CN101565753A - Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof - Google Patents
Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof Download PDFInfo
- Publication number
- CN101565753A CN101565753A CNA2009101383274A CN200910138327A CN101565753A CN 101565753 A CN101565753 A CN 101565753A CN A2009101383274 A CNA2009101383274 A CN A2009101383274A CN 200910138327 A CN200910138327 A CN 200910138327A CN 101565753 A CN101565753 A CN 101565753A
- Authority
- CN
- China
- Prior art keywords
- reaction
- liquid
- diagnostic kit
- sample
- staphylococcus aureus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and a detecting method thereof. The diagnostic kit is composed of two pairs of primers, DNA polyase, a reaction solution, a sample pretreating solution, a developing solution and a masculine contrast solution which are respectively installed in a container. The rapid diagnostic kit for gene according to the invention can determine the existence of target substance according to whether amplification exists through applying six sections and four primers, and therefore has high specificity. The rapid diagnostic kit for gene according to the invention has the advantages of high speed, high activity, high sensitiveness, capacity for executing the amplification reaction with only one constant temperature, no requirement of specific agent or device, and low detecting cost. The determination of the rapid diagnostic kit for gene according to the invention is convenient. The pyrophosphoric acid group ions precipitated from the dNTP are combined with the Mg<2+> in the reaction solution. The subsidiary product of magnesium pyrophosphate precipitate is generated and can be observed and determined visually. Furthermore after the developing solution is added, the difference of developing color between the negative result and the positive result is remarkable, and is more evident and reliable.
Description
Technical field
The present invention relates to biological detection reagent, be specifically related to a kind of rapid diagnosis kit for staphylococcus aureus gene and detection method thereof.
Background technology
At present streptococcus aureus there is multiple detection method, from being accredited as main national standard (GB/T4789.7-2003) with pathogenic micro-organism isolation identification, morphology evaluation and automatic biochemical, immunology detection technology, nucleic acid probe, polymerase chain reaction (PCR) technology equimolecular biological detection method [food safety detection and modern biotechnology to differential protein, Chemical Industry Press, 2004].Wherein the cause of disease detection of nucleic acids all improves a lot at aspects such as rapidity, security, accuracy and susceptibilitys, these new technologies are attempted to break through microbiologies such as traditional morphology, biochemical reaction and are detected old model, do not need microorganism is separated purification, and directly its gene and gene product are carried out rapid detection with the enrichment liquid of sample or sample, and combine with Protocols in Molecular Biology and information biology means, to accurately, fast, the direction of sensitivity and automatization develops.
With polymerase chain reaction (PCR) technology is that the cause of disease nucleic acid detection technique of representative also exists some problems in actual applications, as the special instrument of common polymerase chain reaction (PCR) Technology Need, and there are easy crossed contamination and the loaded down with trivial details shortcoming of operating process.And fluorescence real-time quantitative polymerase chain reaction (real time PCR) though technology has solved the problem of crossed contamination preferably, and has simplified operating process, needs more complicated quantitative assay instrument, therefore is not suitable for field quick detection.And the cost of fluorescent probe is higher in the real-time quantitative polymerase chain reaction PCR technology, has strengthened the difficulty of applying.The immunology detection technology is fast and convenient with low cost, but requires the monoclonal antibody of high quality high stability, otherwise because of accuracy is not enough, can only be the auxiliary detection means at present.So in time use the newest fruits of biotech development significant to satisfying improving constantly of pathogenic micro-organism detection requirement.Wherein isothermal duplication (Isothermal Amplification) nucleic acid Fast Detection Technique is the rapid progress on the cause of disease nucleic acid detection technique, the loop-mediated isothermal amplification technique of now having set up (loop-mediated isothermal amplication of DNA, be called for short LAMP) have a lot of superiority, and do not see that useful loop-mediated isothermal amplification technique detects the gene quick diagnosis kit of streptococcus aureus at present yet.
Summary of the invention
The objective of the invention is deficiency, a kind of rapid diagnosis kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technique that cost is low, easy to use, detection speed is fast, specificity is high that detects is provided at the prior art existence.
Another object of the present invention provides the detection method of above-mentioned rapid diagnosis kit for staphylococcus aureus gene.
Above-mentioned purpose of the present invention is achieved by following technical solution:
One, rapid diagnosis kit for staphylococcus aureus gene of the present invention, form by two pairs of primers, Bst archaeal dna polymerase, reaction solution, stable liquid, sample pretreatment liquid, colour developing liquid and positive control solution, more than six kinds of liquid place container respectively, wherein:
Described two pairs of primers are:
Outer primer F3:TTTTCATAATCRATCACTGGAC is shown in SEQ ID NO:1;
Outer primer B3:TTTAACAGCTAAAGAGTTTGGT is shown in SEQ ID NO:2;
Inner primer FIP:ACAATAATAACGAGGTYATTGCAGCTTTTCTTG
AACACTTTCATAACAGGTAC is shown in SEQ ID NO:3;
Inner primer BIP:CCTTCAGCAAGCTTTAACTCATAGTTTTTCAGATAGCATGCCATACAGTC is shown in SEQ ID NO:4;
Above-mentioned reaction solution contains 1.6～2mmol/L dNTP, 20～25mmol/L Tris-HCl, 10～12.5mmol/L Repone K, 10～12.5mmol/L ammonium sulfate, 8～10mmol/L sal epsom, 0.1～0.125%TritonX-100,0.8～1mol/L trimethyl-glycine, each 1.6～2mol/L of inner primer FIP/BIP and each 0.2～0.25mol/L of outer primer F3/B3.Preferred ratio is that reaction solution contains 2mmol/LdNTP, 25mmol/L Tris-HCl, 12.5mmol/L Repone K, 12.5mmol/L ammonium sulfate, 10mmol/L sal epsom, 0.125%TritonX-100,1mol/L trimethyl-glycine, each 2mol/L of inner primer FIP/BIP and each 0.25mol/L of outer primer F3/B3.(0.1～0.125%TritonX-100 is meant: the volume percent that Triton X-100 accounts for sample pretreatment liquid is 0.1～0.125%)
Above-mentioned sample pretreatment liquid contains Tris-HCl, 1～2mmol/L EDTA and the 1～1.2%Triton X-100 of 10～20mmol/L pH 8.0.Preferred ratio is that sample pretreatment liquid contains 20mmol/L Tris-HCl (pH 8.0), 2mmol/L EDTA and 1.2%Triton X-100.(1～1.2%Triton X-100 is: the volume percent that Triton X-100 accounts for sample pretreatment liquid is 1～1.2%)
Above-mentioned colour developing liquid is preferably fluorescence dye SYBR Green I;
Aforementioned stable liquid is preferably paraffin oil.
Above-mentioned positive control is staphylococcus aureus gene group DNA.
Two, the production technique of gene quick diagnosis kit of the present invention
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, reaction solution is aseptic subpackaged, and determine the quality inspection of sampling with carrying out concentration according to experiment;
3, stable liquid is aseptic subpackaged, the sampling quality inspection;
4, with the positive control sample preparations, packing, sampling quality inspection;
5, assembling test kit.
Three, the detection method of gene quick diagnosis kit of the present invention
1, sample preparation
Testing sample is centrifugal in centrifuge tube, remove supernatant, add sample pretreatment liquid in the precipitation and mix, cooled on ice after the boiling water bath deactivation, behind the high speed centrifugation, supernatant is stand-by sample template DNA;
2, loop-mediated isothermal amplification technique reaction process
In reaction tubes, add reaction solution 38～40 volume %, big fragment 0.9～1.8 volume % of Bst archaeal dna polymerase, stable liquid 52～54.5 volume %, sample template DNA 4.5～9 volume %, 63～65 ℃ of isothermal reaction 45～90min.Described volume percent is meant the volume percent that accounts for four component cumulative volumes.
3, post-reaction treatment
In above-mentioned reaction tubes and positive controls, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative.
Principle of the present invention is the special inside and outside primer (being inner primer FIP/BIP and outer primer F3/B3) of two couples that utilizes the Bst archaeal dna polymerase and design according to target-gene sequence, six isolated areas on the specific recognition target sequence, start the endless chain replacement(metathesis)reaction, start complementary strand in target DNA district synthetic, and result's complementary sequence on same chain goes round and begins again and is formed with the very stem of polycyclic Cauliflower structure-circular DNA mixture.In the LAMP reaction process, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product---magnesium pyrophosphate milky white precipitate, can be by the visual inspection result of determination.The LAMP reaction is to finish in 45～90 minutes under constant temperature (63～65 ℃) condition.This comparatively gentle temperature condition and do not have temperature cycle that required instrument is oversimplified, overcome conventional P CR inherent detection time long, pollute easily and detect shortcoming such as cost height.In addition, this detection method is lower to testing staff's technical quality requirement, and actually operating is very easy, does not need special reagent and plant and instrument, helps setting up rapid screening system with low cost.The LAMP method is a kind of gene amplification method of easy, quick, high degree of specificity.Constant temperature gene amplification technology and round pcr (comprising the fluorescence real-time quantitative PCR technology) are compared, can find that this technology is equivalent to or is better than round pcr on methodology indexs such as sensitivity, specificity and sensing range, and do not rely on any special plant and instrument and can realize on-the-spot high-throughput rapid detection, and detect cost far below fluorescent quantitative PCR technique.Domestic do not have the test kit of this respect to sell at present as yet.At present in the national standard with microorganism separation and Culture and morphology be accredited as main, in conjunction with the passing method that biochemical analysis and serological typing are identified, preliminary evaluation needs 2～3 days, finishes probation report and needs 10～15 days; Adopt gene quick diagnosis kit of the present invention only to need 2 hours.And, having added colour developing liquid in the reaction solution of the present invention, qualification result is more visual and clear.
Compared with prior art, the present invention has following beneficial effect:
1. gene quick diagnosis kit of the present invention only needs just energy amplified reaction of a steady temperature, does not need special reagent and equipment, and it is low to detect cost; 2. gene quick diagnosis kit of the present invention is used six sections, four primers, and whether the existence that just can judge target substance according to whether increasing to be, so has high specific; 3. gene quick diagnosis kit of the present invention amplification fast and efficient can be finished amplification less than 1 hour, and the productive rate height; 4. gene quick diagnosis kit of the present invention is highly sensitive, and amplification template only needs 100 copies or still less; 5. gene quick diagnosis kit of the present invention is identified easy, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln
2+In conjunction with, produce by product-magnesium pyrophosphate precipitation, can identify by visual inspection, and after adding colour developing liquid, yin and yang attribute colour development difference as a result is remarkable, checking rate height, more obviously reliable.
Description of drawings
Fig. 1 is 22 strain bacterium and DNA of bacteria mixed solution LAMP figure as a result;
Among Fig. 1,1 positive contrast, 2 negative contrasts, 3～19 is non-streptococcus aureus, and 20-23 is the streptococcus aureus clinical separation strain, and 24 is ATCC6538, and 25 are the DNA of bacteria mixing.
Fig. 2 is the different weaker concn LAMP of a streptococcus aureus detected result;
Among Fig. 2, the positive contrast of P, the negative contrast of N, 0 is bacterium stoste, 1～10 is respectively 10
1～10
10Extension rate.
Fig. 3 is the different extension rate LAMP of a streptococcus aureus detected result;
Among Fig. 3, M is Marker, the positive contrast of P, and the negative contrast of N, 0 is bacterium stoste, 1～10 is respectively 10
1～10
10Extension rate.
Embodiment
The preparation of embodiment 1 test kit
(1) in the following sequence through the synthetic oligomerization picodna primer of dna synthesizer:
Outer primer F3:TTTTCATAATCRATCACTGGAC is shown in SEQ ID NO:1;
Outer primer B3:TTTAACAGCTAAAGAGTTTGGT is shown in SEQ ID NO:2;
Inner primer FIP:ACAATAATAACGAGGTYATTGCAGCTTTTCTTGAACACTTTCATAACAGGTA C is shown in SEQ ID NO:3;
Inner primer BIP:CCTTCAGCAAGCTTTAACTCATAGTTTTTCAGATAGCATGCCATACAGTC is shown in SEQ ID NO:4;
(2) purchase archaeal dna polymerase: Bst DNA polymerase (Large Fragment).Place container.
(3) preparation reaction solution: reaction solution contains 2mmol/LdNTP, 25mmol/L Tris-Cl, 12.5mmol/L Repone K, 12.5mmol/L ammonium sulfate, 10mmol/L sal epsom, 0.125%TritonX-100,1mol/L trimethyl-glycine, each 2mol/L of inner primer FIP/BIP and each 0.25mol/L of outer primer F3/B3, places container.
(4) preparation sample pretreatment liquid: sample pretreatment liquid contains 20mmol/L Tris-HCl (pH 8.0), 2mmol/L EDTA and 1.2%Triton X-100, places container.
(5) purchase stable liquid: paraffin oil places container;
(6) purchase colour developing liquid: SYBR Green I places container.
(7) extract positive control: staphylococcus aureus gene group DNA places container.
(8) above-mentioned 7 containers are dressed up test kit, encapsulation.
Preparation technology is summarized as follows:
1, with behind inner primer FIP/BIP and the outer primer F3/B3 synthesizing and purifying, quantitatively preparation, concentration detects, the sampling quality inspection;
2, reaction solution is aseptic subpackaged, and determine the quality inspection of sampling with carrying out concentration according to experiment;
3, with the stable liquid packing, the sampling quality inspection;
4, with the positive control sample preparations, packing, sampling quality inspection;
5, assembling test kit.
The preparation of embodiment 2 test kits
The prescription of reaction solution is: reaction solution contains 1.8mmol/L dNTP, 20mmol/L Tris-HCl, 10mmol/L Repone K, 10mmol/L ammonium sulfate, 8mmol/L sal epsom, 0.1%TritonX-100,0.8mol/L trimethyl-glycine, each 1.6mol/L of inner primer FIP/BIP and each 0.2mol/L of outer primer F3/B3;
The prescription of sample pretreatment liquid is: sample pretreatment liquid contains Tris-HCl, 1mmol/L EDTA and the 1%Triton X-100 of 10mmol/L pH 8.0.
Other are with embodiment 1.
The application of embodiment 3 rapid diagnosis kit for staphylococcus aureus gene
1 materials and methods
1.1 material
1.1.1 bacterial strain
There are 22 strains in our company with bacterial strain, be mainly derived from the biological product of USS collecting center,
Nat'l Pharmaceutical ﹠ Biological Products Control Institute and clinical separation.See table 1 for details.
Table 1 strain name and source
| Bacterium source | Bacterial strain and numbering |
| The biological product collecting center (ATCC) of USS | Streptococcus aureus (6538), Salmonellas (14028,13076,13311), listeria bacteria (7466,25401); |
| Medical microbial culture presevation administrative center (CMCC) | Salmonellas (50115); |
| Clinical separation strain | Streptococcus aureus, Vibrio parahaemolyticus, Shigellae, yersinia entero-colitica, hog cholera sramana, Salmonella enteritidis, Salmonella typhimurium; |
| Other environment separation strain | Streptococcus aureus, Vibrio parahaemolyticus, Shigellae, yersinia entero-colitica, Salmonellas. |
1.1.2 key instrument and reagent
1.2 the evaluation of isolated strains
1.2.1 the cultivation streptococcus aureus reference culture LB substratum of streptococcus aureus, was cultivated 18-24 hour by 37 ℃.Isolated single bacterium colony in 24 hours in the dull and stereotyped 25 ℃ of cultivations of ordinary nutrient agar.
1.2.2 after the isolation identification clinical separation strain of clinical separation strain increases bacterium,, choose suspicious single bacterium colony and make biochemical identification respectively at isolating single bacterium colony on the corresponding screening flat board.
1.3 sample preparation
(1) gets 1ml enrichment liquid 10000rpm centrifugal 2 minutes, remove most supernatant, obtain bacterial sediment; If flat-plate bacterial colony, then direct picking list bacterium colony is rinsed in nucleic acid extraction liquid and is washed;
(2) in above-mentioned bacterial sediment, add 80 μ L nucleic acid extraction liquid and mix, boil in the boiling water after 20 minutes and placed cooled on ice immediately 10 minutes, centrifugal 2 minutes of 10000rpm, supernatant is the sample template DNA.
1.4 the reaction process of loop-mediated isothermal amplification technique
(1) in 200 μ L reaction tubess preparation reaction system: reaction solution 22 μ L, Bst archaeal dna polymerase 0.5 μ L (4U), stable liquid 30 μ L, template DNA 2.5 μ L.
(2) with the reaction tubes for preparing in 65 ℃ of isothermal reactions 1 hour.
1.5 post-reaction treatment
Add 2 μ L SYBR Green I in above-mentioned reaction product, mixing is if the same shows green with the positive control pipe of reaction tubes is then positive, if reaction tubes manifests orange then negative.
1.6 electrophoresis
Prepare 0.1% sepharose, directly the reaction product that adds after developing the color is carried out gel electrophoresis.
1.7 specificity test
1.7.1 pure bacterial strain LAMP detects and with the LAMP method 22 strain bacteriums increased, according to the color reaction observations, green is positive, and orange feminine gender is verified the specificity of this method.
1.7.2 the several bacterial strains hybrid dna detects and with LAMP several bacterium DNA equal-volume mixed solutions such as streptococcus aureus and Vibrio parahaemolyticus, Shigellae, yersinia entero-colitica, Salmonella choleraesuls, Salmonella enteritidis, Salmonella typhimurium to be got 2.5 μ L and make LAMP and detect.
1.8 sensitivity test is inoculated in the ATCC6538 bacterium in the corresponding substratum and cultivates, treats to survey its absorbancy when muddiness appears in liquid nutrient medium, and when absorbance is between 0.35-0.45, the physiological saline gradient dilution with 0.85%.Ten times of each dilutions make 10
-1-10
-10A series of dilution bacterium liquid.Adopt 10
-6, 10
-7, 10
-8, extent of dilution carries out plate count, each extent of dilution is made 3 flat boards respectively, cultivates 24h, gets the flat board of colony number between 30～300 and make plate count for 37 ℃, the mean of the colony number of 3 flat boards of this concentration level is calculated bacterial concentration, is bacterium colony mean number * extension rate * 10; Simultaneously, each concentration level is got 1mL, extracts DNA, makes LAMP and detects.
1.9 test of replica test specificity and sensitivity test repeat respectively 2 times.
2 results
2.1 the foundation of streptococcus aureus LAMP detection method
2.2 the specificity test ATCC6538 detected result positive, the clinical SEPARATION OF GOLD staphylococcus aureus of the 4 strains detected result positive, the non-streptococcus aureus of 17 strains is all negative, several DNA of bacteria mixed solutions such as streptococcus aureus and Vibrio parahaemolyticus, Shigellae, yersinia entero-colitica, hog cholera sramana, Salmonella enteritidis, Salmonella typhimurium are positive, as Fig. 1.High specificity is described.
2.3 sensitivity test through the bacterium colony plate count, selects the 6th, 7,8 extension rate to carry out reading, calculates to such an extent that the LAMP method is minimum detects 3.7 * 10
4Cfu/mL.As Fig. 2,3.
2.4 the test of replica test specificity repeats twice, as a result unanimity.Sensitivity test repeats twice, as a result unanimity.
Rapid diagnosis kit for staphylococcus aureus gene and detection method sequence table thereof based on loop-mediated isothermal amplification technique
SEQUENCE?LISTING
＜110〉Guangzhou Huafeng Biotech Co., Ltd.
＜120〉based on the rapid diagnosis kit for staphylococcus aureus gene and the detection method thereof of loop-mediated isothermal amplification technique
<130>
<160>4
<170>Patent?In?version?3.2
<210>1
<211>22
<212>DNA
＜213〉artificial sequence
<400>1
Outer primer F3:TTTTCATAATCRATCACTGGAC
<210>2
<211>22
<212>DNA
＜213〉artificial sequence
<400>2
Outer primer B3:TTTAACAGCTAAAGAGTTTGGT
<210>3
<211>53
<212>DNA
＜213〉artificial sequence
<400>3
Inner primer FIP:ACAATAATAACGAGGTYATTGCAGCTTTTCTTGAACACTTTCATAACAGGTA C
<210>4
<211>50
<212>DNA
＜213〉artificial sequence
<400>4
Inner primer BIP:CCTTCAGCAAGCTTTAACTCATAGTTTTTCAGATAGCATGCCATACAGTC
Claims (7)
1, a kind of rapid diagnosis kit for staphylococcus aureus gene is characterized in that being made up of two pairs of primers, Bst archaeal dna polymerase, reaction solution, stable liquid, sample pretreatment liquid, colour developing liquid and positive control solution, more than seven kinds of liquid place container respectively,
Above-mentioned two pairs of primers are:
Outer primer F3:TTTTCATAATCRATCACTGGAC;
Outer primer B3:TTTAACAGCTAAAGAGTTTGGT;
Inner primer FIP:ACAATAATAACGAGGTYATTGCAGCTTTTCTTGAACACTTTCATAACAGGTA C;
Inner primer BIP:CCTTCAGCAAGCTTTAACTCATAGTTTTTCAGATAGCATGCCATACAGTC;
Above-mentioned reaction solution contains 1.6～2mmol/L dNTP, 20～25mmol/L Tris-HCl, 10～12.5mmol/L Repone K, 10～12.5mmol/L ammonium sulfate, 8～10mmol/L sal epsom, 0.1～0.125%TritonX-100,0.8～1mol/L trimethyl-glycine, each 1.6～2mol/L of inner primer FIP/BIP and each 0.2～0.25mol/L of outer primer F3/B3;
Above-mentioned sample pretreatment liquid contains Tris-HCl, 1～2mmol/L EDTA and the 1～1.2%Triton X-100 of 10～20mmol/L pH 8.0.
Above-mentioned positive control is staphylococcus aureus gene group DNA.
2,, it is characterized in that described colour developing liquid is SYBRGreen I according to the described test kit of claim 1.
3,, it is characterized in that described sample pretreatment liquid contains the Tris-HCl of 20mmol/L pH 8.0,2mmol/L EDTA and 1.2%Triton X-100 according to the described test kit of claim 1.
4,, it is characterized in that described reaction solution contains 2mmol/L dNTP, 25mmol/L Tris-HCl, 12.5mmol/L Repone K, 12.5mmol/L ammonium sulfate, 10mmol/L sal epsom, 0.125%TritonX-100,1mol/L trimethyl-glycine, each 2mol/L of inner primer FIP/BIP and each 0.25mol/L of outer primer F3/B3 according to the described test kit of claim 1.
5, a kind of method that detects streptococcus aureus is characterized in that using the described test kit of claim 1, follows these steps to carry out:
(1) testing sample is centrifugal in centrifuge tube, remove supernatant, add sample pretreatment liquid in the precipitation and mix, cooled on ice after the boiling water bath deactivation, behind the high speed centrifugation, supernatant is stand-by sample template DNA;
(2) in reaction tubes, add reaction solution 38～40 volume %, big fragment 0.9～1.8 volume % of Bst archaeal dna polymerase, stable liquid 52～54.5 volume %, sample template DNA 4.5～9 volume %, isothermal reaction;
(3) in above-mentioned reaction tubes and positive controls, add colour developing liquid respectively, mixing, the sample sets colour developing is identical with control group then positive, otherwise negative.
6,, it is characterized in that in the step (2) that the reaction conditions of isothermal reaction is 63～65 ℃ of temperature, reaction times 45～90min according to the described detection method of claim 5.
7,, it is characterized in that described stable liquid is paraffin oil according to the described detection method of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009101383274A CN101565753B (en) | 2008-04-29 | 2009-04-28 | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810027760.6 | 2008-04-29 | ||
| CNA2008100277606A CN101307356A (en) | 2008-04-29 | 2008-04-29 | Rapid diagnosis kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof |
| CN2009101383274A CN101565753B (en) | 2008-04-29 | 2009-04-28 | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101565753A true CN101565753A (en) | 2009-10-28 |
| CN101565753B CN101565753B (en) | 2012-07-18 |
Family
ID=40124034
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100277606A Pending CN101307356A (en) | 2008-04-29 | 2008-04-29 | Rapid diagnosis kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof |
| CN2009101383274A Active CN101565753B (en) | 2008-04-29 | 2009-04-28 | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100277606A Pending CN101307356A (en) | 2008-04-29 | 2008-04-29 | Rapid diagnosis kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN101307356A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101979660A (en) * | 2010-11-16 | 2011-02-23 | 广州华峰生物科技有限公司 | Brucella detection kit and using method thereof |
| CN102719548A (en) * | 2010-11-16 | 2012-10-10 | 广州华峰生物科技有限公司 | Kit for detecting brucella and use method thereof |
| CN101824468B (en) * | 2009-12-31 | 2012-10-10 | 广州华峰生物科技有限公司 | Primer group for detecting Yersinia pestis, rapid diagnosis kit and detection method |
| CN105861702A (en) * | 2016-05-16 | 2016-08-17 | 昆明理工大学 | Specific gene of staphylococcus aureus and loop-mediated isothermal amplification kit |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107034266A (en) * | 2016-01-29 | 2017-08-11 | 清华大学 | For detecting that the primer of wound infection pathogen is combined and integrating device |
| CN110819736A (en) * | 2019-09-02 | 2020-02-21 | 深圳芭卡生物科技有限公司 | Primer and kit for detecting infection of three common pathogens of dog and application of primer and kit |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100560735C (en) * | 2005-07-21 | 2009-11-18 | 崔玉东 | A kind of pathogenic bacteria multiple PCR detection kit and detection method thereof |
| CN101307056B (en) * | 2007-05-16 | 2011-04-27 | 中国科学院上海药物研究所 | Linear furocoumarin derivates, preparation method and application thereof, pharmaceutical compositions containing the derivates |
| CN101153329B (en) * | 2007-09-21 | 2010-11-03 | 珠海市疾病预防控制中心 | Primer, detection method and detection reagent kit for detecting staphylococcus aureus |
-
2008
- 2008-04-29 CN CNA2008100277606A patent/CN101307356A/en active Pending
-
2009
- 2009-04-28 CN CN2009101383274A patent/CN101565753B/en active Active
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824468B (en) * | 2009-12-31 | 2012-10-10 | 广州华峰生物科技有限公司 | Primer group for detecting Yersinia pestis, rapid diagnosis kit and detection method |
| CN101979660A (en) * | 2010-11-16 | 2011-02-23 | 广州华峰生物科技有限公司 | Brucella detection kit and using method thereof |
| CN102719548A (en) * | 2010-11-16 | 2012-10-10 | 广州华峰生物科技有限公司 | Kit for detecting brucella and use method thereof |
| CN102719548B (en) * | 2010-11-16 | 2014-01-15 | 广州华峰生物科技有限公司 | Kit for detecting brucella and use method thereof |
| CN105861702A (en) * | 2016-05-16 | 2016-08-17 | 昆明理工大学 | Specific gene of staphylococcus aureus and loop-mediated isothermal amplification kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101565753B (en) | 2012-07-18 |
| CN101307356A (en) | 2008-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101570795B (en) | Mycobacterium tuberculosis gene rapid diagnostic primer based on loop-mediated isothermal amplification technology and use in preparing rapid diagnostic kit | |
| CN101892300B (en) | Klebsiella pneumoniae detection kit and use method thereof | |
| CN101654706B (en) | Rapid diagnostic reagent kit of legionella pneumophilia genes based on loop-mediated isothermal amplification technique and detecting method thereof | |
| CN101565753B (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN101660005A (en) | Rapid diagnostic kit based on loop-mediated isothermal amplification technique for hepatitis A virus genes and detection method thereof | |
| CN102094090B (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN101008036A (en) | Shigella gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology | |
| CN101935693A (en) | Mycobacterium tuberculosis detection kit and use method thereof | |
| CN101942508B (en) | Escherichia coli detection kit and use method thereof | |
| CN101008039A (en) | EB virus gene quick diagnosis kit based on loop-mediated equal-temperature amplification technology | |
| CN101864483B (en) | Salmonella and shigella joint detection kit and detection method thereof | |
| CN101555529B (en) | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof | |
| CN106544444A (en) | The dry powdered LAMP quick detection kits of streptococcus fecalis and its using method | |
| CN101403001B (en) | Rapid diagnosis reagent kit and detection method for pseudomonas aeruginosa gene | |
| CN101368204B (en) | Fast detection primer and reagent kit for enterobacter sakazakii hymenial veil mediated isothermality amplification technique | |
| CN101824468A (en) | Primer group for detecting Yersinia pestis, rapid diagnosis kit and detection method | |
| CN101979660B (en) | Brucella detection kit and using method thereof | |
| CN102719548B (en) | Kit for detecting brucella and use method thereof | |
| CN102251044A (en) | Enterorrhagia colibacillus stx1 gene detection kit and application method thereof | |
| CN101892299B (en) | Clostridium perfringen detection kit and user method thereof | |
| CN102286620A (en) | Enterohemorrhagic E. coli stx2 gene detection kit and using method thereof | |
| AU2021100496A4 (en) | A fast qualitative and quantitative kit for microorganisms and a fast qualitative and quantitative method | |
| CN101824482B (en) | Detection kit for vibrio cholerae O1 group and detection method thereof | |
| CN102146470B (en) | Bacillus anthracis detection kit and using method of kit | |
| CN101403005B (en) | Rapid diagnosis reagent kit and detection method for cholera vibrio gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |