ml tube and 100 μl of D.W. was added to increase the volume to 200 μl and 200 μl of phenol: chloroform: isoamylalcohol was added. Vortex, centrifuged at 13,000 rpm for 1 min, and the supernatant transferred to a new 1.5 ml tube. Two volumes of 100% ethanol and 0.1 times volume of 3M sodium acetate (pH 5.2) were added and mixed and stored at -20 ° C for at least 60 minutes or at 80 ° C for at least 10 minutes. The stored tubes were centrifuged at 4 ° C and 13,000 rpm for 10 minutes and the supernatant was removed. After adding 500 μl of 70% ethanol, the supernatant was removed by centrifugation at 13,000 rpm for 5 minutes at 4 ° C.

After drying the e-tube, 30 占 퐇 of tertiary sterile purified water was added and dissolved. After loading 5 μl of 2.5% agarose gel and loading 3 ul of 50 bp ladder DNA marker, we quantified with 100 bp band using Alphaimager program.

The PCR product obtained by PCR using the analytical sample-molecule-bound nucleic acid primary library prepared as described above as a template was used as a "tester" for the SSH from the preliminary tester, and the product obtained by PCR using the primer- To "driver".

Tester 1 and Tester 2 were prepared by performing PCR in a standard manner. In the case of tester 1, the following primer "SSH forward primer tester 1 ", consisting of a newly designed adapter base sequence and RS reverse primer sequence, 2 used the following primer "SSH reverse primer tester 2" composed of the above "RS forward primer"

SSH forward primer _ Tester 1:

5'-TCGAGCGGCCGCCCGGGCAGGTCGGAAGCGTGCTGCC-3 '(nucleotide sequence 7)

SSH reverse primer _ Tester 2:

5'-CAGCGTGGTCGCGGCCGAGGTTCGACCTCTGGGTTATG-3 '(nucleotide sequence 8)

1.5ng of 20ng tester 1, 1.5μl of 600ng driver PCR product, 1.0μl of 4x hybridization solution (200m MHEPES pH 7.5, 2M NaCl, 0.8m MEDTA) were mixed and subjected to primary hybridization at 60 ° C for 12 hours , 1.5ng of 20ng tester 2, 1.5μl of 600ng driver PCR product and 1.0μl of 4x hybridization solution were mixed and treated at 95 ° C for 5 minutes in a reaction volume of 4.0μl, followed by primary hybridization at 60 ° C for 12 hours Respectively. The former is "Tester 1 mixed solution" and the latter is "Tester 2 mixed solution".

The driver solution was prepared by mixing 1.0 μl of a 120 μg driver, 1.0 μl of a 4 × hybridization solution and 2 μl of water, adding a small amount of mineral oil, and treating the mixture at 98 ° C for 90 seconds using a PCR machine.

Tester 2 mixed solution was mixed carefully into the driver mixed solution, and the mixed solution (mixed solution of tester 2 mixed solution and driver mixed solution) was put back into the tester 1 mixed solution, mixed well by pipette, Were subjected to secondary hybridization. Taq polymerase was added to the solution in which the secondary hybridization reaction was terminated and extension reaction was performed at 75 ° C for 5 minutes to add a base to the 5 'end and the 3' end cohesive end of the double stranded nucleic acid of the secondary hybridization product And switched to a blunt end.

PCR was carried out using the "adapter 1 primer" and the "adapter 2 primer" designed as follows for the solution in which the elongation reaction was terminated.

Adapter 1 Primer:

5'-TCGAGCGGCCGCCCGGGCAGGT-3 '(nucleotide sequence 9)

Adapter 2 Primer:

5'-CAGCGTGGTCGCGGCCGAGGT-3 '(nucleotide sequence 10)

The PCR product was subjected to nested PCR using the above-mentioned "RS forward primer" and the "RS reverse primer" The obtained PCR product is a nucleic acid sample for the purpose of producing a sequence library.

Example 6. Equalization using Duplex-Specific Nuclease (DSN)

As shown in FIG. 10, in order to equalize a molecular binding nucleic acid primary library binding to a biological sample composed of multiple molecules, a molecular binding nucleic acid, which is an RNA binding to a biological sample, is reverse-transcribed using a RS reverse primer as a template, . The prepared double-stranded DNA was prepared at a concentration of ~ 100 ng / mu l, and each 1.5 mu l was divided into a PCR tube. Then, 1 mu l of 4x hybridization solution and 1.5 mu l of distilled water were added and the mineral oil was overlaid. The mixture was heated at 98 ° C for 3 minutes and then hybridized at 60 ° C for 4 hours. After termination of the hybridization, 5 占 퐇 of 2x DSN buffer (100 mM Tris HCl pH 8.0, 10 mM MgCl2, 2 mM dithiothreitol) preheated to 60 占 폚 was added to the mixed reaction. Followed by addition of 0.25 Kunitz units of DSN enzyme (Wako, Japan). After 20 minutes of reaction, 10 μl of 5 mM EDTA was added to terminate the reaction. The molecularly-coupled nucleic acid primary library thus homogenized was amplified by PCR. The nucleotide sequence and frequency of the molecular binding nucleic acid are determined by preparing a sequencing library for the obtained DNA.

Example 7. Reduction with Duplex-Specific Nuclease (DSN)

As shown in FIG. 10, the subtracting was performed using an equalized tester and an equalized driver. PCR amplification for amplifying the homogenized cDNA prepared in Example 5 into a template was performed by first adding 10 μl of 10 × PCR buffer solution, 1 μl of 20 mM dNTP, 1 μl of SSH forward primer_tester 1 (25 pmol / μl) to 50 μl of RT reaction product, 1 μl of SSH reverse primer tester 2 (25 pmol / ul), 0.5 μl of Taq pylymerase (5 μl / μl) and 36.5 μl of tertiary sterile purified water were added to prepare a PCR mixture solution having a final volume of 100 μl. The reaction was preliminarily denatured at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, binding at 55 ° C for 30 seconds, elongation at 72 ° C for 30 seconds, repeated 25 times, and final elongation at 72 ° C for 5 minutes . First, a single-stranded tester was prepared by performing one-way PCR using an equalized tester as a template. One-way PCR amplification was performed by adding 10 μl of 10x PCR buffer solution, 1 μl of 20 mM dNTP, 1 μl of SSH forward primer tester 1 (25 pmol / μl), SSH reverse primer tester 2 (0.25 pmol / μl) 0.5 Ta of Taq ploymerase (5 / / ㎕) and 36.5 3 of tertiary sterilized purified water were added to prepare a PCR mixture solution having a final volume of 100.. The reaction was preliminarily denatured at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, binding at 55 ° C for 30 seconds, elongation at 72 ° C for 30 seconds, repeated 25 times, and final elongation at 72 ° C for 5 minutes .

The preparation of the double-stranded driver was performed by reverse transcribing the molecular-binding nucleic acid of the molecular-binding nucleic acid primary library, which is a comparative sample-RNA, as a template with the DS reverse primer and PCR with the DS primer.

1 [mu] L of single-stranded tester (1 ng), 2 [mu] l of prepared excess double-stranded screw driver (200 ng), and 1 [mu] l of 4x hybridization solution were added to the E-tube, heated at 98 [deg.] C for 2 minutes, RTI ID = 0.0 &gt; C &lt; / RTI &gt; for 12 hours. After hybridization was terminated, 5 占 퐇 of 2x DSN buffer preheated at 60 占 폚 was added to the E-tube and treated at 60 占 폚 for 10 minutes. This reaction solution was treated with 1 의 of DSN and reacted at 60 캜 for 30 minutes to remove double stranded DNA. After completion of the reaction, phenol extraction, ethanol precipitation, and dissolution in distilled water were carried out. Amplification of the subtracted single-stranded tester was carried out by standard method PCR with 1 μl SSH forward primer tester 1 (25 pmol / μl) and 1 μl SSH forward primer tester 2 (25 pmol / μl). Then, 1 μl of Exonuclease I was treated and reacted for 30 minutes to remove the remaining single-stranded nucleic acid. The obtained PCR product is a nucleic acid sample for the purpose of producing a sequence library.

Example 8. Determination of the Sequence and Frequency of Molecule Binding Nucleic Acids

Molecular binding nucleic acid primary libraries prepared from the above or molecular binding nucleic acids constituting the molecular binding nucleic acid secondary library prepared by equalization, subtraction, homogenization-subtraction and SSH processes were determined by NGS as the nucleotide sequence and the frequency of occurrence. DNA pools obtained by performing reverse transcription and PCR on the molecule-bound nucleic acids obtained in the above examples were analyzed using HiSeq 2000 (Illumina). Prepare DNA pools using the TruSeq DNA sample preparation kit v. 2 (Illumina) to 136 ng of DNA for end repair, addition of adenosine, adapter addition and PCR. Each step was rinsed with Agencourt AMPure XP beads (Beckman-Coulter) included in the TruSeq kit except for adenosine base addition. 15 cycles of PCR were carried out using the recipes and PCR primers supplied by Illumina.

The PCR products were quantified by Qubit fluorometer (Invitrogen). A 3 ng PCR product per sample was hybridized on a flow cell with a concentration of 5 pM on a HiSeq 2000 cBOT cluster station. and clusters were formed by amplification 28 times per single DNA molecule by bridge amplification in cBOT. Each cluster was linearized and then hybridized with a sequencing primer. This flowcell was loaded on HiSeq 2000. This flowcell was run with 73 single read bases and HiSeq 2000 Single Read 80 Base Pair Recipe for 7 sequenced multiplexed bases. Illumina Real Time Analysis (RTA) to generate real-time base-call files and quality scores.

After the forward and reverse strands were completed, the Illumina Casava software quality analysis was performed and further downstream analysis was performed using internally developed software.

The matching step of the quality assays comprises the 5 'conserved region (17 bp), the variable region (40 bp) and the 3' conserved region (17 bp) in the <Formula I> structure of the oligonucleotides constituting the single stranded nucleic acid library Were compared based on the pattern of the 74 base pairs (bp) of the sequence; The filtering step excluded any sequences that did not match the pattern. One discrepancy was allowed in each conserved area during pattern matching. The conserved region sequence was excluded after filtering, leaving only a 40 bp variable region sequence for downstream analysis. Reverse supplemental tags combined with forward sequence tags. Molecular binding nucleic acid count rounds were performed in this step and round enrichment analysis was performed. The sequence of the quality analysis and count rounds determined the sequence and frequency of the specific molecular binding nucleic acid constructing the library.

15,000,000 to 18,000,000 sequences per nucleic acid binding nucleic acid pool for the selected molecular binding nucleic acid primary library were analyzed. Finally, the ratio of the nucleotide sequences of 5395 molecular-binding nucleic acids constituting the molecular-binding nucleic acid primary library prepared in the analytical sample to the prepared molecular-binding nucleic acid primary library and the comparative sample was compared (FIG. 16).

