KR20220139859A - Methods and kits for whole genome amplification and analysis of target molecules in biological samples - Google Patents

Abstract

A method for whole genome amplification and analysis of a plurality of target molecules in a biological sample comprising genomic DNA and a target molecule, wherein the biological sample is conjugated with a tagged oligonucleotide and directed against at least one of the target molecules. contacting with a binder, wherein the tagged oligonucleotide comprises a binder barcode sequence (BAB) and a unique molecular identifier sequence (UMI); performing a separation step to selectively remove unbound binder, thereby obtaining a labeled biological sample; performing whole genome amplification and amplification of the tagged oligonucleotides on the labeled biological sample; preparing a massively parallel sequencing library from the amplified tagged oligonucleotides; sequencing the massively parallel sequencing library; retrieving the sequences of BAB and UMI from each sequencing read; and counting the number of different UMIs for each binder.

Description

Methods and kits for whole genome amplification and analysis of target molecules in biological samples

CROSS-REFERENCE TO RELATED APPLICATIONS

This patent application claims priority from Italian Patent Application No. 102019000024159, filed on December 16, 2019, the entire disclosure of which is incorporated herein by reference.

technical field of invention

The present invention relates to methods and kits for whole genome amplification and analysis of target molecules, in particular quantification of proteins, in biological samples, in particular single cell samples.

prior art

The method of single-cell analysis can obtain information about the cell status without complications due to the heterogeneity of the bulk sample. Analysis of the proteome and genome in the same single cell provides correlations between the phenotype and genotype of cells, thus enabling unique insights into various biological and pathological processes. This is particularly true of tumors, where somatically acquired genetic heterogeneity and its influence on transcription and protein translation are important factors in the development and evolution of cancer.

Whole genome amplification (WGA) is useful for analyzing the genome from a single cell to obtain more DNA and to simplify and/or enable analysis of different types of genes, including sequencing, SNP detection, and the like. WGA by LM-PCR based on deterministic restriction sites (DRS-WGA) is known from EP1109938.

WO 2017/178655 and WO 2019/016401 provide massively parallel sequencing from DRS-WGA (eg Ampli1™ WGA) or MALBAC for low-pass whole genome sequencing and copy number profiling. A simplified method of making a massively parallel sequencing library is taught.

Recently, a method has been developed to analyze the genome and transcriptome simultaneously in a single cell. Day S. et al. [Reference: Dey S. et al., 2015, Integrated genome and transcriptome sequencing of the same cell. Nature Biotechnology, 33(3), 285-289. http://doi.org/10.1038/nbt.3129] describes a method in which messenger RNA from a single cell isolated by hand is first transcribed into single-stranded cDNA and then amplified together with genomic DNA by quasi-linear whole genome amplification. teach Two different libraries (one from cDNA and one from genomic DNA) are then prepared and sequenced. Another approach [see Macaulay, I. C., et al., 2015, G&T-seq: Parallel sequencing of single-cell genomes and transcriptomes. Nature Methods, 12(6), 519-522. http://doi.org/10.1038/nmeth.3370], using oligo-dT coated beads to physically separate mRNA from gDNA to capture and isolate polyadenylated mRNA molecules from fully lysed single cells . Then, mRNA was amplified using a modified Smart-seq2 protocol [Picelli, S. et al., 2013, Smart-seq2 for sensitive full-length transcriptome profiling in single cells. Nature Methods, 10(11), 1096-1100. http://doi.org/10.1038/nmeth.2639], gDNA can be amplified and sequenced by available whole genome amplification methods. Although this method is useful for linking genotypes to messenger transcription, it cannot perform direct detection of proteins, and translation and conversion/degradation of proteins are not actively regulated in cells.

Currently, the most widely applied single cell protein detection approaches rely on targeting specific proteins using tagged antibodies. Fluorescence-based detection and quantification of proteins by fluorescence-activated cell sorting (FACS) or fluorescence microscopy allows for protein detection in single cells with low levels of multiplexing using fluorescently labeled antibodies that recognize specific cellular proteins becomes However, since fluorophore-based highly multiplexed assays are challenged by the spectral overlap between the emission spectra of multiple dyes, this approach is generally limited to 10 to 15 simultaneous measurements. Moreover, deconvolution of overlapping spectra requires complex algorithms.

A Fluidigm mass cytometer (CyTOF™) uses a metal-containing polymer tagged (MAXPAR™) antibody to detect proteins. This instrument is based on the principle of non-optical physical detection and the different chemical properties of the label. The fluorescent label is replaced with a specially designed polyatomic element tag, and detection utilizes the high resolution, sensitivity and analysis speed of time-of-flight mass spectrometry (TOF-MS). Because multiple available stable isotopes can be used as tags, multiple proteins can potentially be simultaneously detected in individual cells (Ornatsky, O. et al, 2010, Highly multiparametric analysis by mass cytometry. Journal of Immunological Methods, 361(1-2), 1-20. http://doi.org/10.1016/j.jim.2010.07.002]. The study of Frei et al. [Frei et al., 2016, Highly multiplexed simultaneous detection of RNAs and proteins in single cells. Nature Methods, 13(3), 269-275. http://doi.org/10.1038/nmeth.3742] teaches a method for simultaneous detection of RNA and protein in single cells based on the proximity ligation assay (PLAYR) of RNA. PLAYR enables highly multiplexed quantification of transcripts in single cells via mass-cytometry, which enables simultaneous quantification of more than 40 different mRNAs and proteins. Finally, by mass cytometry, protein phosphorylation [Bendall, S. C. et. Al., 2011, Single-Cell Mass Cytometry of Differential Immune and Drug Responses Across a Human Hematopoietic Continuum. Science, 332 (6030), 687-696. http://doi.org/10.1126/science.1198704] and cell proliferation [Behbehani, G. K. et al., 2012, Single-cell mass cytometry adapted to measurements of the cell cycle. Cytometry Part A, 81A(7), 552-566. http://doi.org/10.1002/cyto.a.22075], along with protein and messenger RNA transcription, could be investigated for multiple cellular processes and phenotypic properties.

The limitations of this approach are:

- Due to ion flight dynamics in mass spectrometers, the throughput of mass cytometry lags behind that of fluorescence-based instruments. Additionally, the sensitivity of mass reporters makes it difficult to characterize molecules expressed at very low levels using mass cytometry because of the small number of highly quantum efficient fluorophores (e.g., phycoerythrin) [cf. Spitzer, M. H. et al., 2016, Mass Cytometry: Single Cells, Many Features. Cell, 165(4), 780-791. http://doi.org/10.1016/j.cell.2016.04.019].

- Importantly, since the cells are nebulized and ionized, the cells cannot be recovered after analysis, and therefore the genomic DNA cannot be analyzed.

A method of protein detection using an oligonucleotide-labeled antibody is described in a paper by Fredriksson et al. [Fredriksson et al., 2002, Protein detection using proximity-dependent DNA ligation assays. Nature Biotechnology, 20(5), 473-477. http://doi.org/10.1038/nbt0502-473], which shows that cooperative and proximal binding of a target protein by two DNA aptamers is of an oligonucleotide linked to each aptamer affinity probe. A technique to facilitate ligation (proximity ligation assay; PLA) is taught. Ligation of two such proximity probes results in an amplifiable DNA sequence that reflects the identity and amount of the target protein. Method 3PLA (Schallmeiner, E. et al., 2007, Sensitive protein detection via triple-binder proximity ligation assays. Nature Methods, 4(2), 135-137. http://doi.org/10.1038/nmeth974] extends the sensitivity and specificity of the proximity ligation method by using three recognition events, and can detect as many as 100 target molecules. In 3PLA, a set of three oligonucleotide modified antibody reagents bind to individual target proteins and generate a detectable signal by proximity ligation. The 3' and 5' ends of the oligonucleotides on the two proximity probes may hybridize with the oligonucleotides present in the third proximity probe to form a complex comprising the three probes and the target protein. This allows the two oligonucleotides to be linked through an intermediate fragment by two ligation reactions, which are templated by a third proximity probe to form a specific amplifiable DNA strand that can be detected by qPCR. Proximity Extension Assay (PEA) is a method in which two oligonucleotide labeled antibodies bind to individual proteins, the oligonucleotides are partially annealed at the 3' end, and extension by polymerase can be detected by qPCR. It is a mutation of PLA that produces amplifiable DNA sequences (Lundberg, M. et al., 2011, Homogeneous antibody-based proximity extension assays provide sensitive and specific detection of low-abundant proteins in human blood. Nucleic Acids Research, 39(15). http://doi.org/10.1093/nar/gkr424]. Although the above method was not specifically designed for single cell protein detection, the PEA assay, using the Fluidigm C1™ single cell automated preparation system, was used to measure 92 proteins in up to 96 single cells per run. The panel's preparation of amplifiable targets was automated (Egidio C. et al., 2014, A Method for Detecting Protein Expression in Single Cells Using the C1 ™ Single-Cell Auto Prep System (TECH2P.874), J Immunol, 192 (1 Supplement) 135.5)]. The Fluidime C1 microfluidic system supports a variety of single-cell biological methods for analyzing transcript or genomic DNA sequences by whole-exome sequencing and target DNA sequencing, but a simple combination of these methods allows for genotyping and genotyping from the same single cell. Information on the phenotype could not be obtained.

Therefore, PLA and PEA assays, whose detection is based on qPCR, are highly sensitive and highly specific, but have limited throughput and can only detect proteins.

US 9,714,937 to NanoString Technologies, Inc. discloses a plurality of peelable labels linked to a detection antibody via hybridization to a target protein and a first region of a detection antibody, a linker oligonucleotide. Methods of detecting a protein through the use of a capture antibody conjugated to a moiety, such as biotin, specific for a second region of the target protein having a nanoreporter comprising it are taught. The two antibodies form a complex with the target protein, which can form a bond with a matrix or bead with high affinity for that moiety. Targets are detected and quantified by counting the number of nanoreporter molecules. A commercially available assay from Nanostring, Inc., based on nCounter ^® digital molecular barcode technology, detects proteins using unique oligonucleotide labeled antibodies that target specific protein epitopes. A unique single-stranded DNA tag is detected using a combination of a biotinylated capture probe and a reporter probe written by a single-stranded DNA molecule annealed to a series of fluorescently labeled RNA segments. The linear sequence of these labels creates a unique barcode for each target of interest. The complex is then immobilized on the imaging surface through non-covalent bonding between biotin and immobilized streptavidin molecules, and the fluorescent barcodes are imaged and counted. The number of counts per protein-specific barcode is a digital measure that is directly related to the number of molecules present in the sample. Protein detection can be combined with messenger RNA detection using a capture probe-reporter probe couple designed for a specific target RNA. About 30 protein targets and 770 mRNA targets can be analyzed in one analysis.

A drawback of this method is that it requires a large number of cells for profiling of RNA (corresponding to 2,500 cells) and/or protein (corresponding to 100,000 cells), and by itself is not suitable for profiling of single cells. . Potentially, this method can be used to detect other analytes, such as genomic DNA, but cannot read the genomic sequence directly, but can only provide a signal for the presence/absence of a known sequence. Because it is based on hybridization, it is partially resistant to sequence variants and sometimes cannot distinguish between different sequence variants.

An NGS-based method for the integrated analysis of multiple protein and RNA transcripts in a single cell, termed cellular indexing of transcripts and epitopes by sequencing (CITE-seq), is described in Stoeckius et al., 2017, Simultaneous epitope. and transcriptome measurement in single cells, Nature Methods volume 14, pages 865-868, and US 2018/0251825. This method relies on an oligonucleotide labeled antibody used to integrate cellular protein and transcriptome measurements into a single cell readout via a 3'-poly adenosine tail present in an antibody tag similar to that present in messenger RNA. This method is compatible with droplet-based approaches for splitting samples from single cells and preparing single cell libraries, such as that provided by 10X Genomics. More specifically, in the CITE-seq method, cells stained with oligonucleotide-labeled antibodies to cell surface epitopes are split into oil droplets containing lytic enzymes and barcoded beads by microfluidic means. Barcode antibodies and mRNAs from each single cell/droplet are captured by beads with unique cell barcodes. The mRNA is then reverse transcribed and amplified with oligos from the barcoded antibody to generate an NGS library ready for sequencing. Finally, sequence counts are used for quantification of barcoded antibodies. Similarly, Peterson et al., 2017, Multiplexed quantification of proteins and transcripts in single cells, Nature biotech., (35) 10:936-939, describes DNA-labeled antibodies and droplet microfluidics based Teaching methods, RNA expression and protein quantification assays (REAP-seq), whereby proteins can be quantified using 82 barcoded antibodies, and transcripts of >20,000 can be profiled in a single cell. Both methods mentioned above use the DNA polymerase activity of reverse transcriptase to simultaneously extend primed oligo-labeled antibodies to poly(dT) cell barcodes, and synthesize complementary DNA from mRNA in the same reaction. On the other hand, other methods based on the droplet approach can be used for analysis of whole genome copy number profiles or analysis of genomic sequences within a single cell. For example, the commercial solution Chromium Single cell CNV Solution by 10X Genomics enables copy number profiling of hundreds to thousands of single cells, and Mission Bio The Tapestri ^® platform provides single-cell target DNA sequencing for sequencing and CNV analysis of gene panels.

The drawbacks of this method are:

- Neither method of performing transcript/proteome profiling described above simultaneously analyzes genomic sequences with proteins or transcripts because genomic DNA does not have the polyadenosine tail required for amplification.

- Dropseq-based copy number and/or target sequencing methods are only suitable for genomic DNA analysis, but do not provide information on the phenotype of single cells, such as transcriptional profiles or quantification of surface markers or other proteins.

- In the droplet-based single cell division approach, a single cell and all information content are essentially "destroyed" in the process, and after the procedure is complete, the single cell cannot be recovered for further analysis.

Summary of the invention

Accordingly, it is an object of the present invention to provide a method for whole genome amplification and analysis of multiple target molecules in a biological sample, which is the analysis of genome-wide copy-number profiles/genomic sequences and of protein expression on the same single cell. It enables simultaneous analysis and overcomes one or more of the deficiencies of state-of-the-art, in particular:

- it is impossible to detect and quantify proteins and to analyze the genome to single-cell resolution in the same sample,

- It is not possible to reanalyze single cells for additional target genomic information.

This object is achieved by the method defined in claim 1 .

Another object of the present invention is to provide a kit as defined in claim 17 .

1 shows the general structure of two possible embodiments of tagged oligonucleotides in the absence (FIG. 1A) or presence (FIG. 1B) of a 3'-tagged oligo sequence according to the present invention. PL = payload sequence; 5-TOS = first tagged oligonucleotide amplification sequence; 3-TOS = second tagged oligonucleotide amplification sequence; UMI = unique molecular identifier sequence; BAB = binding agent barcode sequence.
2 depicts a graph representing a tagged oligonucleotide library of two different tagged oligos, one prone to intramolecular hairpin formation between 5-TOS and 3-TOS at different temperatures (“hairpins”). present": Tm = 67 °C, "without hairpins": Tm = 45 °C). The x-axis is the expected UMI coefficients, and the y-axis is the counted UMIs after sequencing.
3 shows a graph showing the amplification of different amounts of oligo mixtures by 27 PCR cycles. Each dilution was performed from three independent dilution replicates. The x-axis is the number of distinct UMIs expected to be observed, and the y-axis is the experimentally observed UMIs.
Figure 4 shows three graphs of amplification of four oligo mixtures with different amounts of different BABs. Each dilution has a total of 4 data points, one for each oligo. Figure 4A: 23 PCR cycles were performed. Figure 4B: 27 PCR cycles were performed. Figure 4C: 35 PCR cycles were performed. The x-axis is the number of distinct UMIs expected to be observed, and the y-axis is the experimentally observed UMIs.
5 shows the structure of an embodiment according to the invention of tagged oligos with one primer amplification. Additional captions: 5-WGAH = 5' WGA handle sequence; 3-WGAH = 3' WGA handle sequence; 1AH = first amplification handle sequence; 2AH = second amplification handle sequence.
6 shows the structure of another embodiment according to the invention of a tagged oligo having at least a second primer amplification. Figure 6A: Structures of tagged oligos and relative elongation oligonucleotides with annealing sites corresponding to BAB. Figure 6B: Structures of tagged oligos and relative elongation oligonucleotides with annealing sites that do not correspond to BAB. Additional captions: Ep = 5' stretch oligonucleotide sequence; SS = spacer sequence; AS = annealing sequence; AS-RC = annealing sequence reverse complement.
Figure 7 shows the melting temperature ([Na ⁺ ] = 150 mM; [Mg ⁺⁺ ] = 4 mM) of hairpins in silico (in silico) induced by a 15 nt long complementary sequence located at the end of the ssDNA molecule as a function of molecular length. In silico) a graph of the prediction is shown.
Figure 8 shows the structure of another embodiment according to the invention of tagged oligos with at least three primer amplifications.
9 shows a general scheme for library creation. Figure 9A: Generation of a library from tagged oligos according to the embodiment of Figure 5. Figure 9B: Generation of a library from tagged oligos according to the embodiment of Figure 6A. Figure 9C: Generation of a library from tagged oligos according to the embodiment of Figure 8. Additional captions: 2AH-RC = second amplification handle sequence reverse complement.
Figure 10 depicts the design of the P5-Synth oligos and corresponding library primers disclosed in Example 1.
11 shows a schematic of NGS library generation of oligo P5-Synth using library primers according to Example 1. FIG.
Figure 12 shows a scatter plot of PBMC and SK-BR-3 cells stained with Ab-oligo and a second fluorescent antibody. The x-axis is the fluorescence level of the APC channel, which is proportional to the amounts of Ab-oligo tag1, tag2 and tag4. The y-axis is the fluorescence level of the PE channel, which is proportional to the amount of Ab-oligo tag3.
13 depicts electrophoresis from a library generated from P5-synth tagged oligos from single cells according to Example 1. FIG.
14 depicts the results of protein quantification from single cells treated according to the embodiment of FIG. 8 using tagged oligo amplification after WGA. UMI counts of cytokeratin (Figure 8A), Her2 (Figure 8B), CD45 (Figure 8C) and IgG1 isotype controls (Figure 8D) quantification, respectively. The y-axis is the number of UMIs and the x-axis is the cell type isolated according to FIG. 9 .
15 depicts the results of protein quantification from single cells treated according to the embodiment of FIG. 8 using tagged oligo amplification during WGA. UMI counts of cytokeratin (Figure 8A), Her2 (Figure 8B), CD45 (Figure 8C) and IgG1 isotype controls (Figure 8D) quantification, respectively. The y-axis is the number of UMIs and the x-axis is the cell type isolated according to FIG. 9 .
16 depicts the design of the P5-Lib1 oligos and corresponding library primers disclosed in Example 3.
17 shows a schematic of NGS library generation of P5-Lib1 oligos using library primers.
18 shows an example of a LowPass profile for CNA analysis obtained from single cells. Figure 18A: Single cell CNA profile spiked with P5-Lib1 oligos and treated according to the embodiment of Figure 5. Figure 18B: Single cell CNA profile spiked with P5-Synth oligos and treated according to the embodiment of Figure 8. Figure 18C: Single cell CNA profile in the absence of tagged oligo spikes. All profiles correspond to SK-BR-3 cells with typical gains and losses. Small fluctuations are due to single-cell genome heterogeneity.
19 depicts a graph representing a tagged oligo library obtained from single cells spiked with P5-Synth and P5-Lib1. The x-axis is the expected number of UMIs, and the y-axis is the counted UMIs after sequencing.

Justice

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although many methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described below. Unless otherwise noted, the techniques described herein for use in the present invention are standard methodologies known to those skilled in the art.

An “ab-oligo mixture” refers to any cell targeting an internal (ie, an “internal ab-oligo mixture”) and/or external (ie, an “external ab-oligo mixture”) epitope and/or isotype control ab-oligo. solutions containing ab-oligos.

“Antibody-oligonucleotide conjugate” or “ab-oligo conjugate” or “ab-oligo” refers to a synthetic molecule derived by chemical conjugation of an antibody molecule with an ssDNA oligonucleotide molecule. Chemical conjugation is usually performed using specific chemical reactions that enable the linkage of two molecules in a covalent manner. The stoichiometry of the antibody:oligonucleotide can be controlled to have a specific ratio. In the early stages of WGA, the antibody moiety is usually digested, leaving only the oligonucleotide portion. For simplicity, in the description, these molecules will still be referred to as ab-oligo molecules or ab-oligo amplicons.

The abbreviation “APC” refers to the fluorophore allophycocyanin.

"Binder barcode sequence (BAB)" means a unique DNA oligonucleotide sequence that identifies a binder.

By “balanced PCR amplification” is meant the characteristic of PCR in which amplification of multiple targets is performed, whereby substantially all target molecules are amplified in each PCR cycle.

A "binding agent" refers to a molecule capable of specifically binding to a designated target molecule, e.g., a protein or a glycosylated protein or a phosphorylated protein (e.g., by way of non-limiting example, an antibody, affibody, ligand, aptamer, synthetic binding proteins, small molecules).

"CITE-Seq" or "cellular index of transcripts and epitopes by sequencing" refers to the method developed by Stoeckius et al. for simultaneous protein quantification and mRNA sequencing in single cells. it means.

"CyTOF" or "cytometry by time-of-flight" means a device that performs mass cytometry techniques that use mass spectrometry in combination with cytometry to enable quantification of proteins within single cells. Cells are stained with a binder bound to a heavy metal isotope.

The term “conjugate” refers to a molecule obtained from the covalent conjugation of a tagged oligonucleotide with a binding agent.

"Copy number alteration (CNA)" refers to a somatic change in the copy number of a genomic region that is generally defined with respect to the same individual genome.

"DNA library purification" means the process of separating DNA library material from unwanted reaction components, such as enzymes, dNTPs, salts, and/or other molecules that are not part of the desired DNA library. Examples of DNA library purification processes include purification using solid-state reversible immobilization (SPRI) beads, such as Agencourt AMPure, Merck Millipore Amicon spin-columns, or Beckman Coulter. .

"DNA library quantification" means the process of quantifying DNA library material. Examples of DNA library quantification processes include quantification using QuBit technology, electrophoretic assays (Agilent Bioanalyzer 2100, Perkin Elmer LabChip technology) or RT-PCR PicoGreen systems (Kapa Biosystems).

"Dynamic range" means the ratio between the maximum and minimum values that a particular quantity can assume.

"Library primer" means an ssDNA molecule that acts as a primer to generate a library capable of massively parallel sequencing from tagged oligonucleotides.

"Low-pass whole genome sequencing" or "low-pass sequencing" means whole genome sequencing at an average sequencing depth of less than one.

“Massive-parallel sequencing” or “next generation sequencing (NGS)” refers to spatially and/or temporally separated, clonally sequenced (with or without pre-clonal amplification). ) refers to a DNA sequencing method comprising the generation of a library of DNA molecules. Examples thereof include the Illumina platform (Illumina Inc), the IonTorrent platform (ThermoFisher Scientific Inc), the Pacific Biosciences platform, and the MinIon (Oxford Nanopore Technologies Ltd).

"Multiple Annealing and Looping Based Amplification Cycles (MALBAC)" refers to a quasi-linear whole genome amplification method [Zong et al., 2012, Genome-wide detection of single-nucleotide and copy-number variations of a single human cell, Science. Dec 21;338(6114):1622-6. doi: 10.1126/science.1229164.]. The MALBAC primer has an 8 nucleotide 3' random sequence that hybridizes with the template and a 27 nucleotide 5' consensus sequence (GTG AGT GAT GGT TGA GGT AGT GTG GAG). After the first extension, the semi-amplicon is used as a template for another extension, which creates a whole amplicon with complementary 5' and 3' ends. After several cycles of quasi-linear amplification, the entire amplicon can be amplified exponentially with subsequent PCR cycles.

The term “oligonucleotide” or “oligo” refers to, by way of non-limiting example, an oligomeric molecule comprising a nucleotide sequence such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA), locked nucleic acid (LNA), peptide nucleic acid (PNA), and the like. means

"Tagged oligonucleotide" or "tagged oligo" refers to an oligonucleotide molecule (eg, an ssDNA molecule) conjugated directly to a binding agent (eg, a primary antibody). Tagged oligos are used for indirect quantification of target molecules (eg proteins) that are ligands of binding agents.

The abbreviation “PE” refers to the fluorophore phycoerythrin.

"PFA 2%" means a 2% w/v paraformaldehyde solution in phosphate buffered saline.

"Primary WGA DNA library (pWGAlib)" means a DNA library obtained from a WGA reaction.

The term “reamplification” or “re-amp” refers to a PCR reaction in which all or a substantial portion of a primary WGA DNA library is further amplified.

"Residue" means an amino acid residue present in a polypeptide chain of a protein.

"Sequencing of a barcode" means a polynucleotide sequence that, when sequenced within one sequencer read, makes it possible to assign that read to a specific sample associated with that barcode.

"UMI" or "unique molecular identifier sequence" means a degenerate or partially-degenerate (ie, random or semi-random) oligonucleotide sequence that is substantially unique for each ssDNA or dsDNA molecule.

"Universal WGA-primer" or "WGA PCR primer" means an additional oligonucleotide linked to each fragment produced by the action of a restriction enzyme. Universal WGA primers are used for DRS-WGAs such as Ampli1™ WGA.

DETAILED DESCRIPTION OF THE INVENTION

The method for amplifying whole genomes and analyzing multiple target molecules in a biological sample including genomic DNA and target molecules according to the present invention includes the following steps.

In step a), a biological sample is provided. The biological sample is preferably a single cell, but may also be a sample comprising several cells.

In step b), the biological sample is contacted with at least one binding agent directed to at least one target molecule conjugated with the tagged oligonucleotide, as a result of which at least one target molecule is present in the biological sample, at least one of the binding agent binds to at least one target molecule.

The binding agent is preferably selected from the group consisting of antibodies or fragments thereof, aptamers, small molecules, peptides and proteins. The target molecule is preferably selected from the group consisting of proteins, peptides, glycoproteins, carbohydrates, lipids and combinations thereof. More preferably, the binding agent is an antibody. A binding agent binds to a target molecule with a specific stoichiometry, such as a monoclonal antibody or enzyme substrate, or a non-specific stoichiometry, such as a polyclonal antibody or small molecule. The former enables better quantification of the target in relation to the latter. The binding agent chemically conjugates to the tagged oligo through covalent or non-covalent interactions. In the former case, both the oligo and the binder have reactive moieties that allow them to bond to each other. Binder:oligo stoichiometry can be controlled during the conjugation procedure.

A non-limiting list of examples of binding agents/target molecules is reported in Table 1 below.

binder(s) target molecule(s) Antibodies or Nanobodies or fragments of antibodies such as Fab Antigens, post-translationally modified proteins such as phospho-proteins (pAKT), or acetylated proteins (such as histones) aptamer antigen small molecule drugs cell surface receptors, channels peptide protein, enzyme protein Protein, DNA, RNA

Oligonucleotides used as tagged oligonucleotides are preferably ssDNA or dsDNA molecules with chemical modifications at the 5' or 3' ends. This modification is used for covalent conjugation with counterpart binders.

Conjugates formed by tagged oligos conjugated with a binding agent can target both extracellular and intracellular epitopes. An “external” and an “internal” conjugate can be applied to a biological sample as two separate mixtures comprising the conjugate at the final staining concentration. First, an exogenous mixture is applied to label extrinsic epitopes. Second, cells are permeabilized using detergent or similar means, and the internal mixture is applied to the sample to label internal epitopes. Alternatively, one-step staining may be performed by mixing the external conjugate and the internal conjugate together. The final dyeing concentration is different for each binder and must be determined experimentally.

The tagged oligo sequence is preferably shorter than 300 bases, more preferably shorter than 120 bases to facilitate conjugation with the binder and to reduce cost. In a preferred embodiment, the tagged oligo sequence is between 60 and 80 nucleotides.

Referring to Figure 1A, the tagged oligonucleotides include:

i) a payload sequence (PL) of a nucleic acid comprising a binder barcode sequence (BAB) and a unique molecular identifier sequence (UMI), and

ii) at least one first tagged oligonucleotide amplification sequence of the nucleic acid (5-TOS).

The payload sequence contains the information necessary for target counting.

The unique molecular identifier sequence (UMI) is preferably a degenerate or semi-degenerate sequence in the range of 10 to 30 nucleotides. Preferably, the UMI is at least 10 bases in length and corresponds to 4 ¹⁰ =1,048,576 different combinations in theory, which is sufficient for most target molecules. For highly abundant target molecules, longer UMIs can be used to increase the possible combinations of 12 bases, etc. The use of semi-degenerate bases reduces the possible combinations and increases the UMI length, preferably up to a maximum of 20 or 30 bases. Semi-degenerate UMIs can be advantageously used to introduce reference points that can be used for readouts to realign sequences that prevent overestimation of existing distinct UMIs. The UMI sequence may be located either 5' or 3' of the BAB. The UMI sequence is preferentially placed immediately after the read 1 sequencing primer annealing site to increase the complexity of the first sequenced base. This is advantageous for the Illumina sequencing platform, as it requires high complexity for cluster identification in the initial sequencing step. BAB is a fixed sequence for each conjugate molecule. BAB was designed to circumvent functions that might interfere with primary PCR amplification and sequencing steps such as homopolymer, hairpin and/or heteroduplex formation [Frank, DN, 2009, BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing. BMC Bioinformatics, 10, 362. http://doi.org/10.1186/1471-2105-10-362], selected from a pool of all possible BAB sequences of a defined length to maximize their relative Hamming distance. thus minimizing the possibility that PCR or sequencing errors will lead to misallocation of sequenced reads. The BAB length should be selected based on the number of target molecules to be detected. Preferably, the BAB is at least 10 nucleotides in length, corresponding in theory 4 ¹⁰ =1,048,576 different combinations, which corresponds to the GC content (eg [30%..70%]), the absence of homopolymers, the absence of hairpins. and about 2000 possible BAB sequences after applying the filter to the minimum Hamming distance (preferably ≧3 nt).

The first tagged oligonucleotide amplification sequence (5-TOS) is located 5' of the tagged oligo. This sequence is required for tagged oligo amplification and subsequent library generation. Tagged oligo amplification is necessary to avoid any bias due to molecular loss during processing of the sample that could interfere with proper UMI counts.

1B , the target oligonucleotide preferably further comprises at least one second tagged oligonucleotide amplification sequence (3-TOS). This sequence is located 3' of the tagged oligo. This sequence is required for tagged oligo amplification and subsequent library generation. Tagged oligo amplification is necessary to avoid any bias due to molecular loss during processing of the sample that could interfere with proper UMI counts.

In a preferred embodiment, the 5-TOS and 3-TOS sequences are designed to avoid the formation of stable secondary structures in hairpins and other intramolecular thereof within the amplification temperature range, as they may interfere with tagged oligo amplification. 2 depicts a graph showing a library of tagged oligonucleotides from two different tagged oligos, one prone to intramolecular hairpin formation between 5-TOS and 3-TOS at different temperatures (" "With hairpin": Tm = 67° C., SEQ ID NO: 50, AG = -11.15 kcal/mol; "Without hairpin": Tm = 45° C., SEQ ID NO: 51, AG = -1.52 kcal/mol). The x-axis is the predicted UMI coefficients, and the y-axis is the UMI counted after sequencing.

Tagged oligos and their amplification primers were optimized to achieve high sensitivity, wide dynamic range, balanced PCR amplification and reproducibility.

In a preferred embodiment of the invention, the UMI sequence length was chosen to quantify a target ranging from 0 to about 10 ⁶ molecules (n=10).

The dynamic range was characterized by amplification of tagged oligos with concentrations spanning four orders of magnitude (10 ² to 10 ⁶ molecules). 3 shows a graph showing the amplification of different amounts of oligo mixtures by 27 PCR cycles. Each dilution was performed from three independent dilution replicates. The x-axis is the number of individual UMIs expected to be observed, and the y-axis is the experimentally observed UMIs. A very linear correlation can be observed in the number of molecules ranging from 10 ² to 10 ⁶ between the observed UMI and the predicted UMI before amplification.

Balanced PCR amplification was characterized by performing different amplification cycles on the same starting sample. As shown in Figures 4A and 4B, amplifying the same pool of tagged oligos with different numbers of total PCR cycles (23 and 27 PCR cycles, respectively) did not result in any observed differences in UMI, which indicates that the number does not affect the UMI coefficient.

Sensitivity was characterized by amplification of different amounts (up to 40 molecules) of tagged oligo pools. As shown in Figure 4C, up to 10 ² tagged oligo molecules can be quantified. It should be noted that serial dilution solution experiments are prone to sampling bias because the distribution of molecules within the volume is very non-uniform, which is particularly relevant for highly dilute solutions. Thus, the observed limit of quantification may be an underestimation related to the experimental setup rather than the limit of the assay.

In step c) of the method according to the invention, a separation step is carried out to selectively remove unbound binder, in this way to obtain a labeled biological sample. The separation step is usually performed by washing with an appropriate buffer solution and collecting the labeled biological sample by centrifugation.

In step d), the whole genome amplification of said genomic DNA and amplification of the tagged oligonucleotide conjugated with at least one binding agent are performed simultaneously on the labeled biological sample. Whole genome amplification of genomic DNA is performed either by deterministic restriction site whole genome amplification (DRS-WGA) or by multiple annealing and loop based amplification cycle whole genome amplification (MALBAC).

In step e), a large-scale parallel sequencing library is constructed from the amplified tagged oligonucleotides.

In step f), a massively parallel sequencing library is sequenced.

In step g), the sequences of the binder barcode sequence (BAB) and the unique molecular identifier sequence (UMI) are retrieved from each sequencing read.

In step h), the number of different unique molecular identifier sequences (UMIs) is counted for each binding agent.

Steps e), f), g) and h) will be disclosed in more detail with reference to specific embodiments later in the detailed description.

The disclosed method preferably further comprises isolating a single cell from the biological sample. Isolation can be carried out by selecting the cells, in particular, using a cell sorter such as, for example, DEPArray ^® Menarini Silicon Biosystems SpA (DEPArray ® NxT), or alternatively by dividing the cells into droplets. The isolation step is preferably carried out after step c) and before step d).

The disclosed method preferably comprises the step of purifying the massively parallel sequencing library before step f).

In more specific terms, but without intending to limit the scope of this description, the method disclosed above, also designated Ampli1 protein (A1-P), allows for quantification of the protein and whole genome genetic characterization of single cells. Quantification of single or multiple proteins in a single cell is achieved using a panel of binding agents (particularly antibodies (Abs)) conjugated with tagged oligonucleotides. These oligonucleotides unambiguously identify conjugated antibodies via DNA barcode sequences and quantify the abundance of desired epitopes via random or partially degenerate sequences, i.e., Unique Molecular Identifiers (UMI) used for epitope quantification. designed to do Biological samples are labeled with one or more Ab-oligo conjugates, each having a unique DNA barcode sequence. Single cells or pools of cells can then be isolated by different means (e.g., the DEPArray™ NxT system) and their genomic contents can be amplified by whole genome amplification (e.g., Ampli1™ Whole-Genome-Amplification Kit). . At or immediately after the latter step, the tagged oligonucleotides are pre-amplified to avoid downsampling during the NGS library preparation procedure. Specific primers, i.e. “library primers,” are used to generate NGS (Illumina) libraries ready for sequencing. Tagged oligonucleotides are designed to be compatible with the Ampli1™ WGA (A1-WGA) workflow, enabling single-cell genetic analysis (eg Ampli1™ LowPass) in parallel with protein quantification using A1-P.

In the following, three specific embodiments of the present invention are disclosed, each using a different number of primers for tagged oligo amplification and whole genome amplification.

In a first preferred embodiment and with reference to FIG. 5 , the tagged oligonucleotide is at least 5′ to 3′

a) a first tagged oligonucleotide amplification sequence of a nucleic acid (5-TOS) comprising, in turn, a 5' whole genome amplification handle sequence (5-WGAH) and a first amplification handle sequence (1AH);

b) payload sequence (PL);

c) a second tagged oligonucleotide amplification sequence of a nucleic acid (3-TOS) comprising, in turn, a second amplification handle sequence of the nucleic acid (2AH) and a 3' whole genome amplification handle sequence (3-WGAH)

includes

3-WGAH is the reverse complementary sequence of 5-WGAH, allowing simultaneous amplification of gDNA and tagged oligonucleotides during whole genome amplification. 1AH and 2AH are located at the 5' and 3' ends of the payload sequence, respectively, and are used for subsequent library generation. 1AH and 2AH are preferably designed to avoid stable intramolecular secondary structures such as hairpins that can inhibit tagged oligo amplification. A fixed sequence may exist between each of the above-described sequences.

Whole genome amplification and amplification of tagged oligos are preferably performed using a single primer.

In a second preferred embodiment and with reference to FIGS. 6A and 6B , the tagged oligonucleotide is at least 5′ to 3′

a) a first tagged oligonucleotide amplification sequence of a nucleic acid (5-TOS) comprising, in turn, a 5' whole genome amplification handle sequence (5-WGAH) and a first amplification handle sequence (1AH);

b) payload sequence (PL);

c) optionally an annealing sequence (AS)

includes

At least one primer is used for whole genome amplification and amplification of the tagged oligonucleotide, at least one oligonucleotide (E-p) is used for extension of the tagged oligonucleotide, and wherein said at least one oligonucleotide (E-p) is 3 ' at least

d) 5' whole genome amplification handle sequence (5-WGAH);

e) a spacer sequence (SS);

f) a second amplification handle sequence (2AH); and

g) a sequence that is reverse complementary to the annealing sequence (AS-RC) or reverse complementary to the binder barcode sequence (BAB-RC)

includes

In other words, amplification of the tagged oligo occurs by annealing E-p to the AS located 3' of the tagged oligo using the annealing sequence reverse complement (AS-RC) located at the 3' end of E-p (Fig. 6A), thus This results in 3' extension of both the tagged oligo and E-p in the reaction, which in turn produces a WGA-primer amplifiable molecule. Alternatively, as shown in FIG. 6B , AS can match the BAB sequence, and E-p can anneal to the BAB sequence via the BAB reverse complementary sequence (BAB-RC). The first option (anneal to AS) has the advantage that a single E-p can be used with any BAB, thus reducing manufacturing cost and protocol complexity. The second option (anneal to BAB) can advantageously be used to normalize signals originating from targets with large differences in abundance. This can be achieved, by way of non-limiting example, by using limiting amounts of primers for potentially highly enriched targets, or by using different BAB annealing temperatures to reduce amplification of highly enriched tagged oligos. The annealing temperature can be adjusted by the BAB length and/or composition.

After extension of the tagged oligo and E-p, the WGA primer performs amplification of the tagged oligo within the resulting larger molecule. The spacer sequence (SS) increases the length of the amplicon produced by the tagged oligo. As the fragment length increases, intramolecular secondary structures such as hairpins induced by the complementary ends of the fragment become unstable, thereby lowering the melting temperature (Fig. 7), and promoting amplification of tagged oligos with other WGA fragments. become [cf. M. Zuker. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31 (13), 3406-15, (2003)]. The length of the elongation oligonucleotide (E-p) sequence is preferably in the range of 60 to 300 bases. More preferably, the length of the elongation oligonucleotide (E-p) sequence is in the range of 120 to 200 bases.

In a third preferred embodiment and with reference to Figure 8, the tagged oligonucleotide is at least 5' to 3'

a) a first tagged oligonucleotide amplification sequence (5-TOS) of a nucleic acid corresponding to a first amplification handle sequence (1AH);

b) payload sequence (PL);

c) a second tagged oligonucleotide amplification sequence (3-TOS) of a nucleic acid corresponding to a second amplification handle sequence (2AH)

includes

at least one first primer is used for whole genome amplification, at least one second and one third primer is used for amplification of the tagged oligonucleotide, and at least one second primer is used for amplification of a first amplification handle sequence (1AH) and the at least one third primer has a sequence that is reverse complementary to the second amplification handle sequence (2AH-RC).

The tagged oligo amplification primers are designed to have a melting temperature compatible with at least the first 10 to 15 cycles of the WGA PCR thermal profile.

Preferably, at least one second primer and at least one third primer are added in step d).

Step e) of preparing a massively parallel sequencing library from the amplified tagged oligonucleotides preferably comprises at least one first library primer comprising a 3' sequence corresponding to the first amplification handle sequence (1AH), and a second PCR reaction using at least one second library primer comprising a 3' sequence corresponding to a sequence reverse complementary to the amplification handle sequence (2AH-RC).

Therefore, library primers are advantageously used to generate NGS libraries for quantitative analysis of binders in a single PCR step. The specific examples of library primers reported herein are used to generate libraries compatible with the Illumina sequencing platform, without intending to limit the scope of the present invention.

In a preferred embodiment, the forward and reverse primers are designed based on an Illumina adapter comprising from 5' to 3':

1) Illumina adapter sequence (IA): Required for Illumina sequencing.

- Index sequencing primers/flow cytometric binding sequence: This region is required for flow cytometric binding as well as annealing sequences for i5/i7 index sequencing primers.

- i5/i7 index: index used for NGS multiplexing reaction;

- Read 1/Read 2 sequencing primers: Illumina sequencing primers and annealing sequences for amplification of libraries from tagged oligos.

2) a sequence that is reverse complementary to the first amplification handle sequence (1AH) or the second amplification handle sequence (2AH-RC): these sequences are the first amplification handle sequence and the second amplification handle sequence respectively on the double-stranded tagged oligo after amplification of the tagged oligo; annealed with a second amplification handle sequence.

9 shows the structure of library primers used in the generation of a massively parallel sequencing library from the amplified tagged oligonucleotides, respectively, in the embodiment according to FIGS. 5 ( FIG. 9A ), FIG. 6A ( FIG. 9B ) and FIG. 8 ( FIG. 9C ). shows

After generation of the library, preferably at least one purification step is performed, followed by pooling necessary for library quantification and subsequent sequencing procedures. Sequencing is preferentially performed as a paired-end sequencing, resulting in two reads, each derived from a strand of the library DNA molecule.

The same approach can be used to generate NGS libraries for other sequencing platforms such as Ion Torrent.

Analysis of paired-end read sequences generated from the NGS library is analyzed according to the following steps:

1. Sub-sequence extraction. Sub-sequences corresponding to UMI, BAB and amplification handle sequences (1AH and/or 2AH) are extracted from both sequencing reads for each tagged oligo molecule.

2. Read the realignment. If the sub-sequence and/or amplification handle sequence(s) of the BAB do not match the reference sequence (with a tolerance of 0.5 to 2 mismatch for every 5 bases), the position of the sub-sequence ranges from -n to +n. Offset up to a variable amount (where n is the maximum offset allowed) (eg n=8), and the sub-sequence is re-extracted. For each iteration, the Hamming distance from the reference sequence is calculated, the offset that returns the minimum distance is selected, and all sub-sequences (UMI, BAB, amplification handle sequences) are extracted.

3. Read the filtering. The BAB is read and/or sub-sequences different from the reference sequence are processed, whose sub-sequences have more than a defined amount of bases discarded as poor quality reads.

4. Determination of UMI. The UMI sequences from the read pairs are expected to be completely complementary in the absence of sequencing errors. If there is any difference between the first strand UMI and the second strand complementary UMI sequence:

a. read pairs may be discarded with low confidence, or

b. Consensus between two sequences can be calculated, for each position in the UMI, by selecting bases from among the sequences from the two sequencing reads, which is the highest base calling score reported by the sequencer's base caller. have

Although the first method (a) has a low tendency to overestimate the target molecule due to sequencing bias, it can read the actual binding event between the binding agent and the target molecule, which instead reverts to the second method (b).

5. Target Molecules Quantification. Counting of target molecules is performed by determining the number of distinct UMI sequences for each BAB sequence representing a particular binding agent in the analyzed sample.

The kit according to the invention comprises:

a) at least one binding agent directed to at least one target molecule in a biological sample conjugated with a tagged oligonucleotide, said tagged oligonucleotide comprising:

i) a payload sequence (PL) of a nucleic acid comprising a binder barcode sequence (BAB) and a unique molecular identifier sequence (UMI);

ii) at least one first tagged oligonucleotide amplification sequence (5-TOS)

at least one binder comprising;

b) at least one primer for carrying out whole genome amplification and at least one primer for carrying out amplification of a tagged oligonucleotide, wherein at least one primer for carrying out said whole genome amplification and amplification of said tagged oligonucleotide at least one primer for carrying out the at least one primer having the same sequence or having a different sequence

includes

In a preferred embodiment, the kit comprises an oligonucleotide for extending the tagged oligonucleotide.

In a preferred embodiment, the at least one tagged oligonucleotide has a sequence corresponding to SEQ ID NO: 1, and there are two primers for carrying out the amplification of the tagged oligonucleotide, each having the sequence of SEQ ID NO: 2 and SEQ ID NO: 3. The kit preferably further comprises one or more first library primer(s) and one or more second library primer(s). More preferably, the first library primer has a sequence selected from the group consisting of SEQ ID NO: 8 to SEQ ID NO: 15, and the second library primer has a sequence selected from the group consisting of SEQ ID NO: 16 to SEQ ID NO: 27.

In another preferred embodiment, the at least one tagged oligonucleotide has a sequence corresponding to SEQ ID NO:28 and the oligonucleotide for effecting extension of the tagged oligonucleotide has a sequence corresponding to SEQ ID NO:29. The kit preferably further comprises one or more first library primer(s) and one or more second library primer(s). More preferably, the first library primer has a sequence selected from the group consisting of SEQ ID NO: 30 to SEQ ID NO: 37, and the second library primer has a sequence selected from the group consisting of SEQ ID NO: 38 to SEQ ID NO: 49.

Example

Example One

In this example, tagged oligos were designed to perform amplification after WGA with the setup according to FIG. 8 . A tagged oligo named "P5-Synth" (SEQ ID NO: 1, FIG. 10, NNNNNNNNNN: UMI sequence) was designed to be compatible with the Ampli1™ WGA kit (Menarini Silicon Biosystems). The first amplification handle sequence (1AH) was identical to the last 19 bases of the index 2 (i5) adapter of the Illumina TruSeq DNA and RNA CD index. A second amplification handle sequence (2AH) was generated in silico to avoid intramolecular secondary structures and potential matches to the human genome. The melting temperatures of both amplification handle sequences were designed to be similar to those of the WGA primers. Tagged oligo amplification primers (SEQ ID NO: 2 and SEQ ID NO: 3) were designed according to the first and second amplification handle sequences.

As shown in FIG. 10 , the forward library primer is identical to the index 2 (i5) adapter (Illumina), whereas the reverse library primer is identical to the index 1 (i7) adapter to which the reverse complementary sequence of the second amplification handle sequence is added. More specifically, Figure 10 depicts the design of P5-Synth oligos and corresponding library primers.

Oligo P5-Synth (SEQ ID NO: 1): White boxes indicate internal domains with UMI and binder barcodes. Gray boxes with black borders indicate the first and second amplification handle sequences.

P5 library primer (SEQ ID NO: 8): Forward primer used for generation of NGS library. The gray boxes are the annealing sites with oligo P5-Synth; The short dashed box is the i5 index used for multiplexing the sequencing reaction; Inside the long dashed box is the index sequencing primer/flow cyto adapter sequence.

Synth library primer (SEQ ID NO: 16): Reverse primer used for generation of NGS library. The gray boxes are the annealing sites using oligo P5-Synth. Within the short dashed box are the sequencing primer sites; The dashed box is the i5 index used for multiplexing the sequencing reaction; Inside the long dashed box is the index sequencing primer/flow cyto adapter sequence.

As shown in Figure 11, during library generation, Illumina index 1 and 2 adapters are added to the 5' and 3' of the tagged oligos, respectively.

In this example, the tagged oligo was conjugated via a 5' amino modifier. A C6 or C12 spacer was present between the amine moiety and the 5' of the oligo to avoid the steric hindrance inhibitory effect on the subsequent PCR reaction. Antibodies were covalently linked via amino-reactive reagents from lysine, glutamine, arginine and asparagine residues to tagged oligos using amines commonly present in antibodies. Four Ab-oligos (Table 2) were generated using tagged oligos and antibody oligo conjugation was 1:2 by Expedeon Ltd (25 Norman Way, Over, Cambridge CB24 5QE, United Kingdom). of antibody:tagged oligo stoichiometry. Epitope localization: indicates location relative to the cell membrane.

designation antibody Lee So-hyung Antibody name binder barcode epitope localization Ab-oligo tag 1 Anti-Pan-cytokeratin mouse IgG1 anti-CK TACTCATGCT
(SEQ ID NO: 4) inside Ab-oligo tag2 Anti Her2 mouse IgG1 Anti Her2 AGATAGCGCA
(SEQ ID NO: 5) inside Ab-oligo tag3 Anti-CD45 mouse IgG2a Anti-CD45 TCTCTCGCTG
(SEQ ID NO: 6) Out Ab-oligo tag4 IgG1 isotype control mouse IgG1 IgG1 isotype CTGAGTCAGA
(SEQ ID NO: 7) -

Ab-oligos were used to stain two different types of cell lines. The first cell type was SK-BR-3 cells, a breast tumor-derived cell line overexpressing cytokeratin and Her2 proteins. The second cell type was peripheral blood mononuclear cells (PBMC), which are leukocytes extracted from whole blood expressing CD45 and negligible levels of cytokeratin and Her2.

SK-BR-3 cells (ATCC ^® HTB-30™, ATCC) were grown in culture according to the manufacturer's procedures. PBMCs were extracted from human blood samples. Both cell types were fixed using PFA 2% according to a customized protocol.

Cell staining with Ab-oligos was performed on 100,000 to 50,000 pre-fixed and permeabilized cells. Cells were collected by centrifugation at 1000 × g, RT for 5 min. Cells were washed with at least 1 mL of running buffer (autoMACS running buffer, ref. 130-091-221, Miltenyi Biotec) and collected by centrifugation. This last step was repeated twice. External Ab-oligos and their isotype Ab-oligo controls are diluted to working concentration in 100 μl of running buffer. An external Ab-oligo mixture (Ab-oligo tag3) was added to the cells and incubated for 15 minutes at room temperature. Samples were then washed twice with 1 mL of running buffer and collected by centrifugation. Goat anti-mouse IgG2a-PE antibody in 500 μl of running buffer was added and incubated at +4° C. for 30 minutes. This step enabled staining of PBMC cells in PE. Samples were washed twice with running buffer. Internal Ab-oligos and their isoform Ab-oligo controls are diluted to working concentration in 200 μl of Internal Perm Buffer (Inside Stain Kit, Ref. 130-090-477, Miltenyi Biotec). Internal Ab-oligo mixtures (Ab-oligo tags 1, 2 and 4) were added to the cells and incubated for 10 minutes at room temperature. Samples were washed twice with 1 mL of internal Perm buffer and collected by centrifugation. A mixture of Hoechst and goat anti-mouse IgG1-APC antibodies in 500 μl of internal Perm buffer was added and incubated at +4° C. for 30 minutes. This step enabled staining of SK-BR-3 cells in PE and all cell nuclei. Samples were washed twice with running buffer.

By adding a secondary antibody conjugated to a fluorophore, SK-BR-3 cells (APC channel) and PBMC (PE channel) can be identified by fluorescence. Moreover, the fluorescence level reflects the relative abundance of Ab-oligos. Single cells were purified based on their immunofluorescence labeling using the DEPArray™ NxT system (Menarini Silicon Biosystems) (FIG. 12).

Specifically, Figure 12 shows a scatter plot of PBMC and SK-BR-3 cells stained with Ab-oligo and secondary fluorescent antibodies. The x-axis is the fluorescence level of the APC channel, which is proportional to the amounts of Ab-oligo tag1, tag2 and tag4. The y-axis is the fluorescence level of the PE channel, which is proportional to the amount of Ab-oligo tag3. The scatter plot is divided into four quadrants according to immunofluorescence levels, each containing a specific cell type: 1) PBMCs (high levels of CD45 and low levels of CK, Her2); 2) double positive cells (high levels of CD45, CK, Her2); 3) double negative cells (low levels of CD45, CK, Her2); 4) SK-BR-3 cells (low levels of CD45 and high levels of CK, Her2). Single cells highlighted with empty/filled squares/circles were isolated and used for library generation.

Alternatively, to perform tagged oligo amplification after WGA, a customized reaction mixture of forward/reverse primers and Ampli1™ PCR kit reagents was prepared according to the left inset in Table 3. To each tube containing the WGA product was added 15 μl of the reaction mixture. Each sample was incubated according to the thermal profile shown in the right inset of Table 3.

Left inset: reaction mixture composition of tagged oligo amplification reaction. Right inset: Thermal cycle program of tagged oligo amplification.

Library preparation was performed by taking an aliquot of 1 μl of WGA containing the amplified Ab-oligo amplicons using the Ampli1™ PCR kit using P5 and Lib1 library primers at a final concentration of 0.5M. PCR thermal cycle profiles are presented in Table 5. Each sample had a different combination of NGS library primers for dual indexing to demultiplex data during bioinformatics analysis. A list of library primers used is given in Table 4. The P5 library primer is a forward primer that can be used with the tagged oligo P5-Synth.

Sequence P5 library primer (5' -> 3') [i5] index number SEQ ID NO: AATGATACGGCGACCACCGAGATCTACAC TATAGCCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT D501 8 AATGATACGGCGACCACCGAGATCTACAC ATAGAGGC ACACTCTTTCCCTACACGACGCTCTTCCGATCT D502 9 AATGATACGGCGACCACCGAGATCTACAC CCTATCCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT D503 10 AATGATACGGCGACCACCGAGATCTACAC GGCTCTGA ACACTCTTTCCCTACACGACGCTCTTCCGATCT D504 11 AATGATACGGCGACCACCGAGATCTACAC AGGCGAAG ACACTCTTTCCCTACACGACGCTCTTCCGATCT D505 12 AATGATACGGCGACCACCGAGATCTACAC TAATCTTA ACACTCTTTCCCTACACGACGCTCTTCCGATCT D506 13 AATGATACGGCGACCACCGAGATCTACAC CAGGACGT ACACTCTTTCCCTACACGACGCTCTTCCGATCT D507 14 AATGATACGGCGACCACCGAGATCTACAC GTACTGAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT D508 15 order Synth library primer (5' -> 3') [i7] index number SEQ ID NO: CAAGCAGAAGACGGCATACGAGAT CGAGTAAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D701 16 CAAGCAGAAGACGGCATACGAGAT TCTCCGGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D702 17 CAAGCAGAAGACGGCATACGAGAT AATGAGCG GTGACTGGAGTTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D703 18 CAAGCAGAAGACGGCATACGAGAT GGAATCTC GTGACTGGAGTTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D704 19 AGCAGAAGACGGCATACGAGAT TTCTGAAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D705 20 CAAGCAGAAGACGGCATACGAGAT ACGAATTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D706 21 CAAGCAGAAGACGGCATACGAGAT AGCTTCAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D707 22 CAAGCAGAAGACGGCATACGAGAT GCGCATTA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D708 23 CAAGCAGAAGACGGCATACGAGAT CATAGCCG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D709 24 CAAGCAGAAGACGGCATACGAGAT TTCGCGGA GTGACTGGAGTTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D710 25 CAAGCAGAAGACGGCATACGAGAT GCGCGAGA GTGACTGGAGTTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D711 26 CAAGCAGAAGACGGCATACGAGAT CTATCGCT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TGGCGCATAATGCATAGCCG D712 27

step temperature hour cycle One 95℃ 3 minutes One 2 95℃ 30 seconds 3 60℃ 30 seconds 72℃ 10 seconds 3 95℃ 30 seconds 23-30 65℃ 30 seconds 72℃ 10 seconds 4 72℃ 1 minute One 5 4℃ ∞ One

Thermal cycle profile for NGS library generation. The number of cycles during step 3 depends on the number of cells recovered and the effective amount of total Ab-oligos in the cells. Usually, after 27 amplification cycles in step 3, a sufficient amount of amplicons was obtained from a single cell.

Library samples were purified using Agencourt AmPure XP beads (Beckman-Coulter). NGS DNA quantification was performed using a KAPA SYBR ^® FAST qPCR kit (Kapa Biosystems). Each NGS library was examined using an Agilent Bioanalyzer 2100 (Agilent), and a library electrophoresis diagram usually consisting of a single peak at 185 bp is shown ( FIG. 13 ).

Samples were pooled together and sequencing was performed on a MiSeq system (Illumina) using the MiSeq Reagent Kit v3 150-cycle (Ref. MS-102-3001, Illumina). Data analysis was performed using custom software developed in Python. Quantification of protein targets according to UMI counts is reported in FIG. 14 . As expected, SK-BR-3 cells showed high expression of cytokeratin and Her2 and low levels of CD45, whereas PBMC showed the opposite behavior. Protein expression levels were high in double positive cells, especially in isotype controls, indicating that these cells are susceptible to non-specific staining. Conversely, double negative cells showed lower levels for all four targets.

Example 2

In this example, the tagged oligo was designed to perform amplification during WGA with the setup according to FIG. 8 . The experimental procedure is the same as in Example 1 except for the following. Tagged oligo amplification primers were added directly to the primary PCR reaction mixture to a final concentration of 0.02 μM. Generation of the library and data analysis were performed as shown in Example 1.

Quantification of protein targets according to UMI counts is reported in FIG. 15 . As expected, SK-BR-3 cells showed high expression of cytokeratin and Her2 and very low levels of CD45, whereas PBMC showed the opposite behavior. Protein expression levels were high in double positive cells, especially in isotype controls, indicating that these cells are susceptible to non-specific staining. Conversely, double negative cells showed lower levels for all four targets. According to the results of Example 1, it can be inferred that the amplification of the tagged oligo can be performed both during or after WGA. However, it should be noted that the absolute UMI coefficients are significantly different between the two procedures. The difference between the two cell types is more consistent with what would be expected for a CD45 target with low expression compared to CK when tagged oligo amplification was performed during WGA.

Example 3

In this example, the tagged oligo was added directly to a single cell. The tagged oligo, “P5-Lib1” (SEQ ID NO: 28), was designed to be amplified by the Ampli1™ WGA kit (Menarini Silicon Biosystems). The tagged oligo amplification primer has the sequence of SEQ ID NO: 29 (the forward and reverse primers are identical and share the sequence of the Ampli1 WGA Lib1 primer). Specifically, the 5'-WGA handle sequence was identical to the Lib1 WGA primer, and the 3'-WGA handle sequence was the reverse complementary sequence of the Lib1 WGA primer. The first amplification handle sequence is identical to that described in Example 1. The second amplification handle sequence consists of a 3'-WGA handle sequence and an additional 5 bp sequence at its 5' end (FIG. 16).

More specifically, Figure 16 shows the design of P5-Synth oligos and corresponding library primers.

Oligo P5-Lib1: white filled boxes with thick borders indicate internal domains with UMI and binder barcodes. Gray filled boxes with thick borders indicate annealing sites for the two library primers. The gray box with a thin border is the WGA handle sequence (Lib1).

P5 library primers: Forward primers used for generation of NGS libraries. Annealing sites with tagged oligo P5-Lib1 in gray filled boxes. Within the short dashed box are the sequencing primer sites; The dashed box is the i5 index used for multiplexing the sequencing reaction; Inside the long dashed box is the index sequencing primer/flow cyto adapter sequence.

Lib1 library primer: Reverse primer used for generation of NGS library. Inside the gray filled box is the annealing site with the tagged oligo P5-Lib1: this sequence consists of a small tail (ACCAC) with part of the Lib1 reverse-complementary sequence, allowing annealing only to the 3' end of the oligo P5-Lib1 make it The short dashed box is the sequencing primer site; The dashed box is the i5 index used for multiplexing the sequencing reaction; Inside the long dashed box is the index sequencing primer/flow cyto adapter sequence.

The forward library primer was identical to the index 2 (i5) adapter (Illumina), whereas the reverse library primer was identical to the index 1 (i7) adapter to which the reverse complementary sequence of the second amplification handle sequence was added ( FIG. 16 ). Thus, during library generation, Illumina index 1 and 2 adapters are added to the 5' and 3' of the tagged oligos, respectively (FIG. 17).

SK-BR-3 cells (ATCC ^® HTB-30™, ATCC) were grown in culture according to the manufacturer's procedure and fixed using PFA 2% according to a customized protocol. Single cells were purified based on morphology using the DEPArray™ NxT system (Menarini Silicon Biosystems). P5-Lib1 and P5-Synth tagged oligos were added directly inside the tube containing single cells. A different amount of each oligo was added to each single cell and Ampli1™ WGA was performed. Samples containing P5-Synth tagged oligos were amplified as in Example 1.

Tagged oligo library generation was performed by taking aliquots of 1 μl WGA containing Ab-oligo amplicons and amplified using the Ampli1™ PCR kit using P5 and Lib1 library primers at a final concentration of 0.5M. PCR thermal cycle profiles are presented in Table 5. Each sample had a different combination of NGS library primers for double indexing to demultiplex data during bioinformatics analysis. A list of library primers used is given in Table 6.

Sequence P5 library primer (5' -> 3') [i5] index number SEQ ID NO: AATGATACGGCGACCACCGAGATCTACAC TATAGCCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT D501 30 AATGATACGGCGACCACCGAGATCTACAC ATAGAGGC ACACTCTTTCCCTACACGACGCTCTTCCGATCT D502 31 AATGATACGGCGACCACCGAGATCTACAC CCTATCCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT D503 32 AATGATACGGCGACCACCGAGATCTACAC GGCTCTGA ACACTCTTTCCCTACACGACGCTCTTCCGATCT D504 33 AATGATACGGCGACCACCGAGATCTACAC AGGCGAAG ACACTCTTTCCCTACACGACGCTCTTCCGATCT D505 34 AATGATACGGCGACCACCGAGATCTACAC TAATCTTA ACACTCTTTCCCTACACGACGCTCTTCCGATCT D506 35 AATGATACGGCGACCACCGAGATCTACAC CAGGACGT ACACTCTTTCCCTACACGACGCTCTTCCGATCT D507 36 AATGATACGGCGACCACCGAGATCTACAC GTACTGAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT D508 37 order lib1 library primer (5' -> 3') [i7] index number SEQ ID NO: CAAGCAGAAGACGGCATACGAGAT CGAGTAAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC GGATTCCTGCT TCAGTACCAC D701 38 CAAGCAGAAGACGGCATACGAGAT TCTCCGGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D702 39 CAAGCAGAAGACGGCATACGAGAT AATGAGCG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D703 40 CAAGCAGAAGACGGCATACGAGAT GGAATCTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D704 41 CAAGCAGAAGACGGCATACGAGAT TTCTGAAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D705 42 CAAGCAGAAGACGGCATACGAGAT ACGAATTC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D706 43 CAAGCAGAAGACGGCATACGAGAT AGCTTCAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D707 44 CAAGCAGAAGACGGCATACGAGAT GCGCATTA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D708 45 CAAGCAGAAGACGGCATACGAGAT CATAGCCG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D709 46 CAAGCAGAAGACGGCATACGAGAT TTCGCGGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D710 47 CAAGCAGAAGACGGCATACGAGAT GCGCGAGA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D711 48 CAAGCAGAAGACGGCATACGAGAT CTATCGCT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGGATTCCTGCT TCAGTACCAC D712 49

Aliquots of 10 μl WGA samples were purified with SPRI beads (Beckmann Coulter) and then processed with the Ampli1™ LowPass kit to generate NGS libraries for CNA analysis. Spiking of tagged oligos in single cells prior to the WGA procedure did not affect downstream genetic analysis ( FIG. 18 ). Tagged oligos designed to fit the workflow shown in FIGS. 5 and 8 did not affect or interfere with the WGA procedure. Moreover, it was still possible to obtain NGS libraries from tagged oligonucleotides in both conditions. Both tagged oligonucleotides can be accurately quantified, indicating the robustness of both methodology and tagged oligo design ( FIG. 19 ).

advantage

The method for whole genome amplification and analysis of multiple target molecules in a biological sample according to the present invention makes it possible to simultaneously obtain genome-wide copy number profile/analysis of genomic sequence and protein expression in the same single cell.

The method of the present invention makes it possible to perform whole-genome amplification of genomic DNA, and enables further analysis such as low-pass sequencing of the desired gene panel or genome-wide copy number profiling by targeted sequencing, and Since it may be the case that only (1 or less) circulating tumor cells (CTCs) are available, it allows the detection and performance of digital quantification of multiple protein panels down to the resolution of single cells using a very small number of samples. This is because differences in genotype, phenotype and environment can be confounding and completely prevent correlation between genotype (copy number of sequence changes) and phenotype (protein expression) of different cells in a genetically heterogeneous sample. It is particularly advantageous over measuring molecular types.

The method according to the invention surprisingly advances the state of the art using capabilities previously thought unachievable by the person skilled in the art in one or more dimensions, given by way of non-limiting example:

· Digital quantification of proteins in single cells up to hundreds of copies per cell.

I believe that by using the unique WGA in this process, the above points are obtained with the possibility of obtaining additional genetic material to investigate other properties of the single cell, and the possibility of reliably reanalyzing the single cell for validation. This is not possible with a droplet-based approach such as that proposed by 10× Genomics.

Although the main field of application of this method is oncology, the method can also be applied to other fields such as dermatology or mosaic disorders such as hyperproliferative phenotypes.

SEQUENCE LISTING <110> MENARINI SILICON BIOSYSTEMS S.P.A. <120> METHOD AND KIT FOR WHOLE GENOME AMPLIFICATION AND ANALYSIS OF TARGET MOLECULES IN A BIOLOGICAL SAMPLE <130> 941-18 <160> 51 <170> BiSSAP 1.3.6 <210> 1 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> P5-Synth <220> <221> misc_feature <222> 20..29 <223> /note="n is g or c or t or a" <400> 1 cacgacgctc ttccgatctn nnnnnnnnnc ggctatgcat tatgcgcca 49 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Tagged oligo first amplification primer (1AH-p) <400> 2 cacgacgctc ttccgatct 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Tagged oligo second amplification primer (2AH-RC-p) <400> 3 tggcgcataa tgcatagccg 20 <210> 4 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> BAB1 example 1 <400> 4 tactcatgct 10 <210> 5 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> BAB2 Example 1 <400> 5 agatagcgca 10 <210> 6 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> BAB3 Example 1 <400> 6 tctctcgctg 10 <210> 7 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> BAB4 Example 1 <400> 7 ctgagtcaga 10 <210> 8 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D501 <400> 8 aatgatacgg cgaccaccga gatctacact atagcctaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 9 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D502 <400> 9 aatgatacgg cgaccaccga gatctacaca tagaggcaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 10 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D503 <400> 10 aatgatacgg cgaccaccga gatctacacc ctatcctaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 11 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D504 <400> 11 aatgatacgg cgaccaccga gatctacacg gctctgaaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 12 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D505 <400> 12 aatgatacgg cgaccaccga gatctacaca ggcgaagaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 13 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D506 <400> 13 aatgatacgg cgaccaccga gatctacact aatcttaaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 14 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D507 <400> 14 aatgatacgg cgaccaccga gatctacacc aggacgtaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 15 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D508 <400> 15 aatgatacgg cgaccaccga gatctacacg tactgacaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 16 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> D701 <400> 16 caagcagaag acggcatacg agatcgagta atgtgactgg agttcagacg tgtgctcttc 60 cgatc 65 <210> 17 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D702 <400> 17 caagcagaag acggcatacg agattctccg gagtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 18 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D703 <400> 18 caagcagaag acggcatacg agataatgag cggtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 19 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D704 <400> 19 caagcagaag acggcatacg agatggaatc tcgtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 20 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D705 <400> 20 caagcagaag acggcatacg agatttctga atgtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 21 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D706 <400> 21 caagcagaag acggcatacg agatacgaat tcgtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 22 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D707 <400> 22 caagcagaag acggcatacg agatagcttc aggtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 23 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D708 <400> 23 caagcagaag acggcatacg agatgcgcat tagtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 24 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D709 <400> 24 caagcagaag acggcatacg agatcatagc cggtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 25 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D710 <400> 25 caagcagaag acggcatacg agatttcgcg gagtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 26 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D711 <400> 26 caagcagaag acggcatacg agatgcgcga gagtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 27 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> D712 <400> 27 caagcagaag acggcatacg agatctatcg ctgtgactgg agttcagacg tgtgctcttc 60 cgatctggcg cataatgcat agccg 85 <210> 28 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> P5-Lib1 <220> <221> misc_feature <222> 41..50 <223> /note="n is c or g or t or a" <400> 28 agtgggattc ctgctgtcag tcacgacgct cttccgatct nnnnnnnnnn gtggtactga 60 cagcaggaat cccact 76 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Tagged oligo extension oligonucleotide with P5-Lib1 <400> 29 agtgggattc ctgctgtcag t 21 <210> 30 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D501 <400> 30 aatgatacgg cgaccaccga gatctacact atagcctaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 31 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D502 <400> 31 aatgatacgg cgaccaccga gatctacaca tagaggcaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 32 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D503 <400> 32 aatgatacgg cgaccaccga gatctacacc ctatcctaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 33 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D504 <400> 33 aatgatacgg cgaccaccga gatctacacg gctctgaaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 34 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D505 <400> 34 aatgatacgg cgaccaccga gatctacaca ggcgaagaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 35 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D506 <400> 35 aatgatacgg cgaccaccga gatctacact aatcttaaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 36 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D507 <400> 36 aatgatacgg cgaccaccga gatctacacc aggacgtaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 37 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> D508 <400> 37 aatgatacgg cgaccaccga gatctacacg tactgacaca ctctttccct acacgacgct 60 cttccgatct 70 <210> 38 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D701 <400> 38 caagcagaag acggcatacg agatcgagta atgtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 39 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D702 <400> 39 caagcagaag acggcatacg agattctccg gagtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 40 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D703 <400> 40 caagcagaag acggcatacg agataatgag cggtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 41 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D704 <400> 41 caagcagaag acggcatacg agatggaatc tcgtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 42 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D705 <400> 42 caagcagaag acggcatacg agatttctga atgtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 43 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D706 <400> 43 caagcagaag acggcatacg agatacgaat tcgtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 44 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D707 <400> 44 caagcagaag acggcatacg agatagcttc aggtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 45 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D708 <400> 45 caagcagaag acggcatacg agatgcgcat tagtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 46 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D709 <400> 46 caagcagaag acggcatacg agatcatagc cggtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 47 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D710 <400> 47 caagcagaag acggcatacg agatttcgcg gagtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 48 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D711 <400> 48 caagcagaag acggcatacg agatgcgcga gagtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 49 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> D712 <400> 49 caagcagaag acggcatacg agatctatcg ctgtgactgg agttcagacg tgtgctcttc 60 cgatcggatt cctgcttcag taccac 86 <210> 50 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> with hairpin <220> <221> misc_feature <222> 20..29 <223> /note="n = a or t or g or c" <400> 50 cacgacgctc ttccgatctn nnnnnnnnnt actcatgcta gatcggaaga gcacacgtc 59 <210> 51 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> without hairpin <220> <221> misc_feature <222> 20..29 <223> /note="n = a or t or g or c" <400> 51 cacgacgctc ttccgatctn nnnnnnnnnt tactcatgct ggctatgcat tatgcgcca 59

Claims (24)

A method for whole genome amplification and analysis of multiple target molecules in a biological sample comprising genomic DNA and a target molecule, the method comprising:
a) providing a biological sample;
b) contacting the biological sample with at least one binding agent directed to at least one of a target molecule conjugated to a tagged oligonucleotide, wherein the tagged oligonucleotide is
i) a payload sequence (PL) of a nucleic acid comprising a binder barcode sequence (BAB) and a unique molecular identifier sequence (UMI), and
ii) at least one first tagged oligonucleotide amplification sequence of a nucleic acid (5-TOS)
comprising;
Accordingly, when the at least one target molecule is present in the biological sample, the at least one binding agent binds to the at least one target molecule;
c) performing a separation step to selectively remove unbound binder, thereby obtaining a labeled biological sample;
d) for a labeled biological sample,
- i) deterministic restriction site whole genome amplification (DRS-WGA), or
ii) Multiple Annealing and Looping Based Amplification Cycle Whole Genome Amplification (MALBAC)
whole genome amplification of the genomic DNA by
- amplification of tagged oligonucleotides conjugated with at least one binding agent
As a step of performing,
Whole genome amplification and amplification of the tagged oligonucleotide are performed simultaneously;
e) preparing a massively parallel sequencing library from the amplified tagged oligonucleotides;
f) sequencing the massively parallel sequencing library;
g) retrieving the sequence of the binder barcode sequence (BAB) and the unique molecular identifier sequence (UMI) from each sequencing read;
h) counting the number of different unique molecular identifier sequences (UMIs) for each binding agent;
A method comprising The method of claim 1 , wherein the tagged oligonucleotide further comprises at least one second tagged oligonucleotide amplification sequence (3-TOS). 3. The method of claim 1 or 2, wherein the unique molecular identifier sequence (UMI) is a degenerate or semi-degenerate sequence in the range of 10 to 30 nucleotides. 4. The method of any one of claims 1 to 3, wherein the method further comprises isolating a single cell from the biological sample. 5. The method of claim 4, wherein the isolating step is performed by selecting the cells. 5. The method of claim 4, wherein the isolating step is performed by dividing the cells into droplets. 7. The method according to any one of claims 4 to 6, wherein the isolating step is carried out after step c) and before step d). 8. The method according to any one of claims 1 to 7, further comprising purifying the massively parallel sequencing library prior to step f). 9. The method of any one of claims 1 to 8, wherein the at least one binder is
a) an antibody or fragment thereof;
b) an aptamer;
c) small molecules;
d) peptides and
e) protein
selected from the group consisting of 10. The method of any one of claims 1 to 9, wherein the target molecule is
a) protein;
b) a peptide;
c) glycoproteins;
d) carbohydrates;
e) lipids and
f) combinations of these
selected from the group consisting of 11. The method according to any one of claims 2 to 10,
wherein the tagged oligonucleotide is at least 5' to 3'
a) a first tagged oligonucleotide amplification sequence of a nucleic acid (5-TOS) comprising, in turn, a 5' whole genome amplification handle sequence (5-WGAH) and a first amplification handle sequence (1AH);
b) a payload sequence (PL);
c) a second tagged oligonucleotide amplification sequence of a nucleic acid (3-TOS) comprising, in turn, a second amplification handle sequence of the nucleic acid (2AH) and a 3' whole genome amplification handle sequence (3-WGAH)
A method comprising 12. The method according to any one of claims 1 to 11, wherein the whole genome amplification and amplification of the tagged oligo are performed using a single primer. 11. The method according to any one of claims 1 to 10,
wherein the tagged oligonucleotide is at least 5' to 3'
a) a first tagged oligonucleotide amplification sequence of a nucleic acid (5-TOS) comprising, in turn, a 5' whole genome amplification handle sequence (5-WGAH) and a first amplification handle sequence (1AH);
b) a payload sequence (PL);
c) optionally an annealing sequence (AS)
comprising;
wherein at least one primer is used for whole genome amplification and amplification of the tagged oligonucleotide, and at least one oligonucleotide (Ep) is used for extension of the tagged oligonucleotide,
said at least one oligonucleotide (Ep) is at least 5' to 3'
d) 5' whole genome amplification handle sequence (5-WGAH);
e) a spacer sequence (SS);
f) a second amplification handle sequence (2AH); and
g) a sequence that is reverse complementary to an annealing sequence (AS-RC) or a sequence reverse complementary to a binder barcode sequence (BAB-RC)
A method comprising 11. The method according to any one of claims 1 to 10,
wherein the tagged oligonucleotide is at least 5' to 3'
a) a first tagged oligonucleotide amplification sequence (5-TOS) of a nucleic acid corresponding to a first amplification handle sequence (1AH);
b) a payload sequence (PL);
c) a second tagged oligonucleotide amplification sequence (3-TOS) of a nucleic acid corresponding to a second amplification handle sequence (2AH)
comprising;
wherein at least one first primer is used for whole genome amplification and at least one second and one third primer is used for amplification of the tagged oligonucleotide;
wherein the at least one second primer has a sequence identical to the first amplification handle sequence (1AH) and the at least one third primer has a sequence that is reverse complementary to the second amplification handle sequence (2AH-RC). 15. The method of claim 14, wherein the at least one second primer and at least one third primer are added in step d). 16. The method according to any one of claims 11 to 15, wherein step e) of preparing a massively parallel sequencing library from the amplified tagged oligonucleotides comprises generating a 3' sequence corresponding to the first amplification handle sequence (1AH). in a PCR reaction using at least one first library primer comprising at least one first library primer, and at least one second library primer comprising a 3′ sequence corresponding to a sequence reverse complementary to a second amplification handle sequence (2AH-RC). carried out by the method. 17. A kit for carrying out the method of any one of claims 1 to 16, comprising:
a) at least one binding agent directed to at least one target molecule in a biological sample conjugated with a tagged oligonucleotide, said tagged oligonucleotide comprising:
i) a payload sequence (PL) of a nucleic acid comprising a binder barcode sequence (BAB) and a unique molecular identifier sequence (UMI);
ii) at least one first tagged oligonucleotide amplification sequence (5-TOS)
at least one binder comprising;
b) at least one primer for carrying out whole genome amplification and at least one primer for carrying out amplification of a tagged oligonucleotide, wherein at least one primer for carrying out said whole genome amplification and amplification of said tagged oligonucleotide at least one primer for carrying out the at least one primer having the same sequence or having a different sequence
comprising, a kit. 21. The kit of claim 20, further comprising an oligonucleotide for extending the tagged oligonucleotide. 19. The method according to claim 17 or 18, wherein said at least one tagged oligonucleotide has a sequence corresponding to SEQ ID NO: 1, and there are two primers for carrying out amplification of said tagged oligonucleotide, SEQ ID NO: 2 and SEQ ID NO: 2, respectively. A kit having the sequence of number 3. 20. The kit according to any one of claims 17 to 19, further comprising one or more first library primer(s) and one or more second library primer(s). 21. The group of claim 20, wherein the first library primer(s) has a sequence selected from the group consisting of SEQ ID NO: 8 to SEQ ID NO: 15, and the second library primer(s) has a sequence selected from the group consisting of SEQ ID NO: 16 to SEQ ID NO: 27 A kit having a sequence selected from 19. The method according to claim 17 or 18, wherein the at least one tagged oligonucleotide has a sequence corresponding to SEQ ID NO: 28, and the primers for carrying out amplification of the tagged oligonucleotide have a sequence corresponding to SEQ ID NO: 29 having, kit. 23. The kit of claim 22, further comprising one or more first library primer(s) and one or more second library primer(s). 24. The group of claim 23, wherein said first library primer(s) has a sequence selected from the group consisting of SEQ ID NO: 30 to SEQ ID NO: 37, and said second library primer(s) has a sequence selected from the group consisting of SEQ ID NO: 38 to SEQ ID NO: 49 A kit having a sequence selected from

Images