CN106755550B - PCR detection method for vibrio alginolyticus in aquaculture animal - Google Patents
PCR detection method for vibrio alginolyticus in aquaculture animal Download PDFInfo
- Publication number
- CN106755550B CN106755550B CN201710157709.6A CN201710157709A CN106755550B CN 106755550 B CN106755550 B CN 106755550B CN 201710157709 A CN201710157709 A CN 201710157709A CN 106755550 B CN106755550 B CN 106755550B
- Authority
- CN
- China
- Prior art keywords
- vibrio alginolyticus
- vibrio
- dna
- pcr
- alginolyticus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a PCR detection method of vibrio alginolyticus in an aquaculture animal. Extracting total DNA of the tissue of the aquaculture animal; performing PCR amplification by using the extracted DNA as a template and vibrio alginolyticus specific primers; the specific primers of the vibrio alginolyticus are specific primers P1 of a topA gene, P2 of a toxR gene and P3 of the toxR gene aiming at a strain vibrio alginolyticus; and judging whether the aquaculture animal is infected by the vibrio alginolyticus according to an agarose gel imaging result of the PCR amplification product. The invention makes the detection of residual vibrio alginolyticus in the aquatic product animal simpler and more convenient, provides necessary theoretical basis and perfect method system for the detection and analysis of residual vibrio alginolyticus in the aquatic product animal in future, and lays a foundation for the detection of aquatic product pathogenic bacteria and food import and export safety in China.
Description
Technical Field
The invention belongs to the field of pathogenic microorganism detection, and particularly relates to a method for detecting common pathogenic bacteria in cultured aquatic animals, which comprises the following steps: PCR detection method of Vibrio alginolyticus (Vibrio algiryliticus).
Background
Vibrio alginolyticus (Vibrio algirylicus) is a gram-negative halophilic Vibrio, has high detection rate in seawater, marine products and food, is one of normal flora in the sea, exists in various marine animals, is a conditional pathogen of marine culture animals such as fishes, shrimps and shellfishes, and causes huge economic loss to aquaculture industry. Vibrio alginolyticus also causes wound infection and septicemia in humans. In recent years, food poisoning and gastroenteritis caused by vibrio alginolyticus are frequently reported, and symptoms are mainly manifested by digestive tract symptoms such as headache, dizziness, hypodynamia, abdominal pain, nausea and the like with different degrees. Therefore, Vibrio alginolyticus has been increasingly regarded as a causative bacterium of diarrhea and a causative bacterium affecting food safety.
At present, the methods for detecting vibrio alginolyticus mainly comprise a bacteria biochemical method, an immunological detection method, a denatured high performance liquid chromatography, a loop-mediated isothermal amplification technology and a molecular biological detection method at home and abroad. However, the method has the problems of complex detection method, poor sensitivity and the like.
Disclosure of Invention
The invention aims to provide a PCR detection method of Vibrio alginolyticus (Vibrio algirolyticus) in aquaculture animals. The method of the invention can rapidly identify the pathogenic source and provide technical support for the safety of aquatic livestock and the safety of import and export of aquatic food in China.
The technical scheme adopted by the invention is as follows: a PCR detection method of vibrio alginolyticus in an aquaculture animal comprises the following steps:
1) extracting total DNA of the tissue of the aquaculture animal;
2) performing PCR amplification by using the extracted DNA as a template and vibrio alginolyticus specific primers; the described algae dissolving
The vibrio specific primer is specific primer P1 for the topA gene and specific primer for the toxR gene of vibrio alginolyticus
Substance P2, primer P3 specific for toxR gene;
the sequence of the specific primer P1 is as follows: P1-F: TCGCTTCATGGACCGTGTC; P1-R: GGCGCTTAGGTTAGTCGAGT.
The sequence of the specific primer P2 is as follows: P2-F: CTGACGTTGAAGAAGCCACTT; P2-R: GGCGTCATCACAGGTACATTTT.
The sequence of the specific primer P3 is as follows: P3-F: CCTAAACGCGGTTATCAACTCA; P3-R: GGCGTCATCACAGGTACATTTT.
And (3) PCR reaction conditions: the first stage is as follows: 5min at 94 ℃;
and a second stage: 30s at 94 ℃, 30s at 60 ℃ or 30s at 69 ℃ and 30s at 72 ℃; 30 cycles;
and a third stage: 5min at 72 ℃;
a fourth stage: storing at 4 ℃.
3) And judging whether the aquaculture animal is infected by the vibrio alginolyticus according to an agarose gel imaging result of the PCR amplification product.
The judgment standard is as follows:
for the specific primer P1, if the agarose gel representation of the PCR amplification product has 484bp bands, the aquaculture animal is infected by Vibrio alginolyticus, otherwise, the aquaculture animal is not infected.
Aiming at the specific primer P2, if the agarose gel of the PCR amplification product shows that a 286bp band is generated, the turbot is infected by vibrio alginolyticus, otherwise, the turbot is not infected.
Aiming at the specific primer P3, if the agarose gel of the PCR amplification product shows that 353bp bands are generated, the sea cucumber is infected by the vibrio alginolyticus, otherwise, the sea cucumber is not infected.
The PCR detection method of the vibrio alginolyticus in the aquaculture animal is characterized in that the aquaculture animal is turbot, sea cucumber, loach, crab, crayfish, freshwater shrimp or salmon.
The invention has the beneficial effects that:
1. the designed specific primer of vibrio alginolyticus can effectively distinguish the vibrio alginolyticus from various common pathogenic strains, and shows strong specificity.