Molecular Binding Nucleotide Sequence Analysis Constructing the Molecular Bound Nucleic Acid Secondary Library Prepared by Soxing, Homogenization, Homogenization-Reducing, and SSH Process The sequence of the molecular binding nucleic acid, which constitutes the secondary library of the molecular binding nucleic acid, reference sequences and sequences were clustered and analyzed with a viewable Omega Cluster on the EBI website (http://www.ebi.ac.uk/Tools/msa/clustalo/).

As a result, a total of 1,149 molecular binding nucleic acids, which can represent each of the analyzed samples and comparative samples, were determined.

Example 9. Evaluation of Equalization and Reduction

The homogenization and the degree of reduction of the molecular-binding nucleic acid primary library were evaluated by treating and fixing the serum on the NC membrane, treating and reacting the homogenized and subtracted molecular binding nucleic acid library, Was separated from the NC membrane, RT-PCR was performed using the same as a template, and electrophoresis was performed to confirm the result.

FIG. 17 shows the result of evaluating the molecular binding nucleic acid library obtained by using the serum of myocardial infarction patients as an analytical sample and performing the equalization-subtraction using sera from patients with unstable angina as a comparative sample. A strong band was formed with the analytical sample, and a weak band was formed in the comparative sample, so that the analytical sample was equalized and subtracted by the comparative sample.

Example 10. Determination of the biological significance of molecular-binding nucleic acids

As a result of analyzing the nucleotide sequence and appearance frequency of the molecular binding nucleic acid using NGS, the molecular binding nucleic acid library binding to the molecule constituting the specific human serum analysis sample was analyzed by the frequency of occurrence of the specific molecular binding nucleic acid and the serum sample It can be seen that there is a correlation with the number of specific molecules to be constituted. The profile reflecting the appearance frequency of the molecular binding nucleic acid constituting the molecular binding nucleic acid library binding to the molecules constituting the specific serum sample of the present invention is a profile reflecting the molecular profile (information collecting quantitative state) of a specific serum sample composed of multiple molecules, to be.

The molecular binding nucleic acid constituting the molecular profile is subjected to multivariate analysis to statistically select molecular binding nucleic acids capable of representing the properties of analytical samples and comparative samples, Hierarchical Clustering and Artificial Neural Network can be used to analyze the degree of contribution to biological analysis. This process was used to select molecular binding nucleic acids that contribute to the analysis of biological significance.

Serum samples (10 samples) from myocardial infarction patients (S) and sera from unstable angina patients (21 samples) were analyzed using a comparative sample (C) (Table 2). The frequency of the molecular binding nucleic acids was analyzed by NGS, which was formed by reacting the 1149 molecular binding nucleic acids determined above and the molecular binding nucleic acid pool corresponding to the reference material with the sample. FIG. 18 shows the distribution of molecular-binding nucleic acids that can distinguish between cardiac infarction patients and unstable angina patients statistically with the frequency of 1149 molecular binding nucleic acids. The result of hierarchical clustering with the frequency of occurrence of the selected molecular binding nucleic acid is shown in FIG. 19. As shown in FIG. 19, it can be seen that the myocardial infarction and unstable angina patients form independent clusters, And the frequency of nucleic acid can be distinguished from patients.

Clinical information on cardiovascular disease patients Myocardial infarction Unstable gender male 10 21 female 0 One age 40-49 One 0 50-59 5 9 60-69 4 11 70-79 0 One Sum 10 21

Based on the molecular binding nucleic acid that binds to multiple molecules making up a biological sample, the molecular profile is searched and analyzed in a specific biological sample by the method using NGS and the biological meaning that specifically binds to the serum protein of the patient sample of myocardial infarction The analytical molecular binding nucleic acids that contribute to the analysis of the nucleic acid can be selected. Among these, the sera from patients with myocardial infarction, which is an analysis sample of serial number 768 molecular binding nucleic acid, and the sera from patients with unstable angina, which is a comparative sample, were evaluated, (Fig. 20).

Example  11. Isolation and Identification of Proteins Binding to Molecular Bound Nucleic Acids

A database consisting of disease groups was compared and analyzed to determine useful spots, and molecular binding nucleic acids contributing to the analysis of corresponding biological meanings were prepared, and the corresponding proteins were identified and identified as shown in FIG. Biotin was attached to one side of the selected molecular binding nucleic acid and reacted with streptavidin. The resultant complex was reacted with a serum sample to isolate a serum protein-molecule-bound nucleic acid complex, followed by separation of a band formed by electrophoresis And serum proteins were identified. The selected single-stranded by separating the protein that binds to the nucleic acid to determine the amino acid sequence of the protein by MALDI-TOF-TOF instrument, and that "the target molecule is less than the dissociation constant (Kd) of the serum binding proteins and nucleic acid molecules 20x10 ^-9 "He said.

Example  12. Selection of molecular binding nucleic acid for anticancer drug reaction protein

Biological samples were prepared from the total protein of cells treated with the anticancer substance doxorubin and untreated cells to examine the molecular binding nucleic acids and proteins capable of drug reactive monitoring. The target cancer cell line was Hep3B hepatoma cell line. Doxorubicin was treated with heparin cell culture medium to a final concentration of 5 ug / mL and it was confirmed that doxorubicin was absorbed into the cells 4 hours after treatment .

Cells (analyzed samples) and non-treated cells (comparative samples) cultured for 6 hours after toxin rubrin treatment were harvested and total protein separated. A molecular-binding nucleic acid primary library was prepared by binding the single-stranded nucleic acid library prepared in Example 2 to each cell line. After securing the SSH molecule-bound nucleic acid library of the hepatocellular carcinoma cell line SSH prepared by the above-described library, the molecular binding nucleic acid selected by the NGS technique was selected.

The molecular binding nucleic acid pools and the comparative sample binding molecule binding nucleic acid pools were prepared by reacting the selected molecular binding nucleic acid pools with cancer cell Hep3B analysis samples and comparative samples to produce protein profiles using the NGS technique.

The protein profiles produced and accumulated in the above analytes and comparative samples were analyzed by ANOVA, and molecular binding nucleic acids specifically binding to the analytical samples were selected and observed at the cell level. The selected molecular binding nucleic acid was labeled with Rhodamine staining reagent, and treated and non-treated cells were stained and observed under a fluorescence microscope. As a result, it was confirmed that the molecule-bound nucleic acid binds specifically to the treated cells as shown in FIG.

Example  13. Liver cancer cell line  Selection of specific molecule-bound nucleic acids and their uses

The single-stranded nucleic acid library prepared in Example 2 was treated with hepatoma cell line Hep3B and GIBCO Hepatocyte samples to prepare a molecular-binding nucleic acid primary library binding to each cell line. After securing the liver cancer cell line SSH molecular binding nucleic acid library prepared by SSH of the prepared library, the molecular binding nucleic acid selected by the NGS technique was selected.

The hepatocellular Hep3B binding molecule binding nucleic acid pool and GIBCO hepatocyte binding molecule binding nucleic acid pool were prepared by reacting the selected molecular binding nucleic acid pool with a cancer cell Hep3B assay sample and a GIBCO Hepatocyte comparative sample to produce a cell surface profile using the NGS technique.

Molecular binding nucleic acids that specifically bind hepatocellular carcinoma cell line Hep3B were selected and analyzed for their ability to bind at the cellular level by ANOVA test of cell surface profiles produced and accumulated in cancer Hep3B assay samples and GIBCO hepatocyte comparison samples. The binding ability of the selected molecular binding nucleic acids and hepatocarcinoma Hep3B and GIBCO Hepatocytes was determined by binding a specific molecular binding nucleic acid to the cells, amplifying the bound molecular binding nucleic acids, and electrophoretically identifying the binding molecule. Was confirmed to be a nucleic acid.

The selected molecular-binding nucleic acid was labeled with Rhodamine staining reagent and stained with Hep3B and GIBCO Hepatocyte, and observed under an optical microscope. As a result, they were found to bind specifically to Hep3B hepatoma cell line and hardly bind to GIBCO hepatocytes I could confirm.

Cdk2 siRNA, which is highly expressed in cancer cells and inhibits the function of cdk2 gene, which is known as a tumor gene, was constructed. We have developed a complex that specifically binds to hepatocarcinoma cell lines by binding to specific hepatocarcinoma cell - bound nucleic acid, and confirmed its function.

Hep3B molecule-bound nucleic acid-cdk 2 siRNA complex was prepared and treated with hepatocyte hepatoma cell line Hep3B at 100 nM complex, 250 nM complex, and 100 nM cdk 2 siRNA by transfection or direct treatment and reacted for 3 days.

The results of quantitative analysis of cdk2 mRNA by separating total RNA from each were as shown in Fig. 23, and a Hep3B molecular-binding nucleic acid-cdk2 siRNA complex was prepared and 100 nM (first lane) and 250 nM complex (second lane) 2 siRNA (third lane), followed by three days of non-treatment (fourth lane), followed by total RNA isolation and quantitative analysis of cdk2 mRNA. In the case of transfection, the amount of cdk2 mRNA was decreased in Hep3B molecule-bound nucleic acid-cdk2 siRNA complex and cdk2 siRNA compared to the untreated sample, but the direct treatment decreased Hep3B molecule binding The amount of cdk2 mRNA was reduced in the cdk2 siRNA complex treated with the nucleic acid. As a result, in the case of the Hep3B molecule-bound nucleic acid-cdk 2 siRNA complex, the analytical molecular binding nucleic acid in the complex binds to the protein in hepatocarcinoma cell line Hep3B and moves into the cell to act as siRNA, thereby decreasing the amount of cdk2 mRNA have.

Example  14. Manufacturing and analysis of biochip

Single-stranded nucleic acids (oligonucleotides) having a nucleotide sequence complementary to 1,149 molecular-binding nucleic acids having the above-selected nucleotide sequence were organically synthesized (Bioneer) as a detection probe to be fixed on the surface of a glass slide .

The biochip was immobilized with a fixed probe using UltraGAPSTM Coated Slide (Corning), a glass slide coated with GAPS (Gamma Amino Propyl Silane). A microarrayer system (GenPak), which is a pin method, was used for manufacturing the biochip, and the spot spacing was set to be 370 탆 center-to-center. Each of the capture probes was dissolved in a standard solution to adjust the concentration. At this time, the humidity in the air layer was maintained at 70% to perform spotting. The spotted slides were left in a humidified chamber for 24 to 48 hours and baking was performed in an UV crosslinker. In a well known manner, the capture probes were immobilized on a glass slide, the slides were immediately centrifuged and dried, and then stored in a light-blocked state.

The disk with the serum protein (molecule) -molecule-coupled nucleic acid complex of the myocardial infarction patient harvested in Example 9 above was treated in an RT-PCR solution to prepare a Cy-5 labeled forward primer (5'-Cy5-CGGAAGCGTGCTGGGCC-3 ') And RT-PCR with DS reverse primer. In addition, discs with serum protein (SNP) -SNBABB complex in patients with unstable angina were treated with RT-PCR solution to prepare Cy-3 labeled DS forward primer (5'-Cy3-CGGAAGCGTGCTGGGCC-3 ') and DS reverse primer Followed by RT-PCR. The two solutions were mixed in an equal amount to prepare a target probe.

The target probes were treated on the biochip of the present invention, hybridized at 60 ° C for 4 to 12 hours, and washed with 0.1x SSC solution at 42 ° C. Wherein the hybridization solution comprises 1 M sodium chloride, 0.3 M sodium citrate, 0.5% SDS or 100 μg / ml Salmonella, 0.2% bovine serum albumin or single stranded nucleic acid. Hybridization was performed on the hybridized glass slide at 42 ° C for 12 hours after the hybridization solution was treated, and then the biochip was washed with the washing solution. The composition of the washing solution is, for example, 1X SSC + 0.2% SDS, 1X SSC + 0.2% SDS, 0.5X SSC + 0.2% SDS and 0.01X SSC + 0.2% SDS. Minute.

After the washing of Example 10 was completed, the glass slide was dried by centrifugation, and then a laser scanner (Cy5, 635 nm; Cy3, 548 nm) having an appropriate wavelength of laser , GenePix4000, Axon). Fluorescence was stored in a multiimagetagged image file (TIFF) format and analyzed with appropriate image analysis software (GenePix Pro3.0, Axon). It is possible to provide a method of producing bio-chip fluorescence data and confirming a molecular profile in a biological sample with a pattern of all spots.

The degree of fluorescence of the spot varies depending on the nature of the double strand formed by the acquisition probe and the target probe. The degree and amount of binding of the human serum protein-molecule binding nucleic acid complex is determined by their specificity and binding ability. The base sequence of the target probe originating from the human serum protein-molecule binding nucleic acid complex and the capture probe attached to the biochip affects the double-strand stability of the target probe-capture probe and the amount of the target probe on the biochip affects the degree of fluorescence 24).

That is, the degree of fluorescence represents the amount of the target probe, and the amount of the target probe represents the amount of the human serum protein-molecule binding nucleic acid complex. The amount of the complex also indicates the amount of molecules in the biological sample. Therefore, it is possible to confirm the amount of a specific molecule in a biological sample containing molecules of the molecule corresponding to the spot from the degree of fluorescence of the spot. Finally, the fluorescence intensity of the formed spot is analyzed to confirm the pattern of all the spots of the biochip, so that the profile of the serum protein can be confirmed in human serum.

That is, the color spectrum of blue-yellow-red spots formed is a phenomenon in which the ratio of the target probe labeled Cy-3 attached to the acquisition probe and the target probe labeled Cy-5 is varied, The degree of the color spectrum represents the amount of a specific molecule (protein) present in a specific serum sample constituting human serum, so that it shows the color spectrum of all spots on the biochip. This is because the molecular profile (information that combines the quantitative state) .

That is, in the molecular analysis method of the present invention, the target probe which binds to the capture probe at a specific spot to form double strands is composed of a target single-strand nucleic acid labeled with Cy-3 and a target probe labeled with Cy-5, But the latter exists in proportion to the corresponding molecule in human serum. Thus, a particular spot is blue if it is relatively small, yellow if it is similar, and red if it is present in excess.

Example  15. NGS  Analysis of Nucleic Acid and Protein in Biological Samples Used

Methods for analyzing proteins using next generation sequencing (NGS) are well described in the above examples of the present invention. NGS is a technology that sculpts a whole-genome in a chip-based and PCR-based paired end format and performs sequencing at a very high speed based on hybridization of the fragment. Methods for producing a great deal of information about a dielectric are known.

As a result of single nucleotide polymorphisms (SNPs) and genetic polymorphisms that can be 2 to 5% different alleles in the population with NGS technology, mutations in the wild type amino acid mutation can be analyzed quickly. Whole genome sequencing (WGS) is a method of sequencing whole genomes by next generation nucleotide sequencing (NGS) in a multiple of 10X, 20X, and 40X formats, and whole exome sequencing (WES) And TS (Target Sequencing) is a technology for sequencing only the gene region involved in the production of target proteins among the above WGS. Thus, the data size of WGS> WES> TS is generated. However, because of its small size, it has the advantage of being able to sequence many samples. METSEq is a sequencing technology for measuring DNA methylation of genes, and RNAseq is a sequencing technology for gene expression, a DNA transcriptome. SV (structural variation) is a variation in a large unit (DNA segment) of a chromosome caused by insertion, inversion, translocation and so on.

The process of producing protein and nucleic acid information simultaneously using NGS technology is as follows. First, reference sequences should be constructed from the nucleotide sequences of the nucleic acids to be analyzed and the nucleotide sequences of the molecular-binding nucleic acids containing the plasmids of the molecules to be analyzed. In this Example, a reference sequence was constructed from the base sequence of 1149 molecular-binding nucleic acids and the base sequence of the nucleic acid to be analyzed.

Biological samples were divided into samples for protein analysis. In an embodiment of the present invention, a molecule-molecule-bound nucleic acid complex pool is formed by contacting a molecule constituting a sample with a molecular-binding nucleic acid pool containing a known pressure-timer. The molecule constituting the prepared biological sample is attached to an NC disk, the molecule-bound nucleic acid complex pool containing the platamer is contacted with the reaction solution, and the formed molecule-molecule-bound nucleic acid complex pool is washed with the washing solution to remove unbound or non- And the disk was removed. DNA pools obtained by reverse transcription and PCR were prepared from molecularly-bound nucleic acids, which are obtained from molecular-binding nucleic acid pools that bind to multiple molecules constituting the sample attached to the disk. Prepare DNA pools using the TruSeq DNA sample preparation kit v. 2 (Illumina), 136 ng of DNA was subjected to end repair, addition of adenosine, adapter addition and PCR. Each step was rinsed with Agencourt AMPure XP beads (Beckman-Coulter) included in the TruSeq kit except for adenosine base addition. A 15-step PCR was performed using a recipe supplied by Illumina and a PCR primer to prepare a squashed library.

It is an oligonucleotide design used in the process of amplifying a target gene as a preceding element to analyze nucleic acid and to fish nucleic acid information. To produce multiple target loci assembly sequencing (mTAS) oligonucleotides with optimal lengths that can be annealed at specific temperatures, we used a computer program, Perl-mTAS. Oligonucleotide probes were constructed from a target-specific sequence (target hybridization nucleotide sequence) and a 5'-flanking assembly spacer sequence (overlapping sequence). All probes were approximately 25 bp and annealed at Tm 60 ° C.

For each target genomic locus, a gap of 7 bp containing the SNP position is present (i.e., left side of the SNP position, 3 bp; SNP position, 1 bp; and right side of the SNP position, 3 bp). The spacing of the gaps was adjusted to 0-3 bp for ease of design. Although the assembly spacer sequences are arbitrarily made, the annealing sites present on the assembly sequence are the closest neighboring methods to calculate the temperature value for the overlapping regions between the oligonucleotides. . &Lt; / RTI &gt;

Nucleic acid samples were prepared by known methods in samples in which the biological samples were separated and the nucleic acid samples were separated. DNA (gDNA) was extracted from human serum samples using a QIAamp DNA extraction kit (Qiagen, Germany). For the isolation of gDNA, serum samples were placed in 1.5 ml microcentrifuge tubes, and 20 μl of protease K and 180 μl of buffer solution were mixed and reacted at 56 ° C for 1 hour. The reaction solution thus obtained was purified using a QIAamp spin column and washed twice with a buffer solution. Then, 50 μl of the buffer solution preheated at 70 ° C was dissolved to extract gDNA, which was stored at 20 ° C. For each extracted gDNA, the amount of gDNA was measured using Qubit dsDNA HS Assay Kit and Qubit 2.0 (Life Technologies, USA).

Using 10 ng of gDNA stored at -20 ° C, a library for performing NGS was constructed using panel primers of 17 target genes. The panel primers are shown in Table 3.

The library for NGS was constructed using Ion AmpliSeq Library Kit 2.0 (Life Technologies). First, DNA primers were amplified from the DNA extracted from the sample using a panel primer pool which was preceded to obtain only the mutation site of the target gene. 4 × 5 × HiFi master mix, 10 μl of panel primer pool, and 10 μg of DNA were mixed and adjusted with sterilized distilled water to make the total reaction volume 20 μl. The prepared mixed reaction solution was amplified by repeating 21 cycles of 2 minutes at 99 ° C, 15 seconds at 99 ° C, and 4 minutes at 60 ° C in a PCR instrument. The resulting amplification product was subjected to a reaction at 50 ° C for 10 minutes, 55 ° C for 10 minutes, and 60 ° C for 20 minutes, and both ends of the amplification product were partially cleaved by adding 2 μl of Fupa solution. 2 μl of Ion P1 adapter and 2 μl of Ion Xpress barcode were added to the partially digested amplified product, and the reaction was performed at 22 ° C for 30 minutes and at 72 ° C for 10 minutes to bind the sequencing adapter and the sample to the amplification product . Sequencing adapter and barcode-coupled amplification products were washed with 45 μl of AMPure XP solution and quantified using an Agilent DNA 1000 chip to produce a squamous library.

1.5 ml samples are sampled from the serum samples and centrifuged at 10,000 g for 5 minutes at room temperature to recover the cells. The recovered cells were extracted with total RNA using RNeasy Plus Mini Kit (Qiagen). The concentration and quality of the extracted RNA was determined by measuring at 260 nm and 280 nm using a NanoDropTM 1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA).

Sequence analysis is performed using a mass simultaneous technique in a cDNA library prepared from RNA in a sample. A cDNA library was synthesized using, for example, the mRNA-Seq Sample Preparation Kit (Illumina) according to the manufacturer's instructions or with slight modifications. A 5-fold diluted Klenow DNA polymerase is used for the terminal-repair step of plasma cDNA. A QIAquick PCR Purification Kit QIAquick MinElute Kit (Qiagen) was used to purify each end-capped and adenylated product. A 10-fold diluted twin-tailed adapter was coupled to a plasma cDNA sample, and a 2 round round of purification was performed on the adapter-bound product using AMPure XP beads (Agencourt) and an Agilent DNA 1000 chip To make a squashed library.

All genomic-wide miRNAs were analyzed and compared by small RNA sequencing in human serum samples. A small RNA-rich total RNA was extracted from serum samples using the mirVAna miRNA isolation kit (Ambion, Austin, TX). The miRNA library was amplified using the Illumina library preparation protocol (Illumina, San Diego, CA, USA) Prepared. Each library was indexed with an Illumina adapter (a 6-base barcode). The small RNA library was size fractionated on a 6% TBE urea polyacrylamide gel and a 140-160 base pair fraction was cut from the gel And purified. The purified miRNA library was quantified using an Agilent DNA 1000 chip to construct a squashed library.

Although the sequencing library can be prepared by mixing the nucleic acid sample isolated from the fractionated biological sample and the separated molecular-molecule-bound nucleic acid complex pool, the sequencing library prepared by separately preparing the sequencing library was mixed to determine the base sequence. The nucleotide sequence of the nucleic acid constructing the prepared sequencing library was compared with the reference sequence and the appearance frequency was determined.

The length and the amount of the library constructed using the High Sensitivity chip were measured using an Agilent Bioanalyzer 2100 (Agilent, USA) in order to check whether the prepared NGS library could be used for sequencing. The length was 100 to 300 bp, A library satisfying the condition of 100 pmol / l or more was used for sequencing. We managed the library quality using High Sensitivity chip.

As shown above, the PCR products integrated with each sample and the bar code sequence of the corresponding sample were quantified with a Qubit fluorometer (Invitrogen). A 3 ng PCR product per sample was hybridized on a flow cell with a concentration of 5 pM on a HiSeq 2000 cBOT cluster station. and clusters were formed by amplification 28 times per single DNA molecule by bridge amplification in cBOT. Each cluster was linearized and then hybridized with a sequencing primer. This flowcell was loaded on HiSeq 2000. This flowcell was run with 73 single read bases and HiSeq 2000 Single Read 80 Base Pair Recipe for 7 sequenced multiplexed bases. Image generation and analysis were performed by Illumina Real Time Analysis (RTA), and real-time base-call files and quality scores were confirmed.

After the forward and reverse strands were completed, the Illumina Casava software quality analysis was performed and further downstream analysis was performed using internally developed software.

The appearance frequency of the nucleic acid constituting the determined sequence library reflects the information of the target nucleic acid and the protein, and the nucleic acid of the nucleic acid sample and the target molecule constituting the biological sample can be analyzed using the analysis result.

Target genes and primers Forward primer Reverse Primer Target gene TCCTCATGTACTGGTCCCTCAT GGTGCACTGTAATAATCCAGACTGT KRAS CATACGCAGCCTGTACCCA GTGGATGCAGAAGGCAGACAG RET TGTCCTCTTCTCCTTCATCGTCT AGGAGTAGCTGACCGGGAA RET CCATCTCCTCAGCTGAGATGAC GGACCCTCACCAGGATCTTG RET CCTATTATGACTTGTCACAATGTCACCA TAGACGGGACTCGAGTGATGATT BRAF CACAGCAGGGTCTTCTCTGTTT CCTTCTGCATGGTATTCTTTCTCTTCC EGFR TGTCAAGATCACAGATTTTGGGCT ATGTGTTAAACAATACAGCTAGTGGGAA EGFR GGTGACCCTTGTCTCTGTGTTC AGGGACCTTACCTTATACACCGT EGFR GGAAACTGAATTCAAAAAGATCAAAGTGCT GGAAATATACAGCTTGCAAGGACTCT EGFR cttACCAGCTTGTTCATGTCTGGA AGAGGACTTCGCTGAATTGACC MET GCAGCGCGTTGACTTATTCATG CACAGCTACTCTCAGAAAGCACT MET AACTGAGCTTGTTGGAATAAGGATGTTAT CCATTTTGGTTTAATGTATGCTCCACAATC MET CCCATCCAGTGTCTCCAGAAGT CAAGTGACACTGGTTGTAAATATGCATTT MET GTTATGACAGGATTTGCACACATAGTT CCCAAGCCATTCAATGGGATCT MET CCCTTCTCTTCACAGATCACGA CAGACAGATCTGTTGAGTCCATGT MET GCTTGGGCTGCAGACATTTC GCCAGCTGTTAGAGATTCCTACC MET TGGTCCTGCACCAGTAATATGC ATTATAAGGCCTGCTGAAAATGACTGA KRAS CCATCCACAAAATGGATCCAGACA GCTCTGATAGGAAAATGAGATCTACTGTTT BRAF AGGAAATTCCCACTTAGGAACCATTG AGCAAACTCAGTTGAAATGGTTTGG MET GTTCAGTGTGTCAAACAGTATTCTTGAATG GTTGGATGAATTTCATAGACAATGGGATC MET ACAAGCATCTTCAGTTACCGTGAA AAAACTGCAATTCCTCTTGACTATTCTACA MET GCTATGGATGTTGCCAAGCTGT TAACATGAAAAAGGCTTTGGTTTTCAGG MET GCAACAGCTGAATCTGCAACTC ATTTTCATTGCCCATTGAGATCATCAC MET CTGTGTTTAAGCCTTTTGAAAAGCCA CCAAGTACAACAATTGTATTCACATAGCT MET CATAATTAAATGTTACGCAGTGCTAACCA GCAAACCACAAAAGTATACTCCATGGT MET CAGTCAAACCCTCAGGACAAGA CCCTCGGTCAGAAATTGGGAAA MET TCTCAGGAATCACTGACATAGGAGAAG CGAATGAAATTTCGAAGATCTCCATGTTT MET GCTGGTGGTCCTACCATACATG TTTTTAAAGACTCAGAGCAGGCCTATT MET GAGGCCAGATGAAATACTTCCTTCA AAAATCAGCAACCTTGACTGTGAATTTT MET TGTCCTTTCTGTAGGCTGGATGA GGTGGTAAACTTTTGAGTTTGCAGA MET GTGAAGTGGATGGCTTTGGAAAG AAACTGGAATTGGTGGTGTTGAATTTTT MET CGTCTCCTGGAGATGGATACTCT CTGTGGAGGAACTTTTCAAGCTG FGFR1 GCAGTTACTGGGCTTGTCCAT GAGGCGGAGAAGCTCTAACAC FGFR1 GCATGGACAGGTCCAGGTAC GGAAGACCTGGACCGCATC FGFR1 CCTTACCTGGTTGGAGGTCAA GGAGACGTCCCTGACCTTACA FGFR1 GAGTTCTTTGCTCCACTTGGGA CCACACTCTGCACCGCTAG FGFR1 GCACCTTACCTTGTTCAGGCAA TGGAGTATCCATGGAGATGTGGA FGFR1 AGGAATGCCTTCAAAAAGTTGGGA TCCAGTGCATCCATGAACTCTG FGFR1 GTGATGGCCGAACCAGAAGAAC CATGTGCCTCTGCCATTGTTG FGFR1 GAGAGAGGCCTTGGGACTGATA TCAGAAATGGAGATGATGAAGATGATCG FGFR1 AGCAGGTTGATGATATTCTTATGCTTCC CCACTCCCTTAGCCTTTATCCTG FGFR1 TTAAACCCAATGCCCAGACCCAAA CCCTTCTTCTTCCCATAGATGCTCT FGFR1 TCTCCTCTGAAGAGGAGtcatcatc GGTGTCCGTGTTCATCTGGAAC FGFR1 GGCAGAAAGAGGACTCCTCAGT CGACTGCCTGTGAAGTGGATG FGFR1 TGTAGATCCGGTCAAATAATGCCTC GGTTTCATCTGAGAAGCAAGGAGT FGFR1 GCATTAGAGGCCCAGAGAGAGA TCATCGTCTACAAGATGAAGAGTGGTA FGFR1 GCTGTGGAAGTCACTCTTCTTGG CTAACACCCTGTTCGCACTGA FGFR1 TTGGAATGGGACAAGATTTTCTTTGC CGAAAGACTGGTCTTAGGCAAAC FGFR1 AGGACAGAAGCATCACTTACACTTC CAACTTATGCCACTCTCTGTTTCC FGFR1 AAATGAAAAGCATGTAATCAGGACTTCCTA ACACTGCGCTGGTTGAAAAATG FGFR1 TGTGGTCAGGTTTGAATTCTTTGC GCCGTAGCTCCATATTGGACATC FGFR1 CATGCAATTTCTTTTCCATCTTTTCTGG CTCACAGGTGTTGGGCAGAT FGFR1 CTTTGTCATTTACAAGTACTTTGCAAACAC TCCCTAAAGCTGGAGTCCCAAATA ROS1 TTCTAGTAATTTGGGAATGCCTGGTT cgcctcTGAATATTTCTTTAATGTTGTCTT ROS1 GCCTAGGTGCTCCATAATGATGG AGTCTGGCATAGAAGATTAAAGAATCAAAA ROS1 ACCAATCATGATGCCGGAGAAAG ACCTGGTGTGGTTGTCAATACC ALK TCACCGAATGAGGGTGATGTTTT GCAGAGCCCTGAGTACAAGC ALK GGTTGTAGTCGGTCATGATGGT TGGCCTGTGTAGTGCTTCAAG ALK ccacttcacctagccAGAATTTTC CTGACAGGCGATCTTGAACATCA EML4 AGATGATAGTATTTCTGCTGCAAGTACTTC CACATGATCTTCAGAGATTGCAAGAC EML4 CAAGAAGATGAAATCACTGTGCTAAAGG CAGCTTCAACTTTCAAAGAAAATATTGCAA EML4 CTCTGTCGGTCCGCTGAAT GCTGTGTGCGGAAGGAAAAAA EML4 GTTCTAGTTCAGTCTTCTTCATTGTACCTT CGGAAGAAGGTAAACATTAGCTCTACAG EML4 TCTGTTAAGATATGGTTATCGAGGAAAGGA CAACCATTTCACACAGTCTGTATGG EML4 AGAGAACTCAGCGACACTACCT TCTGAGCTTTCCACAAGAAATCACTT EML4 GCTTCCAAATAGAAGTACAGGTAAGCT CTGAGCACATGTCAAGAGCAAATC EML4 TCTTGCCACACATCCCTTCAAA GCCAGTGTGAGGAGTTTCTGTG EML4 ATGGTATTTCTTTCTTAGAATGTTAGCCCTATC AAATTTACCTTTATTTCTGCTCCTTTTGCTTT EML4 GAGCATATGCTTACTGTATGGGACT GCTTTTGCGACTTACGAATAGATAGTTCTA EML4 TTTTTCATTTGTTTAAATGTGTATTGTTCCATG GGAGAAGGTGATGCTCGAATTTG EML4 gaggaaTCTCATTCTAATGATCAAAGTCCA CCATTCCCTAGCTCTGTACTTGG EML4 TGTCAGTTACATGTCTTTGATACTCAGAA GGGTGTTGAAGGTATTTTCGACAATTTAT EML4 CTTGGGAAAATTCAGATGATAGCCGTA CCAGACATACATAACTGTACATGCAAACAT EML4 CCATAGGGAGACTTTCTCATGTACTC TAGCATTTAAACATCCCACCACTTCA EML4 CCCTCCTTCCAAATGGACTTAATTTTAAA TGCACCACTTCCATTGGTTATACAG EML4 CCTCGAGCAGTTATTCCCATGTC AGACAATTCTGCAATGTTAGTTTTTCCC EML4 aacttttacagttttcttgaggtgattttaatgg TTTCAATTAGCAAAAATTAAACTAAGAAGGGCA EML4 ACAAAGGTATTCTGTTGTTTCATGTTTCC CAATGTCTCTAGGTACAGAAGGCAT EML4 GTTCTACTGAAGTTTTCTTCCAAATAGACACT CTCCAGTTAATAACATCCCATTTCTCATCT EML4 GGCAGTGTGTTCACACTTTGTC GTGGGACAAAATACCTGAGTTTAGAGTATT EML4 GACTAAAACTTTGAAGTAGTCATTTTTGTCTT GAATGAACATGGTAATTGGCCGA EML4 TGTCTTGTGTTTCAACAGAAGGAGAATAT GCTGTCATGGTAGAGAAGGATACG EML4 CCTGAGAAGCTCAAACTGGAGT cctggccTGATGTTTCCTTTTTAATTTTT EML4 gcacaccagcgttatgacaaag TGTGTGGATAGAAACTAGATCTCTGGTT EML4 GGTGGTTTGTTCTGGATGCAGA CAATTGCAGTGAAGTGCTGTGAAT EML4 AGTGGATAGGATTCATTCATTAATTGCCA TACAGCCAGGAAGGTACCATCT EML4 ATTTCTCTAGTCAACACTGACCTATTTTATTCT TCCCAATAATTTTACAACTTGTTCTACTTCACT EML4 GTAGCAGTAATTGAATTGATACTTGAAGGAGA CGCTCCAGGTCCAGAAGAAAATATG EML4 GCAAATACCATAATTACATGCGGTAAATCT GCCATGACAACTTGATGCTTATTAAACAAT EML4 TTTTTAAATGGCATTAGTTCTGTGTGCT GCTCAAAAGTGCCAAGTCCAATA EML4 TCTGTTACTCTATCCACACTGCAGAT ACTTCATGGCCACATAAACACAAAAC EML4 AACAGTATTGGCTAGCTGTTGAACT ATACTTACAGTACAATATTTCATAGTCTCCCGA EML4 CCCAGACAACAAGTATATAATGTCTAACTC CCCTGACAGACACATCTTAGCatatatata EML4 CAAGCACTATGATTATACTTCCTGTTTCT ACAAACCACTTCTTTACATCAGGTGT EML4 TTAATAAGCATCAAGTTGTCATGGCAAAAAA GGCTCTACAGTAGTTTTGCTCCATA EML4 AGACTCAGGTGGAGTCATGCTTA CCTGGTCTAAGAGATGGGACTGA EML4 ATTTCTGAAACAGGCATGTCAAGAATG CCAGTTGATATCAGGTGACTGTCATTG EML4 AGCCATGTCACCAATGTCAGTTTTA GGCTTTGGTTAGAGTAGTATCCGCTA EML4 AGTTATCTTTGCCTCAGAATGAGACTG GTGGGAGAACTGCTTATTCTACTTTCC EML4 GCCCTTAAATGAGACAGCTGAAGA GCTTATCTCGTTGCATGGCTCTT EML4 GAGACCTTGGTGAGCCTCTTTATG ACATGCAGCTGAAGGAAAAGAGTT EML4 CAGCTATAAATGCAGGCTTCGAGTA GTTCCTCGTAAAATAAAGTTTCGTGATGT EML4 GGAAAGGCAGATCAATTTTTAGTAGGC ACCCTGAAAATGAAAGACACTCATTGTTAT EML4 GCTAATTTTTCTGCATCCCTGTGTT GGGATACTGAAACAGATGGACTTTACAAA EML4 GTGATAGCTGTTGCCGATGACT GAGTATCATGGAGAGGAATCAGTAACCTAT EML4 CTTTTGATGACATTGCATACATTCGAAAGA CAGTTATCTTTTCAGTTCAATGCATGCT PIK3CA ATCCGCAAATGACTTGCTATTATTGATG CCCAGGATTCTTACAGAAAACAAGTG NRAS GGGTGAGGCAGTCTTTACTCAC GCCGTTGTACACTCATCTTCCTAG ALK CCTCACCTCTATGGTGGGATCA GCTCGCCAATTAACCCTGATTACT NRAS CAGGTCTCTCCGGAGCAAA GCCAAGTCCCTGTGTACGA HER2 AGAACCTCTCAACATTGTCAGTTTTCT GCTCTGAGTAGAACCATTGCTCA MET TTGGCACAACAACTGCAGCAAA CCAGAACATTGTTCGCTGCATTG ALK GTCTCTCGGAGGAAGGACTTGA CAGACTCAGCTCAGTTAATTTTGGTTAC ALK CAGCTGGTGACACAGCTTATG CTCCGGAGAGACCTGCAAAGAG HER2 TATGCAGATTGCCAAGGTATGCA AATGGGAAGCACCCATGTAGAC HER2 GGGTGTCTCTCTGTGGCTTTAC ACTCTGTAGGCTGCAGTTCTCA ALK GCCAATGAAGGTGCCATCATTC CTCAGGCATCCCAGGCACAT AKT1 ATTTTACAGAGTAACAGACTAGCTAGAGACA AAAGAAAAAGAAACAGAGAATCTCCATTTTAGC PIK3CA GAAATTTAACAGGGTGTTGTTGTGCA CTGTTCATCTGACAGCTGGGAAT DDR2 GCTGGAGGAGCTAGAGCTTGAT GCTTGTGGGAGACCTTGAACAC MEK1 TGGGTGGTCAGCTGCAAC CATGCTTCAATTAAAGACACACCTTCTTTAA ALK GCTCTGAACCTTTCCATCATACTTAGAAAT ccagactaacaTGACTCTGCCCTATATAAT ALK AAAGAAGGTGTGTCTTTAATTGAAGCAT gggtctaatcccatctccagtct ALK TCAtgttagtctggttcctccaaga gggttatacttgcaacacagtct ALK agggaaggctgggtgaacc actgactttggctccagaacc ALK ggagcctaaggaagtttcagcaag cactgctgtgattgcactgaag ALK ggttctggagccaaagtcagtc aactataggaaacacaactgaccaagatc ALK caatcacagcagtggatttgagg aggcggaattagagcacagatc ALK GAAGAGCCACATCAtgaaaagatctct agttaccatccctgcctacaga ALK ggacctctttggactgcagttt ggtagagctctttaggatttttcaaaacca ALK ggttgtcaatgaaatgaattcaccaacata ACAGAATCTACCCACTGAATCACAATTT ALK AAACTCCATGGAAGCCAGAACA ttcattcgatcctcaggtaacccta ALK tggaccgaccgtgatcagat ATCTGCCGGTAGAAGGGAGAT ALK CCTTTGAGGGATGGCACCATAT GAGACATGCCCAGGACAGATG ALK CCTTTCCCTCTGCCCTTTTCAA AGAGAGATAGGAAAATCGGTTTCTGAGTAT ALK GGCTCACAGGCTGAACAGAAAT ACTTCTAGCTCCCACATGCTTC ALK CATTACATAGGGTGGGAGCCAAA TGTGTATCCTCCTGGCTGATCA ALK GCTTTCACCATCGTGATGGACA AAACGGAAGCTCCCAACCTT ALK CTGATCAGCCAGGAGGATACAC CCAAGGTGTCACTTCGTTATGC ALK CCCACCCAATTCCAGGGACTA GGCTTTCTCCGGCATCATGAT ALK TGCTTTTCTAACTCTCTTTGACTGCA GATTGTGGCACAGAGATTCTGATACTT MET CACAGCCTGAGACACTATTCAGTC ACTCTCGCTGATCCTCTCTGT ALK ATGTATTTAACCATGCAGATCCTCAGTTT ATCTTGTTCTGTTTGTGGAAGAACTCT PTEN GGATGAGCTACCTGGAGGATGT CCATCTGCATGGTACTCTGTCT HER2 TCTTTGTCTTCGTTTATAAGCACTGTCA GTGTTCTTGCATAAAAACACTTCAAATG ROS1 TGAAACTTGTTTCTGGTATCCAAAAATCAT CTGGCTTGCAAAAATCCAGTAGTAG ROS1 TTCCTTTAGGAAATGTTAACAGTGCATTTG GATTAAAAATGGTGTAGTATGATTTGTGTACTT ROS1 ACTTACCAAAGGTCAGTGGGATTG CTCTGTGTGCTTAGGTAGAGCTG ROS1 CTGTGACCACACCTGTCATGTA AAGAAGGCAAGACCCTTAAAGGAG RET AGCTCTACCTAAGCACACAGAGTAATA GTGGTTTGTTgctctctgcaaaaa ROS1 GGCCCAATGTGTGGATAGAAC CAGGACAACTTCTCTACATAGCCA RET GTGTGGATAGAACTTTGGTGGGA GAAGTGTCCAGGACAACTTCTCT RET GGGTGGCTATGTAGAGAAGTTGT CTACATGACAGGTGTGGTCACA RET CGAAGTACTGAGTCCAAGCCAT GACAAGTTCCAATGTGCAGAGAAC RET CTTCTGCACTGAAATCTTTCTACAGAATATATT gaatctagataccttgccggtgaag ROS1 cgactagaagcaactccgttca gctcactgctcttccttctctct ROS1 tagattcgctcatcaaaattgactagaagg gcacagttctttggaaaagcaatttc ROS1 gggaaattgcttttccaaagaactg cccagggagttcagtaagcttag ROS1 atcaaaagcaaggtgtttttgcttt ATAATGCCAACTATTTAGTATCCAAAGACTGAG ROS1 AAAAACTAATTAAATCCAGGTAAAAAGCCAT TCGTTTATGGGTGATTTTGACAAATAAGTTTT ROS1 GCCATATATAAGTACACAAATCATACTACACCA GTTTGTTTTGGTTTATTTTGACTCGTTTATGG ROS1 TCACCCATAAACGAGTCAAAATAAACCA CAATGATAAACACTCTTGTACTCTGCaaaa ROS1 CTGCACATTGGAACTTGTCCATG TTCTCCTAGAGTTTTTCCAAGAACCAAG RET GTGGGAATTCCCTCGGAAGAA TGCCTGGCAGGTACCTTTC RET AGTCACTGTCCCTGTGACCAT ACGTAGGGCTATATAATACCAGAAAACTCA RET GCATAGGGACACGTTTCTGTCAT AGGCTGTGCTCATTACACCAG RET CATTTGGAACAGAGGAAAATTTTGACCTC AGaccactattgccctcttacaga RET CCAGTGCCAGCTGGTGTAA GTGGGAAGGCCTGAGAACAC RET GGGCAGTAAATGGCAGTACC TCGGCACCACTGGGTACAG RET TCACATCCAGGTTATATTCCTCAGTAGAAA gtaagcttcgttccaatactttttctacat ROS1 TTTAGGACCAAGAAATCTCAGTCTTTGG GTTTCCTCTACACAACTGAAACTACCT ROS1 CTCAGTCTTTGGATACTAAATAGTTGGCA tcctcatgccatagtttgccag ROS1 GTCCCAACCATGTCAAAATTACAGAC CCATGGGCTAGACACCACT HER2 atttgctcttccatgacaggctta caagtatctcctgatggatgaatgga BIM ccagtgtgtgtatatcacatacttcattta agcaattccacttccaagtatatatccaaaaa BIM AAAGTTAATGTACCGAGGTAAGTTTTCAGT CTGTAGAATGTCCAGAGAAAATTATGGACT BIM GAAAGGACTTAGCCAGATGTGAGTTT CAAAGTCAAGAGAACCACTTATCAACTCA BIM GTCTTAGTTCATGCCTGAAGACCA TGACTTCTTTGTGGAAAATGTATTTTGCAA BIM ATTCTTTACTCAACCCTATCCATGAAGTTC CTGGCTAAGGCGAACCTCTTTAT BIM CATTTCTAAATACCATCCAGCTCTGTCT CATGTGTAGCTGCTGGGATG BIM GCACACCTGTGAGGTGGTG CTGAAATGAGTTCACGAGCAGTAGTA BIM GGGCTGGAAGTTTTATTATTGCTGT CCTGTTAACTCATTTAGTAAGCAAGGATGT BIM GTTAACGTCTTCCTTCTCTCTCTGT TGAGGTTCAGAGCCATGGAC EGFR CATGCGAAGCCACACTGACGT CTTTGTGTTCCCGGACATAGTCCA EGFR TCATCACGCAGCTCATGCCCTT GTGAGGATCCTGGCTCCTTATCTC EGFR gctggtACTTTGAGCCTTCACAG CACCAGCCATCACGTATGCTTC HER2 TCTCCCATACCCTCTCAGCGTA CAGCCATAGGGCATAAGCTGTG HER2

Claims (78)

(a) preparing a single-stranded nucleic acid library;
(b) preparing a molecular binding nucleic acid primary library comprising a molecule-bound nucleic acid which binds the prepared single-stranded nucleic acid library to a molecule constituting the sample by contacting multiple molecules constituting the sample; And
(c) analyzing the nucleotide sequence and frequency of molecular binding nucleic acids constituting the prepared molecular-binding nucleic acid primary library to select molecular-binding nucleic acids representative of the sample, and Methods and kits. (a) preparing a single-stranded nucleic acid library;
(b) Molecular binding nucleic acid primary library prepared by contacting a plurality of molecules constituting the analytical sample and a comparative sample with a single-stranded nucleic acid library was subjected to homogenization, subtraction, homogenization-subtraction or SSH, Producing a library,
From here,
Wherein said molecular binding nucleic acid primary library of said step (b) comprises a single-stranded nucleic acid library which reacts with a plurality of said molecules constituting a sample to form a molecular binding nucleic acid (B) in said molecular binding nucleic acid primary library of said step (b) composed of said molecular binding nucleic acid to form said complexes and to separate said molecular binding nucleic acid from said molecular binding nucleic acid complex, Is a process of uniformly (regularizing) the appearance frequency of the bound nucleic acid;
Wherein said subtraction is carried out in said molecular binding nucleic acid of said molecular binding nucleic acid primary library of said step (b) combined with said molecule to be a target, said molecular binding nucleic acid of step (b) combined with said molecule not related to said target Removing the molecular binding nucleic acid of the primary library;
Wherein the equalization-subtraction process is a process of subjecting the molecular-binding nucleic acid library subjected to the equalization to the subtraction;
The SSH (Suppression Subtractive Hybridization) is a process of selectively amplifying a double-stranded nucleic acid formed by hybridizing a molecular-binding nucleic acid of a molecular-binding nucleic acid primary library of step (b) and a single-stranded nucleic acid, Binding nucleic acid that is specifically present in the molecular binding nucleic acid primary library of step (b) of the assay sample using a coupled nucleic acid primary library and a molecular binding nucleic acid primary library of the comparative sample;
(c) determining the nucleotide sequence and the frequency of molecular binding nucleic acids constituting the molecular-binding nucleic acid secondary library prepared by performing the equalization process, the subtraction process, the equalization-subtraction process or the SSH process; And
(d) analyzing the frequency of occurrence of the molecular binding nucleic acids obtained from the analytical sample and the comparative sample, and selecting a molecular binding nucleic acid capable of comparing or representing the analytical sample and the comparative sample. Nucleic acid selection method and kit. 3. The method according to any one of claims 1 to 2,
Wherein the single stranded nucleic acid library is comprised of an oligonucleotide of the structure &lt; RTI ID = 0.0 &gt; (I) &lt; / RTI &gt;
5'-5'Saving region -Variable region -3'Saving region -3 '<General Formula I>
From here,
The 5 'conserved region includes (a) a position (5' DS conserving region) for binding complementarily to the base sequence of a primer (DS forward primer) used for preparing double stranded DNA and RNA using the oligonucleotide as a template, (b ) The position (5 'RS conservation region) that complementarily binds the base sequence of the primer (RS forward primer) used in the production of the double stranded DNA in single-stranded DNA or RNA prepared from the oligonucleotide as the template as the oligonucleotide, , And (c) a primer (SSH) used in the step of equalizing or subtracting the molecular-binding nucleic acid primary library prepared from the oligonucleotide or sequentially performing the equalization and the subtraction or both the equalization and the subtraction, Forward primer) (5 'SSH conserved region) complementary to the base sequence of the 5' SSH conserved region;
The 3 'conserved region includes (a) a position (3' DS conservative region) for binding the oligonucleotide to the base sequence of a double stranded DNA and a primer (DS reverse primer) ) The position (3 'RS conservation region) that complementarily binds the base sequence of the primer (RS reverse primer) used in the production of the double stranded DNA in single-stranded DNA or RNA prepared from the oligonucleotide as the template as the oligonucleotide, (c) a primer used for the above-mentioned molecular-binding nucleic acid primary library produced in the oligonucleotide to be equalized, subtracted, or subjected to the equalization and the subtraction in sequence, or to perform the equalization and the subtraction at the same time SSH reverse primer) (3 'SSH conserved region);
Wherein the molecular binding nucleic acid primary library and the molecular binding nucleic acid secondary library are digested. The method of claim 3,
The 5 'DS storage region, the 5' RS storage region, and the 5 'SSH storage region are 5' storage regions, and the 3 'DS storage region, 3' RS storage region, Wherein the nucleic acid is partially or wholly superimposed on each other. The method of claim 3,
The DS primer pair is composed of a forward primer and a reverse primer necessary for double-stranded DNA and RNA synthesis using the oligonucleotide as a template,
The forward primer is composed of a base sequence having a position to which the in vitro RNA polymerase binds and a base sequence complementary to a complementary base sequence of the 5 'conserved region of the oligonucleotide,
Wherein the reverse primer is a base sequence complementarily binding to the 3 'conserved region of the oligonucleotide. The method of claim 3,
The RS primer pair is a base sequence for preparing double or single stranded DNA using the oligonucleotide or the transcript RNA of the oligonucleotide as a template, and is composed of a forward primer and a reverse primer,
The forward primer is a base sequence complementary to a complementary base sequence of the 5 'conserved region of the oligonucleotide,
Wherein the reverse primer is a base sequence complementary to a 3 'conserved region of an oligonucleotide when synthesizing cDNA by binding to the RNA template and serving as a primer when used for reverse transcription of the transcript RNA of the oligonucleotide &Lt; / RTI &gt; The method of claim 3,
The SSH primer pair is composed of a forward primer and a reverse primer as base sequences for preparing a tester using a preliminary tester as a template and cDNA prepared using the molecular-binding single-stranded RNA as a template and double-stranded DNA as a template.
The primer for the preparation of the tester 1 is an SS-SS primer tester 1 and a DS reverse primer consisting of a base sequence complementary to a complementary base sequence of an adapter 1 and a 5 'conserved region of an oligonucleotide,
Wherein the primer for the preparation of the tester 2 is an SSH reverse primer tester 2 consisting of a base sequence complementary to the 3 'conservation region of the oligonucleotide with the DS forward primer and the adapter 2 And kit. 8. The method of claim 7,
Wherein the adapter 1 and the adapter 2 are nucleotide sequences capable of performing a PCR process. 3. The method according to any one of claims 1 to 2,
Wherein the single-stranded nucleic acid library is composed of an oligonucleotide having the structure of the following formula II.
5'-variable region-3 '&lt; General Formula II &gt; The method of claim 9, wherein
The single-stranded nucleic acid separated from the molecule-molecule-bound nucleic acid complex pool formed by contacting the single-stranded nucleic acid library composed of the oligonucleotide of the above-mentioned <Formula II> with the molecule constituting the sample was added to 5 The 5'-5 'conservative region-variable region-3' of the <Formula I> structure by adding an oligonucleotide composed of the nucleotide sequences of the '-5' conservative region -3 'and the 5'- 3 'conserved region-3 ' oligonucleotide. 3. The method according to any one of claims 1 to 2,
The chemical modification of the nucleotides constituting the single-stranded nucleic acid of the single-
A chemical substitution at one or more positions selected from the group consisting of ribose position, deoxyribose position, phosphate position and base position. 3. The method according to any one of claims 1 to 2,
The chemical modification of the nucleotides constituting the single-stranded nucleic acid of the single-
2'-O-methyl (2'-OMe), the nucleotide 5'-position (2'-NH2), the nucleotide 2'- A modification in a pyrimidine-modified cytosine exocyclic amine, a substitution of 5-bromouracil, a substitution of 5-bromodeoxyuridine, a substitution of 5-bromodeoxycythidine, a template modification, And at least one variant selected from the group consisting of capping or pegylation at the 3 ' and 5 ' ends of the modified 3 ' end. 3. The method according to any one of claims 1 to 2,
The chemical modification of the nucleotides constituting the single-stranded nucleic acid of the single-
5- (N-benzylcarboxyamide) -2'-deoxyuridine, 5- (N-isobutylcarboxyamide) -2'- deoxyuridine, 5- (N- [2- (lH- 3-yl) ethyl] carboxamide) -2'-deoxyuridine, 5- (N- [1- (3- trimethylammonium) propyl] carboxamide) -2'-deoxyuridine chloride, 5- -Naphthylcarboxamide) -2'-deoxyuridine, and 5- (N- [1- (2,3-dihydroxypropyl)] carboxamide) -2'-deoxyuridine Wherein the selected nucleic acid is a selected strain. 3. The method according to any one of claims 1 to 2,
For preparing said molecular binding nucleic acid primary library,
A single stranded nucleic acid library is contacted with multiple molecules making up the sample, diluting the molecule in the pre- or equilibrium state of the reaction, or adding competing molecules of the molecule) And contacting the single-stranded nucleic acid library with a plurality of molecules constituting the sample while increasing binding affinity and specificity of the nucleic acid and reducing non-specific binding. 15. The method of claim 14,
Wherein the competing molecule is a competing molecule selected from the group consisting of oligonucleotides, polyanions, non-basic phosphodiester polymers, dNTPs, and pyrophosphates. 15. The method of claim 14,
Wherein the polyanion is a polyanion selected from heparin, herring sperm DNA, salmon sperm DNA, dextran sulfate, and polydextran. 15. The method of claim 14,
And separating the molecular binding nucleic acid having a high affinity with the molecule from the molecular binding nucleic acid having a lower affinity and separating the molecular binding nucleic acid having a high affinity from the molecular binding nucleic acid having a lower affinity,
(a) causing the reaction solution comprising the molecular binding nucleic acid complex pool to form an equilibrium bond;
(b) diluting the reaction solution comprising the molecule-bound nucleic acid complex pool; And
(c) maintaining the reaction in a reaction solution comprising a diluted molecular binding nucleic acid complex pool. 15. The method of claim 14,
The separation process of the molecule-binding nucleic acid, which is the maximum affinity in the molecule-binding nucleic acid having the lower affinity,
(a) forming a reaction solution containing the molecule-bound nucleic acid complex pool to form an equilibrium bond;
(b) mixing at least one competitive molecule with the reaction solution comprising the molecular binding nucleic acid complex pool; And
(c) maintaining the reaction in a reaction solution containing the competitor and the molecular binding nucleic acid complex pool. 15. The method of claim 14,
The separation process of the molecule-binding nucleic acid, which is the maximum affinity in the molecule-binding nucleic acid having the lower affinity,
(a) forming a reaction solution containing the molecule-bound nucleic acid complex pool to form an equilibrium bond;
(b) mixing at least one competitive molecule with the reaction solution comprising the molecular binding nucleic acid complex pool;
(c) diluting the reaction solution comprising the molecule-bound nucleic acid complex pool; And
(d) maintaining the reaction in a diluted reaction solution comprising the competitor and the molecular binding nucleic acid complex pool. 15. The method of claim 14,
The separation process of the molecule-binding nucleic acid, which is the maximum affinity in the molecule-binding nucleic acid having the lower affinity,
(a) forming a reaction solution containing the molecule-bound nucleic acid complex pool to form an equilibrium bond;
(b) reacting multiple molecules with the reaction solution together for a time sufficient to achieve equilibrium binding;
(c) adding an excess of at least one competitive molecule to the reaction solution of step (b);
(d) adding an excess of at least one competitive molecule to the reaction solution of step (c);
(e) reacting the reaction solution of step (d), the molecule-molecule-bound nucleic acid complex pool and the competitive molecule reaction solution for a predetermined period of time;
(f) separating the molecule-bound nucleic acid complex pool from the reaction solution;
(g) dissociating the molecule-bound nucleic acid complex pool to produce a free nucleic acid; And
(h) amplifying the free nucleic acid so as to obtain a mixture of molecular binding nucleic acids having increased affinity in the molecular binding nucleic acid capable of binding to each of the multiple molecules with increased affinity, whereby the molecular binding nucleic acid The method comprising the steps of: (a) identifying a molecular binding nucleic acid; 3. The method according to any one of claims 1 to 2,
A method for separating and preparing a molecule-molecule-bound nucleic acid complex pool formed by contacting a single-stranded nucleic acid library with a molecule constituting a sample,
Wherein the molecules constituting the sample are immobilized on a solid support and reacted with the single-stranded nucleic acid library to select the molecule-molecule-bound nucleic acid complex pool. 3. The method according to any one of claims 1 to 2,
A method for separating and preparing a molecule-molecule-bound nucleic acid complex pool formed by contacting a single-stranded nucleic acid library with a molecule constituting a sample,
Single-stranded nucleic acid complex pools are selected by capillary electrophoresis of the reaction solution containing the molecules constituting the sample and the single-stranded nucleic acid library, or by treating the reaction solution with a structure composed of nitrocellulose and nylon, And selecting a molecular binding nucleic acid complex pool. 3. The method of claim 2,
For the preparation of an equalization library from the prepared molecular binding nucleic acid primary library,
(a) preparing a double stranded DNA from the prepared molecular binding nucleic acid primary library as a template;
(b) hybridizing the double-stranded DNA with the solution;
(c) removing the double stranded DNA using an enzyme; And
(d) amplifying the remaining single stranded DNA. 24. The method of claim 23,
The step of preparing the double stranded DNA library comprises:
Wherein the RS primer pair is used. 3. The method of claim 2,
For the production of a subtracted library from the prepared molecular binding nucleic acid primary library,
(a) separating the molecular-binding nucleic acid primary library into a molecular-binding nucleic acid primary library (analyte-molecule-bound nucleic acid library) for the analytical sample to be analyzed and a molecular-binding nucleic acid primary library (Comparative sample-molecule-bound nucleic acid library);
(b) preparing a double-stranded DNA by standard PCR using the above-described analytical sample-molecule-bound single-stranded DNA library as a template, and performing a one-way PCR process using the prepared double-stranded DNA as a template to prepare a single- step;
(c) preparing a driver double-stranded DNA by standard PCR using the above-described comparative sample-molecule-bound single stranded DNA library as a template; And
(d) removing the tester / driver double strand and the non-combined single strand driver obtained by reacting the tester with the driver using an enzyme, and amplifying the remaining single strand tester A method for selecting a molecule-bound nucleic acid, and a kit. 26. The method of claim 25,
The single-stranded tester manufacturing step comprises:
A forward primer and a 3 'conserved region consisting of a base sequence complementarily binding the complementary base sequences of the adapter 1 and 5' conserved regions with the molecular-binding single-stranded DNA constituting the analytical sample-molecular-binding single- And a reverse primer consisting of the adapter sequence 2 and a standard primer, and the thus prepared double-stranded DNA is subjected to a one-way PCR process using the prepared double-stranded DNA as a template. Selection method and kit. 27. The method of claim 26,
Wherein the adapter 1 and the adapter 2 are nucleotide sequences capable of performing a PCR process. 27. The method of claim 26,
The driver double-stranded DNA preparation step comprises:
Wherein the standard PCR process is carried out using a DNA binding single strand DNA constituting the comparative sample-molecule binding single strand DNA library as a template using a DS forward primer and a DS reverse primer. 3. The method of claim 2,
For the preparation of an equalization-subtracted library from the prepared molecular binding nucleic acid primary library,
Wherein the equalization step and the subtraction step are continuously performed to equalize and reduce the molecular weight. 3. The method of claim 2,
For the production of SSH library from the prepared molecular binding nucleic acid primary library,
(a) separating the molecular-binding nucleic acid primary library into a molecular-binding nucleic acid primary library (analyte-molecule-bound nucleic acid library) for the analytical sample to be analyzed and a molecular-binding nucleic acid primary library (Prepared by dividing into a comparative sample-molecule-bound nucleic acid library, respectively;
(b) preparing the tester 1 and the tester 2 as templates from the assay sample-molecule-bound nucleic acid library;
(c) preparing the double-stranded DNA driver using the comparative sample-molecule-bound nucleic acid library as a template; And
(d) obtaining a single-stranded nucleic acid by performing the SSH process by the primary hybridization, the secondary hybridization, and the nested PCR method. 31. The method of claim 30,
The preparation of the tester,
(a) preparing the tester 1 by performing PCR with the SSH forward primer tester 1 and the DS reverse primer using the cDNA library prepared as a template for the molecular binding RNA library or the preliminary tester as a template; And
(b) preparing the tester 2 by PCR using the cDNA library prepared using the molecular binding RNA library as a template or the preliminary tester as a template with the DS forward primer and the SSH reverse primer tester 2 Wherein said method comprises the steps of: 31. The method of claim 30,
The manufacture of the driver,
The cDNA library prepared by reverse transcribing the RS constituting the comparative sample-molecule binding RNA library with the RS reverse primer was used as a template, and PCR was performed using the RS primer pair as a template for the cDNA library. The double stranded DNA Wherein the method comprises the step of: 31. The method of claim 30,
The SSH process step comprises:
And removing the single-stranded driver from the tester / driver double strand obtained by the primary hybridization reaction of the tester and the driver by a PCR process. 31. The method of claim 30,
Wherein the reaction between the tester and the driver is performed by two solution hybridization steps. 31. The method of claim 30,
Wherein the tester comprises the steps of preparing two hybridization solutions of the tester and mixing the driver hybridization solution with each of the tester hybridization solutions to perform a primary hybridization step, . 36. The method of claim 35,
The driver hybridization solution containing the mineral oil is heated to the double strand separation temperature of DNA, and one of the two hybridization solutions of the tester obtained by the first hybridization is added to the driver hybridization solution, And a step of performing a second hybridization step by adding the tester hybridization solution. 37. The method of claim 36,
And after completion of the secondary hybridization process, converting both ends of the formed double-stranded DNA, which is a cohensive terminal, into blunt ends to produce a DNA capable of a nest PCR process A method for selecting a molecular binding nucleic acid and a kit. a) preparing a sequencing library from one or more libraries selected from the group consisting of the molecularly-coupled nucleic acid primary library, the SSH library, the equalization library, the subtractive library and the equalization-subtractive library prepared above;
(b) determining a lead by analyzing a nucleotide sequence of the prepared sequencing library with a next generation nucleotide sequence (NGS);
(c) analyzing the determined lead to determine a corresponding molecular binding nucleic acid;
(d) generating an appearance frequency of the molecular binding nucleic acid constituting the molecular binding nucleic acid primary library or the molecular binding nucleic acid secondary library; And
(e) selecting a molecular-binding nucleic acid capable of comparing or representing an analyte or a comparative sample using the frequency of occurrence of the molecular-binding nucleic acids. 39. The method of claim 38,
To select said biologically meaningful molecular binding nucleic acid,
(Information combining quantitative states) is synthesized by integrating information on the binding state of the molecule constituting the sample and the molecular binding nucleic acid using the appearance frequency of the molecular binding nucleic acids constituting the molecular binding nucleic acid library. Binding nucleic acid selection method and kit. 3. The method according to any one of claims 1 to 2,
(a) selected based on the frequency of occurrence of molecular-binding nucleic acids constituting one or more libraries selected from the above-prepared molecular-binding nucleic acid primary library, SSH library, equalization library, subtractive library and equalization- Preparing a molecular binding nucleic acid pool composed of the molecule-bound nucleic acids and constructing reference sequences with the base sequence of the molecular binding nucleic acids;
(b) preparing a molecular binding nucleic acid complex pool (molecular binding nucleic acid complex pool) in which the molecular binding nucleic acid pool is contacted with molecules constituting a biologically meaningful sample to bind molecules constituting the sample;
(c) preparing a sequencing library from the prepared molecule-bound nucleic acid complex pool;
(d) determining a lead by analyzing a base sequence from the prepared sequencing library;
(e) comparing the determined lead with a reference sequence to determine the frequency of occurrence of the molecular binding nucleic acid;
(f) repeating steps (b) and (e) for biologically meaningful samples to establish a database of the frequency of occurrence of molecular binding nucleic acid pools around biological significance; And
(g) analyzing the constructed database to select a molecular-binding nucleic acid having biological significance. 41. The method of claim 40,
(a) obtaining a binding profile (information synthesizing a quantitative state) at the frequency of the molecular binding nucleic acid from the separated molecule-molecule binding nucleic acid complexes; And
(b) comparing the obtained profile with the already obtained profile data to analyze the extent to which the molecular binding nucleic acids contribute to the analysis of the biological meaning. 42. The method of claim 41,
The molecular binding nucleic acid pool consisting of the molecular binding nucleic acids selected from the one or more libraries selected from the molecular binding nucleic acid primary library, the SSH library, the equalization library, the subtraction library and the equalization- Wherein the molecular binding nucleic acid binding profile is generated as a result of sequencing analysis of a sequencing library prepared from the molecular binding nucleic acid complex pool bound to the constituting molecules. 42. The method of claim 41,
From the molecular binding nucleic acid pool consisting of the molecular binding nucleic acids selected from the one or more libraries selected from the above-prepared molecular binding nucleic acid primary library, SSH library, equalization library, subtraction library and equalization-subtraction library, Wherein the nucleic acid is selected as a criterion that contributes to the analysis of biological significance. 41. The method of claim 40,
The criterion that contributes to the analysis of the biological meaning is "classification", "score" which supports the process of making decision making about biological meaning for the purpose of diagnosing, treating, alleviating, , &Quot; index &quot; means clinical information of a sample or a sample from which a biological meaning is determined, and the produced multiple molecular values are collected, and then, using the statistical technique or the machine learning algorithm, Wherein the specific result is a specific result produced so as to deduce or discriminate the disease from the collected information. 45. The method of claim 44,
For the analysis of biological significance,
Further comprising a Feature Selection procedure for locating key molecules in the one or more molecules to find the major molecules by reducing the dimensionality or by modifying the properties. 45. The method of claim 45,
(a) the feature selection is a filter method that performs learning so as to give the most accurate output as a result of the molecular analysis of the input learning group, and evaluates only the individual molecular values of individual features of the feature set;
(b) a wrapper method that combines feature selection and classifiers into a pair and uses the classification performance of a particular classifier as a rating scale;
(c) an embedded method in which feature selection and classifier learning occur simultaneously; And
and (d) a hybrid method comprising a combination of a filter method and a wrapper method. 47. The method of claim 46,
The filter method may be one selected from the group consisting of information gain, signal to noise ratio, t-statistic, Pearson correlation coefficient, principal component analysis, Determination of the clinical test values from the molecular values was performed in a group consisting of multilayer neural networks, k-nearest neighbors, a decsion tree, support vector machines, and Fisher's linear discriminant analysis Wherein the method is performed with a single classifier selected from the group consisting of: 47. The method of claim 46,
Wherein said wrapper method is characterized by a genetic algorithm (GA). 41. The method of claim 40,
The biological meaning means a physiological change of the person who took the sample or the sample. Decision making is performed for the purpose of prevention, diagnosis, treatment, relief and health management of the treatment according to the clinical test value Wherein the nucleotide sequence is selected from the group consisting of SEQ ID NOs. 41. The method of claim 40,
The biological significance determination is based on the clinical test value of the user, and the clinical test value is similarity to the database of the control group and the comparative group, and the biological significance is determined based on the clinical information of the samples constituting the control group and the comparative group. And a kit for selecting a molecular binding nucleic acid. 3. The method according to any one of claims 1 to 2,
The quantitative analysis method of molecular binding nucleic acids in the molecule-molecule-bound nucleic acid complex obtained by reacting the selected molecular binding nucleic acids with the sample is a method selected from the group consisting of Q-PCR, MS and hybridization. Binding nucleic acid analysis method and kit. 52. The method of claim 51,
Wherein the Q-PCR process is performed using TaqMan PCR, intercalating fluorescent dye during PCR, or molecular beacon during PCR. 52. The method of claim 51,
Wherein the hybridization step comprises binding of the molecular binding nucleic acid or the amplification product of the molecular binding nucleic acid to the capture probe. 3. The method according to any one of claims 1 to 2,
Wherein said selected molecularly-bound nucleic acid is used for diagnostic or therapeutic purposes. 55. The method of claim 54,
Wherein the molecular binding nucleic acid used for diagnostic or therapeutic purposes comprises at least one chemical modification. 56. The method of claim 55,
Wherein said at least one chemical modification is a chemical substitution at one or more positions independently selected from a ribose position, a deoxyribose position, a phosphate position and a base position. 3. The method according to any one of claims 1 to 2,
Wherein the target molecule isolated from the molecule-molecule-bound nucleic acid complex formed by reacting the molecule-bound nucleic acid with multiple molecules constituting the sample is identified. 58. The method of claim 57,
(a) linking the molecular binding nucleic acid to a solid support to produce a capture molecule;
(b) contacting the capture molecule with molecules constituting the sample to prepare a target molecule-capture molecule complex; And
(c) identifying the target molecule by isolating the complex thus prepared. 58. The method of claim 57,
Wherein the identified target molecule is used for diagnostic or therapeutic purposes. (a) preparing a molecular binding nucleic acid pool consisting of molecular binding nucleic acids comprising a known calibrator for multiple target molecules, including internal quality control and quantitative reference materials, and providing a reference comprising a base sequence of said molecular binding nucleic acid Constructing reference sequences;
(b) preparing a molecular binding nucleic acid complex pool (molecule-molecule binding nucleic acid complex pool) in which the prepared molecular binding nucleic acid pool is contacted with a molecule constituting the sample to bind to the molecule;
(c) washing the prepared Molecular-Molecular Bound Nucleic Acid complex pool to remove Unbound Molecular Bound Nucleic Acid and non-specifically bound Molecular Bound Nucleic Acid and separating the Molecular-Molecular Bound Nucleic Acid Complex Pool;
(d) preparing a sequencing library from the separated molecular-molecule-bound nucleic acid complex pool;
(e) analyzing the nucleotide sequence of the prepared sequencing library and analyzing the frequency of appearance of the determined lead;
(f) comparing the determined lead with the reference sequence to determine the frequency of occurrence of the molecular binding nucleic acid corresponding to the lead; And
(g) quantifying the plurality of target molecules using the frequency of occurrence of the molecular binding nucleic acid corresponding to the plurality of target molecules including the reference material. 64. The method of claim 60,
To prepare the molecular-molecular binding nucleic acid complex pool,
The molecular binding nucleic acid pool is contacted with the molecule constituting the sample and the molecule is diluted in the pre-reaction or equilibrium state, or the competing molecule of the molecule is added to the molecular binding nucleic acid pool, And contacting the molecules constituting the sample with the molecular binding nucleic acid pool while increasing the binding affinity and specificity of the sample and reducing nonspecific binding. 62. The method of claim 61,
Wherein the competing molecule is a competing molecule selected from the group consisting of oligonucleotides, polyanions, non-basic phosphodiester polymers, dNTPs, and pyrophosphates. 63. The method of claim 62,
Wherein the polyanion is a polyanion selected from heparin, herring sperm DNA, salmon sperm DNA, dextran sulfate and polydextran. 60. The method of claim 60,
For washing and separating the molecule-molecule-bound nucleic acid complex pool,
The molecules constituting the sample to be analyzed are immobilized on a solid support, and the reaction solution containing the molecules constituting the sample and the single-stranded nucleic acid library is subjected to capillary electrophoresis, and the reaction solution is immersed in a solution composed of nitrocellulose and nylon Wherein the molecule-molecule-bound nucleic acid complex pool is selected from the group consisting of the method of treating the target molecule and the method of treating the target molecule. 64. The method of claim 60,
(a) obtaining a binding profile (information synthesizing a quantitative state) at the frequency of the molecular binding nucleic acid from the separated molecule-molecule binding nucleic acid complexes; And
(b) comparing the obtained profile with the already obtained profile data to analyze the extent to which the molecular binding nucleic acids contribute to the analysis of the biological meaning. 64. The method of claim 60,
As a result of the sequencing analysis of the sequencing library prepared from the molecular binding nucleic acid complex pool comprising the above-mentioned known molecular pressure-binding polymer and the molecular binding nucleic acid pool composed of the selected molecular binding nucleic acids and the molecule constituting the sample, a molecular binding nucleic acid binding profile And a kit for analyzing a target molecule. 64. The method of claim 60,
The frequency of the molecular binding nucleic acid constituting the molecule-molecule-bound nucleic acid pool formed by contacting the molecule-binding nucleic acid pool composed of the molecular-binding nucleic acids comprising the known pressure-tight polymer and the multiple molecules constituting the sample is analyzed, And a molecular binding nucleic acid is selected as a criterion that contributes to the analysis of the biological meaning in the sample. 68. The method of claim 67,
The criterion that contributes to the analysis of the biological meaning is "classification", "score" which supports the process of making decision making about biological meaning for the purpose of diagnosing, treating, alleviating, , &Quot; index &quot;, and collects the clinical information of the sample or sample from which the biological meaning is determined and the produced one or more molecular values, and then uses statistical techniques or machine learning algorithms And a specific result produced so as to deduce or discriminate the disease from the collected information. 69. The method of claim 68,
For the analysis of biological significance,
Further comprising a feature selection procedure for locating key molecules in the one or more molecules to reduce or diminish the dimension or to identify key molecules through modification of the characteristics. 69. The method of claim 69,
(a) the feature selection is a filter method that performs learning so as to give the most accurate output as a result of the molecular analysis of the input learning group, and evaluates only the individual molecular values of individual features of the feature set;
(b) a wrapper method that combines feature selection and classifiers into a pair and uses the classification performance of a particular classifier as a rating scale;
(c) an embedded method in which feature selection and classifier learning occur simultaneously; And
and (d) a hybrid method in which a filter method and a wrapper method are mixed. 71. The method of claim 70,
The filter method may be one selected from the group consisting of information gain, signal to noise ratio, t-statistic, Pearson correlation coefficient, principal component analysis, Determination of the clinical test values from the molecular values was performed in a group consisting of multilayer neural networks, k-nearest neighbors, a decsion tree, support vector machines, and Fisher's linear discriminant analysis Characterized in that the method is carried out with a classifier consisting of one selected. 71. The method of claim 70,
Wherein the wrapper method is characterized by a genetic algorithm (GA). 64. The method of claim 60,
The biological meaning means a physiological change of the person who took the sample or the sample. Decision making is performed for the purpose of prevention, diagnosis, treatment, relief and health management of the treatment according to the clinical test value And the kit comprises the information necessary for the process. 64. The method of claim 60,
The biological significance determination is based on the clinical test value of the user, and the clinical test value is similarity to the database of the control group and the comparative group, and the biological significance is determined based on the clinical information of the samples constituting the control group and the comparative group. And a kit for analyzing a target molecule. 64. The method of claim 60,
Wherein the target molecule is quantified by quantifying the molecule-bound nucleic acid in the molecule-molecule-bound nucleic acid complex obtained by reacting the molecule-bound nucleic acids with the sample. And analyzing proteins and nucleic acids constituting the sample at the same time using molecularbased nucleic acids including a known tympanic membrane and next generation sequence sequencing technology to produce and analyze protein information and nucleic acid information. 80. The method of claim 76,
(a) constructing reference sequences as a base sequence of a molecular-binding nucleic acid including a base sequence of nucleic acids to be analyzed and a known abundance of molecules to be analyzed;
(b) fractionating the biological sample;
(c) contacting the molecule constituting the fractionated biological sample with a molecular binding nucleic acid pool containing an extramammary and separating the formed molecule-molecule-bound nucleic acid complex pool;
(d) preparing a sequencing library from the nucleic acid sample separated from the fractionated biological sample and the separated molecule-molecule-bound nucleic acid complex pool;
(e) comparing the nucleotide sequence of the nucleic acid constructing the prepared sequencing library with the reference sequence to determine the appearance frequency; And
(f) analyzing the nucleic acid of the nucleic acid sample and the molecules constituting the biological sample using the appearance frequency of the nucleic acid constituting the determined sequence library. 80. The method of claim 76,
Wherein the nucleic acid information includes RNA information including mRNA and miRNA, and DNA information including structural variation of a gene, methylation, and SNP.

Images