2. The designed specific primer of vibrio alginolyticus has high sensitivity, can effectively detect residual vibrio alginolyticus in the bodies of aquatic product animals, and the minimum detection concentration of the primer can reach 10-5ng/ul。
3. The PCR detection method for residual vibrio alginolyticus in the aquatic product culture animal provided by the invention enables the detection of residual vibrio alginolyticus in the aquatic product culture animal to be simpler and more convenient. In aquaculture animals, once pathogenic bacteria vibrio alginolyticus exist, the rapid identification can be realized, and an effective inspection method is provided for import and export of aquatic products in China.
4. The detection method can effectively detect the high-risk pathogenic bacteria vibrio alginolyticus in the aquatic product culture animal body, and the detection method is proved to have strong specificity and high sensitivity. The establishment of the detection method provides necessary theoretical basis and a perfect method system for the detection and analysis of pathogenic bacteria vibrio alginolyticus remained in aquatic product culture animals in future, not only provides technical support for the food safety of import and export of aquatic products in China, but also makes a contribution to the food safety and healthy development of aquatic products in China.
Drawings
FIG. 1 is a PCR reaction condition optimization of Vibrio alginolyticus specific primer P1 in example 1;
wherein, M is Marker D, 1-5, the annealing temperature is 65 ℃, 66 ℃, 67 ℃, 68 ℃ and 69 ℃ respectively.
FIG. 2 is a verification of the specificity of the Vibrio alginolyticus specific primer P1 in example 1;
wherein, 1.Vibrio furnisi; vibrio vulgaris; vibrio hollisae; vibrio parahaemolyticus 5.Vibrio harveyi; vibrio fluvialis; vibrio campbellii; vibrio algyrinyticus; vibrio metschnikovii; vibrio mimicus; vibrio cyclitrophycus; aeromonas hydrophila; aeromonas salmonicida; aeromonas sobria 15, Aeromonas veronii 16, Pseudomonas hellmanticensis; pseudomonas aeruginosa; pseudomonas kilonensis, M: Marker D.
FIG. 3 shows the PCR reaction sensitivity verification of Vibrio alginolyticus specific primer P1 in example 1.
Wherein M is Marker D, 1-7 is template concentration is 10 respectively1ng/ul，100ng/ul，10-1ng/ul，10-2ng/ul，10-3ng/ul，10-4ng/ul，10-5ng/ul。
FIG. 4 shows the results of gel imaging of PCR amplification products of different aquaculture animals with the Vibrio alginolyticus specific primer P1 in example 1;
wherein M is Marker D, and 1-7 are respectively turbot, sea cucumber, loach, crab, Pandalus prawnis, freshwater shrimp and salmon tissues injected with 0.1ml of vibrio alginolyticus bacterial liquid; 8-14 are tissues of turbot, sea cucumber, loach, crab, crayfish, freshwater shrimp and salmon injected with 0.90% of normal saline respectively.
FIG. 5 is the PCR reaction condition optimization of Vibrio alginolyticus specific primer P2 in example 2;
wherein, M is Marker DL 2000, 1-5 annealing temperatures are 56 ℃, 57 ℃, 58 ℃, 59 ℃ and 60 ℃.
FIG. 6 is a verification of the specificity of the Vibrio alginolyticus specific primer P2 in example 2;
wherein, 1.Vibrio furnisi; vibrio vulgaris; vibrio hollisae; vibrio parahaemolyticus; vibrio harveyi; vibrio fluvialis; vibrio algyrinyticus; vibrio campbellii; vibrio metschnikovii; vibrio mimicus 11.Vibrio gigantis; vibrio cyclitrophycus; aeromonas hydrophila; aeromonas salmonicida; aeromonas veronii; pseudomonas hemmenticensis; pseudomonas aeruginosa 18 Pseudomonas kilonensis; bordetella trematum; m is Marker DL 2000.
FIG. 7 shows the PCR reaction sensitivity verification of Vibrio alginolyticus specific primer P2 in example 2.
Wherein M is Marker D, 1-7 is template concentration is 10 respectively2ng/ul，101ng/ul，100ng/ul，10-1ng/ul，10-2ng/ul，10-3ng/ul，10-4ng/ul。
FIG. 8 shows the gel imaging results of the Vibrio alginolyticus specific primer P2 on the PCR amplification product of the Vibrio alginolyticus artificially infected turbot in example 2;
wherein, M is Marker D, 1-7 are turbot muscular tissues injected with 0.1ml of vibrio alginolyticus bacterial liquid respectively, and 8-14 are turbot muscular tissues injected with 0.90% of normal saline respectively.
FIG. 9 is the PCR reaction condition optimization of Vibrio alginolyticus specific primer P3 in example 3;
wherein, M is Marker DL 2000, 1-5 annealing temperatures are 56 ℃, 57 ℃, 58 ℃, 59 ℃ and 60 ℃.
FIG. 10 is a verification of the specificity of the Vibrio alginolyticus specific primer P3 in example 3;
wherein, 1.Vibrio furnisi; vibrio vulgaris; vibrio parahaemolyticus; vibrio hollisae; vibrio harveyi; vibrio fluvialis; vibrio campbellii; vibrio algyrinyticus; vibrio metschnikovii; vibrio mimicus 11.Vibrio gigantis; vibrio cyclitrophycus; aeromonas hydrophila; aeromonas salmonicida; aeromonas veronii; pseudomonas hemmenticensis; pseudomonas aeruginosa 18 Pseudomonas kilonensis; bordetella trematum; m is Marker DL 2000.
FIG. 11 shows the PCR reaction sensitivity verification of Vibrio alginolyticus specific primer P3 in example 3.
Wherein M is Marker D, 1-7 is template concentration is 10 respectively2ng/ul，101ng/ul，100ng/ul，10-1ng/ul，10-2ng/ul，10-3ng/ul，10-4ng/ul。
FIG. 12 shows the results of gel imaging of PCR amplification products of Vibrio alginolyticus artificially infected with Vibrio alginolyticus in example 3 using the specific primer P3;
wherein M is Marker D, 1-7 are sea cucumber tissues injected with 0.1ml of vibrio alginolyticus bacterial liquid respectively, and 8-14 are sea cucumber tissues injected with 0.90% of normal saline respectively.
Detailed Description
The following examples further illustrate the invention but are not intended to limit the invention thereto.
Example 1
Design of specific primer P1 for vibrio alginolyticus
In this example, a pair of specific primers P1 having strong specificity and high sensitivity to Vibrio alginolyticus (Vibrio alginolyticus) was designed by using software LSPrimer (http:// cccipb. lnu. edu. cn/primer /) and MEGA6 software for the topA gene of Vibrio alginolyticus (Vibrio algolyticus), and specific information of the specific primers is shown in Table 1.
TABLE 1
Second search for optimal PCR reaction conditions for Vibrio alginolyticus specific primer P1
1. Extraction of Vibrio alginolyticus DNA
The method comprises the following steps of extracting the DNA of Vibrio alginolyticus (Vibrio algiryticus) by using an Ezup column genome DNA extraction kit (bacteria):
1.1) taking 1ml of overnight cultured bacterial liquid containing Vibrio alginolyticus (Vibrio algirolyticus) to be added into a 1.5ml centrifuge tube, centrifuging for 1min at room temperature of 8000rmp, discarding supernatant, collecting thalli, adding 180ul Buffer digest, adding 20ul of protease K solution, shaking and mixing evenly. The cells were completely lysed by bathing in 56 ℃ water for 1 h. During the water bath, the mixture was inverted every 10 minutes to facilitate cell lysis.
1.2) add 200ul Buffer BD and mix well by inversion. After adding Buffer BD, if precipitate is generated, the mixture is bathed in water at 70 ℃ for 10 minutes.
1.3) adding 200ul of absolute ethyl alcohol, fully reversing and mixing. After the absolute ethyl alcohol is added, translucent fibrous suspended matters can be generated, and the extraction and the application of the DNA are not influenced.
1.4) putting the adsorption column into a collecting pipe, adding the solution obtained in the step 1.3) and the semitransparent fibrous suspended matters into the adsorption column by a liquid transfer device, standing for 2min, centrifuging for 1min at the room temperature of 12000rmp, and pouring waste liquid in the collecting pipe.
1.5) putting the adsorption column back into the collection tube again, adding 500ul PW Solution, centrifuging at 10000rmp for 30s, and pouring off the filtrate in the collection tube.
1.6) the adsorption column is replaced again into the collection tube, 500ul of Wash Solution is added, 10000rmp is added for centrifugation for 30s, and the filtrate is poured off.
1.7) the adsorption column is replaced in the collection tube and centrifuged at 12000rmp for 2min at room temperature, and the residual Wash Solution is discarded. And (3) opening the cover of the adsorption column, and standing at room temperature for a plurality of minutes to thoroughly dry the Wash Solution remained in the adsorption material, wherein the residue of the Wash Solution can influence the yield of the genome DNA and subsequent experiments.
1.8) taking out the adsorption column, putting the adsorption column into a new 1.5ml centrifuge tube, adding 50-200ul CE Buffer, standing for 3min, centrifuging at 12000rmp at room temperature for 2min, and collecting DNA solution, namely the DNA of the vibrio alginolyticus. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.
2. Exploration of optimal annealing temperature of Vibrio alginolyticus specific primer P1
And performing PCR amplification by respectively taking the extracted DNA of the vibrio alginolyticus as a template, setting the annealing temperature of the target primer to 65 ℃, 66 ℃, 67 ℃, 68 ℃ and 69 ℃, respectively, carrying out electrophoresis on the PCR amplification product in a 1% agarose 1 × TAE buffer system, adding 5ul of sample in each hole, observing by using a gel imaging system, carrying out photographic recording, and determining the optimal annealing temperature of the specific primer of the vibrio alginolyticus according to the gel electrophoresis result after PCR. Specific PCR reaction conditions and systems are shown in Table 2, and the results are shown in FIG. 1.
Table 2 primer optimal PCR reaction search conditions
As can be seen from FIG. 1, the temperature has no significant effect on the primers, but according to the basic principle of PCR, the higher the temperature is, the more favorable the specific binding of the primers is, and thus the optimal annealing temperature is determined to be 69 ℃.
(III) specific search of Vibrio alginolyticus-specific primer P1
1. Extraction of DNA of the Strain to be tested
The DNA of different species shown in Table 3 was extracted using an Ezup column genomic DNA extraction kit (bacteria), as described in step 1 of the second step.
2. Specific exploration
The extracted DNAs of different strains in Table 3 were used as templates for PCR amplification, the specific PCR reaction conditions and system are shown in Table 4, and the results of gel electrophoresis after PCR are shown in FIG. 2.
Table 3 strains to be tested are as follows:
TABLE 4 optimal PCR reaction conditions for the primers of interest
As can be seen from FIG. 2, the specific primers for Vibrio alginolyticus of the present invention show strong specificity in Vibrio, Aeromonas and Pseudomonas, and only produce specific amplification with the target strain Vibrio alginolyticus, but not the target strain. Therefore, it was found to exhibit strong specificity.
(IV) exploration of the sensitivity of Vibrio alginolyticus-specific primer P1
1. Extraction of Vibrio alginolyticus DNA
The DNA of the Vibrio alginolyticus (Vibrio algiryliticus) strain is extracted by using an Ezup column genome DNA extraction kit (bacteria), and the specific steps are as the step 1 in the step (II).
2. Exploration of sensitivity
Adjusting the DNA concentration of Vibrio alginolyticus to 101ng/ul，And sequentially diluted to 100ng/ul、10-1ng/ul、10- 2ng/ul、10-3ng/ul、10-4ng/ul、10-5ng/ul, 1ul of DNA was taken as PCR reaction template, the specific PCR reaction conditions and system are shown in Table 5, and the results of gel electrophoresis after PCR are shown in FIG. 3.
Optimal PCR reaction search conditions for primers of the purpose of Table 5
As can be seen from FIG. 3, the Vibrio alginolyticus specific primer of the present invention has a DNA concentration of 101ng/ul、100ng/ul、10-1ng/ul、10-2ng/ul、10-3ng/ul、10-4ng/ul、10-5ng/ul, specific amplification can be generated, and the minimum detection concentration can reach 10-5ng/ul。
(V) PCR detection method of vibrio alginolyticus in aquaculture animal
1. Extracting total DNA of the tissue of the aquaculture animal;
extracting DNA of an aquaculture animal tissue by using an Ezup column animal genome DNA extraction kit, and specifically comprising the following steps:
1.1) respectively taking 25mg of aquaculture animal tissues which are not injected with the vibrio alginolyticus and are injected with 0.1ml of vibrio alginolyticus suspension, grinding the tissues into powder by using liquid nitrogen, adding the powder into a 1.5ml centrifuge tube, adding 180ul Buffer ACL, adding 20ul of protease K solution, and uniformly shaking. The cells were completely lysed by bathing in 56 ℃ water for 1 h.
1.2) add 200ul Buffer CL and mix well by inversion. After adding Buffer CL, if a precipitate is generated, a water bath is carried out for 10 minutes at 70 ℃.
1.3) adding 200ul of absolute ethyl alcohol, fully reversing and mixing. After the absolute ethyl alcohol is added, translucent fibrous suspended matters can be generated, and the extraction and the application of the DNA are not influenced.
1.4) putting the adsorption column into a collecting pipe, adding the solution obtained in the step 1.3) and the semitransparent fibrous suspended matters into the adsorption column by a liquid transfer device, standing for 2min, centrifuging for 1min at the room temperature of 12000rmp, and pouring waste liquid in the collecting pipe.
1.5) the adsorption column is replaced into the collection tube again, 500ul CW1 Solution is added, 10000rmp is added for centrifugation for 30s, and the filtrate of the collection tube is poured off.
1.6) the adsorption column is replaced again into the collection tube, 500ul CW2 Solution is added, 10000rmp is added for centrifugation for 30s, and the filtrate is poured off.
1.7) the column was replaced in the collection tube and centrifuged at 12000rmp for 2min at room temperature, discarding the remaining CW2 Solution. The adsorption column was opened and left at room temperature for several minutes to completely dry the residual CW2 Solution, CW2 Solution, which affects the yield of genomic DNA and subsequent experiments.
1.8) taking out the adsorption column, putting the adsorption column into a new 1.5ml centrifuge tube, adding 50-200ul CE Buffer, standing for 3min, centrifuging at 12000rmp at room temperature for 2min, and collecting DNA solution, namely the total DNA of the tissue of the aquaculture animal. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.
2. Amplification by PCR
Using the extracted DNA as a template, adopting vibrio alginolyticus specific primer P1, and amplifying by a PCR method to obtain a PCR product;
P1-F:TCGCTTCATGGACCGTGTC
P1-R:GGCGCTTAGGTTAGTCGAGT
and (3) PCR reaction conditions: the first stage is as follows: 5min at 94 ℃;
and a second stage: 30s at 94 ℃, 30s at 69 ℃ and 30s at 72 ℃; 30 cycles;
and a third stage: 5min at 72 ℃;
a fourth stage: storing at 4 ℃.
3. The PCR amplification products were electrophoresed in a 1% agarose 1 XTAE buffer system, loaded with 5ul of each well, visualized with a gel imaging system and photographically recorded as shown in FIG. 4.
M is Marker D, 1-7 are respectively turbot, sea cucumber, loach, crab, crayfish, freshwater shrimp and salmon tissues injected with 0.1ml of vibrio alginolyticus bacterial liquid; 8-14 are tissues of turbot, sea cucumber, loach, crab, crayfish, freshwater shrimp and salmon injected with 0.90% of normal saline respectively.
4. And (4) judging the standard: judging the actual detection effect of the primer according to the agarose gel imaging result of the PCR amplification product; if the result of agarose gel display shows that a 484bp band is generated, the actual detection effect is good. If the result of agarose gel non-presentation shows that 484bp bands are generated, the actual detection effect is not ideal.
As can be seen from FIG. 4, tissues (1-7) of turbot, sea cucumber, loach, crab, shrimp, freshwater shrimp and salmon injected with 0.1ml of vibrio alginolyticus bacterial solution all generate 484bp strips, and tissues (8-14) of turbot, sea cucumber, loach, crab, shrimp, freshwater shrimp and salmon injected with 0.90% of physiological saline do not generate 484bp strips.
Example 2
Design of specific primer of vibrio alginolyticus
In this example, a pair of specific primers P2 with strong specificity and high sensitivity to Vibrio alginolyticus (Vibrio alginolyticus) was designed by using software LSPrimer (http:// cccipb. lnu. edu. cn/primer /) and MEGA6 software for toxR gene of Vibrio alginolyticus (Vibrio algolyticus), and specific information of the specific primers is shown in Table 6.
TABLE 6
Second search for optimal PCR reaction conditions for Vibrio alginolyticus specific primer P2
1. Extraction of Vibrio alginolyticus DNA: same as example 1
2. Exploration of optimal annealing temperature of Vibrio alginolyticus specific primer P2
Respectively taking the extracted DNA of the vibrio alginolyticus as a template for PCR amplification, setting the annealing temperature of a target primer to be 56 ℃, 57 ℃, 58 ℃, 59 ℃ and 60 ℃, respectively, carrying out electrophoresis on PCR amplification products in a 1% agarose 1 × TAE buffer system, adding 5ul of samples in each hole, observing by using a gel imaging system, carrying out photographic recording, and determining the optimal annealing temperature of the vibrio alginolyticus specific primer P2 according to the gel electrophoresis result after PCR. Specific PCR reaction conditions and systems are shown in Table 7, and the results are shown in FIG. 5.
Optimal PCR reaction search conditions for primers of the purpose of Table 7
As can be seen from FIG. 5, the temperature has no significant effect on the primers, but according to the basic principle of PCR, the higher the temperature is, the more favorable the specific binding of the primers is, and thus the optimal annealing temperature is determined to be 60 ℃.
(III) specific exploration of Vibrio alginolyticus specific primer piece
1. Extraction of DNA of the Strain to be tested
The DNA of different species shown in Table 8 was extracted using an Ezup column genomic DNA extraction kit (bacteria), and the specific procedure was as in step 1 of example 1 (two).
2. Specific exploration
The PCR amplification was performed using the extracted DNAs of different species in Table 8 as templates, and the specific PCR reaction conditions and system are shown in Table 9, and the results of gel electrophoresis after PCR are shown in FIG. 6.
Table 8 strains to be tested are as follows:
optimal PCR reaction conditions for primers of the purpose of Table 9
As can be seen from FIG. 6, the specific primers of Vibrio alginolyticus of the present invention show strong specificity in Vibrio, Aeromonas and Pseudomonas, and can only produce specific amplification with the target strain Vibrio alginolyticus, but not the target strain. Therefore, it was found to exhibit strong specificity.
(IV) exploration of the sensitivity of Vibrio alginolyticus-specific primer P2
1. Extraction of Vibrio alginolyticus DNA: same as example 1
2. Exploration of sensitivity
Adjusting the DNA concentration of Vibrio alginolyticus to 102ng/ul, and sequentially diluted to 101ng/ul、100ng/ul、10-1ng/ul、10-2ng/ul、10-3ng/ul、10-4ng/ul, 1ul of DNA was taken as PCR reaction template, the specific PCR reaction conditions and system are shown in Table 10, and the results of gel electrophoresis after PCR are shown in FIG. 7.
Optimal PCR reaction search conditions for primers of the purpose in Table 10
As can be seen from FIG. 7, the Vibrio alginolyticus specific primer of the present invention has a DNA concentration of 102ng/ul、101ng/ul、10-1ng/ul can produce specific amplification, and the minimum detection concentration can reach 10-1ng/ul。
(V) PCR detection of vibrio alginolyticus in turbot culture process
1. Extracting total DNA of turbot tissue
Extracting DNA of turbot tissues by using an Ezup column animal genome DNA extraction kit, and specifically comprising the following steps:
1.1) respectively taking 25mg turbot tissues which are not injected with vibrio alginolyticus and are injected with 0.1ml vibrio alginolyticus suspension, grinding the tissues into powder by using liquid nitrogen, adding the powder into a 1.5ml centrifuge tube, adding 180ul Buffer ACL, adding 20ul protease K solution, and uniformly mixing by shaking. The cells were completely lysed by bathing in 56 ℃ water for 1 h.
1.2) add 200ul Buffer CL and mix well by inversion. After adding Buffer CL, if a precipitate is generated, a water bath is carried out for 10 minutes at 70 ℃.
1.3) adding 200ul of absolute ethyl alcohol, fully reversing and mixing. After the absolute ethyl alcohol is added, translucent fibrous suspended matters can be generated, and the extraction and the application of the DNA are not influenced.
1.4) putting the adsorption column into a collecting pipe, adding the solution obtained in the step 1.3) and the semitransparent fibrous suspended matters into the adsorption column by a liquid transfer device, standing for 2min, centrifuging for 1min at the room temperature of 12000rmp, and pouring waste liquid in the collecting pipe.
1.5) the adsorption column is replaced into the collection tube again, 500ul CW1 Solution is added, 10000rmp is added for centrifugation for 30s, and the filtrate of the collection tube is poured off.
1.6) the adsorption column is replaced again into the collection tube, 500ul CW2 Solution is added, 10000rmp is added for centrifugation for 30s, and the filtrate is poured off.
1.7) the column was replaced in the collection tube and centrifuged at 12000rmp for 2min at room temperature, discarding the remaining CW2 Solution. The adsorption column was opened and left at room temperature for several minutes to completely dry the residual CW2 Solution, CW2 Solution, which affects the yield of genomic DNA and subsequent experiments.
1.8) taking out the adsorption column, putting the adsorption column into a new 1.5ml centrifuge tube, adding 50-200ul CE Buffer, standing for 3min, centrifuging at 12000rmp at room temperature for 2min, and collecting DNA solution, namely the total DNA of the turbot tissue. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.
2. Amplification by PCR
Using the extracted DNA as a template, adopting vibrio alginolyticus specific primer P2, and amplifying by a PCR method to obtain a PCR product;
P2-F:CTGACGTTGAAGAAGCCACTT
P2-R:GGCGTCATCACAGGTACATTTT
and (3) PCR reaction conditions: the first stage is as follows: 5min at 94 ℃;
and a second stage: 30s at 94 ℃, 30s at 60 ℃ and 30s at 72 ℃; 30 cycles;
and a third stage: 5min at 72 ℃;
a fourth stage: storing at 4 ℃.
3. The PCR amplification products were electrophoresed in a 1% agarose 1 XTAE buffer system, 5ul of each well was loaded, observed with a gel imaging system and photographically recorded as shown in FIG. 8.
4. And (4) judging the standard: judging the actual detection effect of the primer according to the agarose gel imaging result of the PCR amplification product; if the result of agarose gel display shows that 286bp bands are generated, the actual detection effect is good. If the agarose gel does not show that 286bp bands are generated, the actual detection effect is not ideal.
As can be seen from FIG. 8, the turbot tissues (1-7) injected with 0.1ml of Vibrio alginolyticus bacterial liquid all generate 286bp bands, while the turbot tissues (8-14) injected with 0.90% of physiological saline do not generate 286bp bands, so that the specific primer designed according to the Vibrio alginolyticus toxR gene has better detection capability and can be applied to actual detection.
Example 3
Design of specific primer of vibrio alginolyticus
In this example, a pair of specific primers P3 with strong specificity and high sensitivity to Vibrio alginolyticus (Vibrio alginolyticus) was designed by using software LSPrimer (http:// cccipb. lnu. edu. cn/primer /) and MEGA6 software for toxR gene of Vibrio alginolyticus (Vibrio algolyticus), and specific information of the specific primers is shown in Table 11.
TABLE 11
Second search for optimal PCR reaction conditions for Vibrio alginolyticus specific primer P3
1. Extraction of Vibrio alginolyticus DNA: the same as in example 1.
2. Exploration of optimal annealing temperature of Vibrio alginolyticus specific primer P3
And performing PCR amplification by respectively taking the extracted DNA of the vibrio alginolyticus as a template, setting the annealing temperature of the target primer to 56 ℃, 57 ℃, 58 ℃, 59 ℃ and 60 ℃, respectively, carrying out electrophoresis on the PCR amplification product in a 1% agarose 1 × TAE buffer system, adding 5ul of sample in each hole, observing by using a gel imaging system, carrying out photographic recording, and determining the optimal annealing temperature of the specific primer of the vibrio alginolyticus according to the gel electrophoresis result after PCR. Specific PCR reaction conditions and systems are shown in Table 12, and the results are shown in FIG. 9.
Optimal PCR search conditions for primers of the order of Table 12
As can be seen from FIG. 9, the temperature has no significant effect on the primers, but according to the basic principle of PCR, the higher the temperature is, the more favorable the specific binding of the primers is, and thus the optimal annealing temperature is determined to be 60 ℃.
(III) specific search of Vibrio alginolyticus-specific primer P3
1. Extraction of DNA of the Strain to be tested
The DNA of different species shown in Table 13 was extracted using an Ezup column genomic DNA extraction kit (bacteria), and the specific procedure was as in step 1 of example 1 (two).
2. Specific exploration
The PCR amplification was performed using the DNAs of different species extracted in Table 13 as templates, and the specific PCR reaction conditions and system are shown in Table 14, and the results of gel electrophoresis after PCR are shown in FIG. 10.
Table 13 strains to be tested are as follows:
optimal PCR reaction conditions for the primers of the purpose in Table 14
As can be seen from FIG. 10, the specific primers of Vibrio alginolyticus of the present invention show strong specificity in Vibrio, Aeromonas and Pseudomonas, and can only produce specific amplification with the target strain Vibrio alginolyticus, but not the target strain. Therefore, it was found to exhibit strong specificity.
(IV) exploration of the sensitivity of Vibrio alginolyticus-specific primers
1. Extraction of Vibrio alginolyticus DNA: same as example 1
2. Exploration of sensitivity
Adjusting the DNA concentration of Vibrio alginolyticus to 102ng/ul, and sequentially diluted to 101ng/ul、100ng/ul、10-1ng/ul、10-2ng/ul、10-3ng/ul、10-4ng/ul, 1ul of DNA was taken as PCR reaction template, the specific PCR reaction conditions and system are shown in Table 15, and the results of gel electrophoresis after PCR are shown in FIG. 11.
Optimal PCR reaction search conditions for primers of the purpose of Table 15
As can be seen from FIG. 11, the Vibrio alginolyticus specific primer of the present invention has a DNA concentration of 102ng/ul、101ng/ul、100ng/ul can produce specific amplification, and the minimum detection concentration can reach 100ng/ul。
PCR detection method of vibrio alginolyticus in holothurian culture process
1. Extracting total DNA of sea cucumber tissues;
extracting DNA of sea cucumber tissues by using an Ezup column animal genome DNA extraction kit, which comprises the following specific steps:
1.1) taking about 25mg of sea cucumber tissues which are not injected with the vibrio alginolyticus and are injected with 0.1ml of vibrio alginolyticus suspension respectively, grinding the sea cucumber tissues into powder by using liquid nitrogen, adding the powder into a 1.5ml centrifuge tube, adding 180ul Buffer ACL, adding 20ul of protease K solution, and shaking and uniformly mixing. The cells were completely lysed by bathing in 56 ℃ water for 1 h.
1.2) add 200ul Buffer CL and mix well by inversion. After adding Buffer CL, if a precipitate is generated, a water bath is carried out for 10 minutes at 70 ℃.
1.3) adding 200ul of absolute ethyl alcohol, fully reversing and mixing. After the absolute ethyl alcohol is added, translucent fibrous suspended matters can be generated, and the extraction and the application of the DNA are not influenced.
1.4) putting the adsorption column into a collecting pipe, adding the solution obtained in the step 1.3) and the semitransparent fibrous suspended matters into the adsorption column by a liquid transfer device, standing for 2min, centrifuging for 1min at the room temperature of 12000rmp, and pouring waste liquid in the collecting pipe.
1.5) the adsorption column is replaced into the collection tube again, 500ul CW1 Solution is added, 10000rmp is added for centrifugation for 30s, and the filtrate of the collection tube is poured off.
1.6) the adsorption column is replaced again into the collection tube, 500ul CW2 Solution is added, 10000rmp is added for centrifugation for 30s, and the filtrate is poured off.
1.7) the column was replaced in the collection tube and centrifuged at 12000rmp for 2min at room temperature, discarding the remaining CW2 Solution. The adsorption column was opened and left at room temperature for several minutes to completely dry the residual CW2 Solution, CW2 Solution, which affects the yield of genomic DNA and subsequent experiments.
1.8) taking out the adsorption column, putting the adsorption column into a new 1.5ml centrifuge tube, adding 50-200ul CE Buffer, standing for 3min, centrifuging at 12000rmp at room temperature for 2min, and collecting DNA solution, namely the total DNA of the sea cucumber tissue. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.
2. Amplification by PCR
Using the extracted DNA as a template, adopting vibrio alginolyticus specific primer P3, and amplifying by a PCR method to obtain a PCR product;
P3-F:CCTAAACGCGGTTATCAACTCA
P3-R:GGCGTCATCACAGGTACATTTT
and (3) PCR reaction conditions: the first stage is as follows: 5min at 94 ℃;
and a second stage: 30s at 94 ℃, 30s at 60 ℃ and 30s at 72 ℃; 30 cycles;
and a third stage: 5min at 72 ℃;
a fourth stage: storing at 4 ℃.
3. The PCR amplification products were electrophoresed in a 1% agarose 1 XTAE buffer system, 5ul of each well was loaded, observed with a gel imaging system and photographically recorded as shown in FIG. 12.
4. And (4) judging the standard: judging the actual detection effect of the primer according to the agarose gel imaging result of the PCR amplification product; if the agarose gel shows that a 353bp band is generated, the actual detection effect is good. If the agarose gel does not show the result that 353bp bands are generated, the actual detection effect is not ideal.
As can be seen from FIG. 12, the sea cucumber tissues (1-7) injected with 0.1ml of Vibrio alginolyticus bacterial liquid all generate 353 bp-sized bands, while the sea cucumber tissues (8-14) injected with 0.90% of physiological saline do not generate 353 bp-sized bands, so that the specific primer designed according to the Vibrio alginolyticus toxR gene has better detection capability and can be applied to actual detection.
<110> Liaoning university
<120> PCR detection method of vibrio alginolyticus in aquaculture animal
<160> 2
<210> 1
<211> 19
<212> DNA
<213> primer P1-F for topA gene of Vibrio alginolyticus
<400> 1
TCGCTTCATGGACCGTGTC
<210> 2
<211> 20
<212> DNA
<213> primer P1-R for topA gene of Vibrio alginolyticus
<400> 2
GGCGCTTAGGTTAGTCGAGT
Claims (1)
1. The PCR primer for detecting the vibrio alginolyticus in the aquiculture animal is characterized in that: the primer is specific to vibrio alginolyticustopAA primer P1 specific to the gene, the sequence of which is:
P1-F： TCGCTTCATGGACCGTGTC
P1-R： GGCGCTTAGGTTAGTCGAGT。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710157709.6A CN106755550B (en) | 2017-03-16 | 2017-03-16 | PCR detection method for vibrio alginolyticus in aquaculture animal |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710157709.6A CN106755550B (en) | 2017-03-16 | 2017-03-16 | PCR detection method for vibrio alginolyticus in aquaculture animal |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106755550A CN106755550A (en) | 2017-05-31 |
| CN106755550B true CN106755550B (en) | 2020-12-08 |
Family
ID=58966176
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710157709.6A Active CN106755550B (en) | 2017-03-16 | 2017-03-16 | PCR detection method for vibrio alginolyticus in aquaculture animal |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755550B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2249183A1 (en) * | 1996-03-26 | 1997-10-02 | Nippon Suisan Kaisha, Ltd. | Oligonucleotides used for detecting vibrio parahaemolyticus and method of detection therewith |
| CN105002280A (en) * | 2015-07-24 | 2015-10-28 | 长江大学 | Fluorogenic quantitative PCR detecting method of vibrios |
| CN105132532A (en) * | 2015-07-24 | 2015-12-09 | 长江大学 | Vibrio detecting primer group and detecting method |
| CN105255996A (en) * | 2014-07-15 | 2016-01-20 | 中国人民解放军海军总医院 | Primers and kit for Vibrio alginolyticus on-site detection, and applications of primers and kit |
-
2017
- 2017-03-16 CN CN201710157709.6A patent/CN106755550B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2249183A1 (en) * | 1996-03-26 | 1997-10-02 | Nippon Suisan Kaisha, Ltd. | Oligonucleotides used for detecting vibrio parahaemolyticus and method of detection therewith |
| CN105255996A (en) * | 2014-07-15 | 2016-01-20 | 中国人民解放军海军总医院 | Primers and kit for Vibrio alginolyticus on-site detection, and applications of primers and kit |
| CN105002280A (en) * | 2015-07-24 | 2015-10-28 | 长江大学 | Fluorogenic quantitative PCR detecting method of vibrios |
| CN105132532A (en) * | 2015-07-24 | 2015-12-09 | 长江大学 | Vibrio detecting primer group and detecting method |
Non-Patent Citations (7)
| Title |
|---|
| A multiplex PCR-based protocol for identification and quantification of Vibrio harveyi-related species;A.Cano-Gomez等;《Aquaculture》;20150201;第437卷;摘要，第196页右栏表3 * |
| Characterization of role of the toxR gene in the physiology and pathogenicity of Vibrio alginolyticus;Chen C等;《Antonie Van Leeuwenhoek》;20120228;第101卷(第2期);第281-288页 * |
| Genetic and phylogenetic evidence for misidentification of Vibrio species within the Harveyi clade;Hoffmann M等;《Lett Appl Microbiol》;20110228;第54卷(第2期);第160-165页 * |
| 华南地区海水养殖鱼类主要弧菌病原的分离与鉴定;崔婧等;《海南大学学报自然科学版》;20140930;第32卷(第3期);第244-251页 * |
| 应用SYBR Green Ⅰ荧光PCR方法快速检测溶藻弧菌;李杰等;《中国预防医学杂志》;20140531;第15卷(第3期);第195-198页 * |
| 溶藻弧菌的PCR快速检测方法;韩一凡等;《中国海洋大学学报》;20091130;第39卷(第6期);摘要，第1237页右栏第2段至第1238页右栏第1段（即1.2-1.6节），第1239页左栏2.2节和2.3节、右栏"3 讨论"部分倒数第1-3行，图4、5 * |
| 韩一凡等.溶藻弧菌的PCR快速检测方法.《中国海洋大学学报》.2009,第39卷(第6期),第1237-1240页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106755550A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108588248A (en) | Multiple PCR primer group, kit and detection method for detecting 5 kinds of fimbriae genes of enterotoxigenic escherichia coli | |
| Natsos et al. | The genus Campylobacter: detection and isolation methods, species identification & typing techniques | |
| CN105734166B (en) | Multiple PCR primer and application thereof in turbot culture process | |
| CN106801103B (en) | Detection primer group, detection kit and multiplex PCR detection method for streptococcus agalactiae | |
| CN106755550B (en) | PCR detection method for vibrio alginolyticus in aquaculture animal | |
| CN108103152B (en) | Rapid detection method for Listonella anguillarum | |
| CN106939347B (en) | Dual PCR (polymerase chain reaction) rapid detection kit and method for pathogenic vibrio natriegens of portunus trituberculatus | |
| Klaif et al. | Molecular characterization of enterohemorrhagic E. coli O157 and O153 isolated from tissue camel and human stool samples in Al-Diwaniyah, Iraq. | |
| CN111394483A (en) | Kit and detection method for simultaneously detecting three fish-source streptococcus | |
| CN106884051B (en) | PCR detection method for vibrio parahaemolyticus in aquaculture animal | |
| CN105969907B (en) | Kit for detecting ST251 type pathogenic aeromonas hydrophila and application thereof | |
| CN106755552A (en) | The PCR detection method of Vibrio vulnificus in a kind of aquiculture animal or aquatic food | |
| Gwak et al. | How to rapidly and sensitively detect for Escherichia coli O157: H7 and Salmonella Typhimurium in cabbage using filtration, DNA concentration, and real-time PCR after short-term enrichment | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN106701994A (en) | Double PCR (Polymerase chain reaction) primer for simultaneous detection of Klebsiella pneumoniae and Aeromonas caviae and detection method of double PCR primer | |
| Sun et al. | Detection of intestinal pathogenic klebsiella pneumoniae from fecal samples of giant panda by polymerase chain reaction | |
| CN113151515A (en) | Detection kit and detection method for food-borne pathogenic bacteria | |
| CN105755156A (en) | Specific primer of Aeromonas salmonicida and application thereof to turbot culture process | |
| CN101705298B (en) | Quick bacterium examination kit and detection method thereof | |
| CN110923348B (en) | Primer and method for identifying five pilus genes of escherichia coli at one time | |
| Baumgartner et al. | Experience with mortalities of cultured Catfish Ictalurus punctatus (Rafinesque 1818) and I. punctatus X I. furcatus (valenciennes 1840) caused by highly virulent strains of Aeromonas hydrophila | |
| CN114262707B (en) | sgRNA for detecting campylobacter jejuni gene, CRISPR/Cas12a system, kit, detection method and application | |
| JP5134071B2 (en) | Method for avoiding inhibition in nucleic acid amplification reaction | |
| CN115838815B (en) | RPA composition, fluorescent RPA kit and detection method for detecting nocardia seriolae | |
| CN109943652B (en) | Multiplex PCR kit and method for rapidly detecting pediococcus acidilactici by using same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |