CN105132532A - Vibrio detecting primer group and detecting method - Google Patents
Vibrio detecting primer group and detecting method Download PDFInfo
- Publication number
- CN105132532A CN105132532A CN201510438179.3A CN201510438179A CN105132532A CN 105132532 A CN105132532 A CN 105132532A CN 201510438179 A CN201510438179 A CN 201510438179A CN 105132532 A CN105132532 A CN 105132532A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- vibrio
- seq idno
- vibrios
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a vibrio detecting primer group. The vibrio detecting primer group comprises one or more of a toxR gene primer pair, a flaA gene primer pair and a pyrH gene primer pair, wherein the sequence of the toxR gene primer pair is as shown in SEQ ID No. 1-2, the sequence of the flaA gene primer pair is as shown in SEQ ID No. 3-4, and the sequence of the pyrH gene primer pair is as shown in SEQ ID No. 5-6. The invention further provides a vibrio detecting method which includes using the primer group to perform PCR amplification on templates. The vibrio detecting primer group and the detecting method have the advantages that high specificity is achieved during detection of vibrio in water environments, pathogen varieties can be determined fast and conveniently, the vibrio fluvialis, vibrio anguillarum and vibrio alginolyticus in vibrio can be detected at the same time and independently, and detecting efficiency is increased; living bacteria are directly used as the templates to build a PCR system, the step of extracting DNA from bacteria is omitted, and simpleness and convenience in operation are achieved; accurate detecting results and high sensitivity are achieved, and the primer group and the detecting method are significant to the prevention of the vibrio which is one of the main bacterial diseases of marine culture animals.
Description
Technical field
The invention belongs to technical field of microbial detection, particularly a kind of vibrios detects primer sets and detection method.
Background technology
Vibrios is the halophilism gram negative bacillus that a class is distributed widely in ocean environment, is subordinate to vibrionaceae, Vibrio, has abundant diversity.There is now kind more than 10 to be pathogenic bacteria in aquaculture, comprise vibrio fluvialis, Vibrio anguillarum, vibrio alginolyticus etc.Vibrio fluvialis, Vibrio anguillarum and vibrio alginolyticus are conditioned pathogen, when aquatic animal is under bad envrionment conditions, meet with unfavorable stimulation or injured time, the generation that can induce an illness.
Develop rapidly along with propagating artificially, Cultivated water ecologic change, vibriosis has become one of main bacterial disease of marine cultured animal.Have popular wide, sickness rate is high, harm is large, mortality ratio high, causes tremendous influence to the cultivation of the seawater animals such as fish, shrimp, crab and shellfish.There are some researches show: when the quantity of vibrios in water is 10
3-10
4during cfu/mL, the red leg disease symptom of prawn obviously increases the weight of, the bacterial flora sum contained in cfu/mL and every ml sample.Vibrio fluvialis, the lonely bacterium of eel and vibrio alginolyticus can cause worldwide more than 50 kinds of brackish water cultured fishes and other cultivated animals generation vibriosis.A lot of research shows, these three kinds of vibrios are major reasons of multiple cultured prawn infection morbidity.The red leg of prawn, the yellow gill, disconnected palpus, volume sword and afterbody can be caused to fester; Slow in reacting to external world; Part shrimp body blackout and muscle gonorrhoea.Vibrio flurialis intestines, vibrio alginolyticus can also make people cure the disease, and cause sporadic diarrhoea.The control of the microbial disease of arc is mainly taked to the aggregate measures of " put prevention first, emphasis is monitored, prevent and treat combination ", the prevention for vibrios is provided basic guarantee by the method effectively detecting vibrios.
PCR detection method is one of effective ways detecting vibrios, but the specificity detected due to current PCR is inadequate, the detection of vibrios is easily subject to the interference of different pathogenic bacterium or other factors, easy generation non-specific amplification, more cannot detect Vibrio simultaneously, and detection sensitivity is limited, cannot detect in time when vibrios content is lower, cause that detection efficiency is on the low side, accuracy is inadequate.
Summary of the invention
In view of this, the invention provides a kind of high specificity, highly sensitive vibrios detects primer sets and detection method.
First aspect present invention provides the primer sets detecting vibrios, comprises following one or more pairs of primer:
ToxR gene primer pair:
Upstream primer toxR-F sequence is: TGCAAGTAAAGATCCTGATG, i.e. sequence table SEQ IDNo.1;
Downstream primer toxR-R sequence is: GTCGTAAACAAAATGACACAA, i.e. sequence table SEQ IDNo.2;
FlaA gene primer pair:
Upstream primer flaA-F sequence is: TTACGCAGAAGCGGTGAT, i.e. sequence table SEQ IDNo.3;
Downstream primer flaA-R sequence is: GCTGTTGGATGAAGGGTC, i.e. sequence table SEQ IDNo.4;
PyrH gene primer pair:
Upstream primer pyrH-F sequence is: AAAGAACTGGTTGAACTGGGTG, i.e. sequence table SEQ IDNo.5;
Downstream primer pyrH-R sequence is: CCATCAACTTTCGTCGCTTT, i.e. sequence table SEQ IDNo.6.
Second aspect present invention provides a kind of method detecting vibrios, and described method comprises the step that the following one or more pairs of primer pair template of use carries out pcr amplification:
ToxR gene primer pair:
Upstream primer toxR-F sequence is: TGCAAGTAAAGATCCTGATG, i.e. sequence table SEQ IDNo.1;
Downstream primer toxR-R sequence is: GTCGTAAACAAAATGACACAA, i.e. sequence table SEQ IDNo.2;
FlaA gene primer pair:
Upstream primer flaA-F sequence is: TTACGCAGAAGCGGTGAT, i.e. sequence table SEQ IDNo.3;
Downstream primer flaA-R sequence is: GCTGTTGGATGAAGGGTC, i.e. sequence table SEQ IDNo.4;
PyrH gene primer pair:
Upstream primer pyrH-F sequence is: AAAGAACTGGTTGAACTGGGTG, i.e. sequence table SEQ IDNo.5;
Downstream primer pyrH-R sequence is: CCATCAACTTTCGTCGCTTT, i.e. sequence table SEQ IDNo.6.
The invention has the beneficial effects as follows: the present invention is respectively with vibrio fluvialis toxR gene, the flaA gene of Vibrio anguillarum and the pyrH gene design primer of vibrio alginolyticus, PCR method is adopted to detect vibrios in water surrounding, high specificity, and the kind of pathogenic bacterium can be determined quickly and easily, realize, to detecting while the vibrio fluvialis in vibrios, Vibrio anguillarum and vibrio alginolyticus and detecting separately, improve determination rates.The present invention directly utilizes viable bacteria to build PCR system as template, eliminates the step extracting DNA from bacterium, and operate more simple and convenient, cost is lower.Detected result is accurate and highly sensitive, reaches 5.21 × 10 successively to the detectable minimum concentration of the vibrio fluvialis in vibrios, Vibrio anguillarum and vibrio alginolyticus
2cfu/mL, 2.70 × 10
4cfu/mL, 2.48 × 10
2cfu/mL, to preventing, the vibriosis of one of marine cultured animal predominantly bacteria venereal disease evil is significant.
Accompanying drawing explanation
Fig. 1 specific assay result schematic diagram that to be toxR gene primer right to, pyrH gene primer to, flaA gene primer; Wherein, M is 2000bpDNA molecular weight standard; 1 is vibrio fluvialis template and vibrio fluvialis toxR primer pair amplifies result; 2 is Vibrio anguillarum template and vibrio fluvialis toxR primer pair amplifies result; 3 is vibrio alginolyticus template and vibrio fluvialis toxR primer pair amplifies result; 4 is Vibrio parahaemolyticus template and vibrio fluvialis toxR primer pair amplifies result; 5 is Vibrio anguillarum template and Vibrio anguillarum flaA primer pair amplifies result; 6 is vibrio fluvialis template and Vibrio anguillarum flaA-F primer pair amplifies result; 7 is vibrio alginolyticus template and Vibrio anguillarum flaA primer pair amplifies result; 8 is Vibrio parahaemolyticus template and Vibrio anguillarum flaA primer pair amplifies result; 9 is vibrio alginolyticus template and vibrio alginolyticus pyrH primer pair amplifies result; 10 is vibrio fluvialis template and vibrio alginolyticus pyrH primer pair amplifies result; 11 is Vibrio anguillarum template and vibrio alginolyticus pyrH primer pair amplifies result; 12 is Vibrio parahaemolyticus viable bacteria diluent and vibrio alginolyticus pyrH primer pair amplifies result.
Fig. 2 is the sensitivity technique result schematic diagram to vibrio fluvialis; Wherein, M is 2000bpDNA molecular weight standard; The vibrio fluvialis concentration of 1 is 5.21 × 10
6cfu/mL; The vibrio fluvialis concentration of 2 is 5.21 × 10
5cfu/mL; The vibrio fluvialis concentration of 3 is 5.21 × 10
4cfu/mL; The vibrio fluvialis concentration of 4 is 5.21 × 10
3cfu/mL; The vibrio fluvialis concentration of 5 is 5.21 × 10
2cfu/mL; The vibrio fluvialis concentration of 6 is 5.21 × 10
1cfu/mL; The vibrio fluvialis concentration of 7 is 5.21cfu/mL; 8 is blank group, namely not containing vibrio fluvialis.
Fig. 3 is the sensitivity technique result schematic diagram to Vibrio anguillarum; Wherein, M is 2000bpDNA molecular weight standard; The Vibrio anguillarum concentration of 1 is 2.70 × 10
7cfu/mL; The Vibrio anguillarum concentration of 2 is 2.70 × 10
6cfu/mL; The Vibrio anguillarum concentration of 3 is 2.70 × 10
5cfu/mL; The Vibrio anguillarum concentration of 4 is 2.70 × 10
4cfu/mL; The Vibrio anguillarum concentration of 5 is 2.70 × 10
3cfu/mL; The Vibrio anguillarum concentration of 6 is 2.70 × 10
2cfu/mL; 7 is blank group, namely not containing Vibrio anguillarum.
Fig. 4 is the sensitivity technique result schematic diagram to vibrio alginolyticus; Wherein, M is 2000bpDNA molecular weight standard; The vibrio alginolyticus concentration of 1 is 2.48 × 10
7cfu/mL; The vibrio alginolyticus concentration of 2 is 2.48 × 10
6cfu/mL; The vibrio alginolyticus concentration of 3 is 2.48 × 10
5cfu/mL; The vibrio alginolyticus concentration of 4 is 2.48 × 10
4cfu/mL; The vibrio alginolyticus concentration of 5 is 2.48 × 10
3cfu/mL; The vibrio alginolyticus concentration of 6 is 2.48 × 10
2cfu/mL; The vibrio alginolyticus concentration of 7 is 2.48 × 10
1cfu/mL; 8 is blank group, namely not containing vibrio alginolyticus.
Fig. 5 is simultaneously to the result schematic diagram that any two kinds of vibrios in vibrio fluvialis, Vibrio anguillarum, vibrio alginolyticus or three kinds of vibrios detect; Wherein, M is 2000bpDNA molecular weight standard; 1 for flaA gene primer to, toxR gene primer to pyrH gene primer to the result of pcr template being carried out to multiplexed PCR amplification; 2 for flaA gene primer to toxR gene primer to the result of pcr template being carried out to double PCR amplification; 3 for toxR gene primer to pyrH gene primer to the result of pcr template being carried out to double PCR amplification; 4 for flaA gene primer to pyrH gene primer to the result of pcr template being carried out to double PCR amplification; 5 is blank, does not namely adopt primer to carry out the result of pcr amplification.
Embodiment
First aspect present invention provides the primer sets detecting vibrios, comprises following one or more pairs of primer:
ToxR gene primer pair:
Upstream primer toxR-F sequence is: TGCAAGTAAAGATCCTGATG, as shown in sequence table SEQ IDNo.1;
Downstream primer toxR-R sequence is: GTCGTAAACAAAATGACACAA, as shown in sequence table SEQ IDNo.2;
FlaA gene primer pair:
Upstream primer flaA-F sequence is: TTACGCAGAAGCGGTGAT, as shown in sequence table SEQ IDNo.3;
Downstream primer flaA-R sequence is: GCTGTTGGATGAAGGGTC, as shown in sequence table SEQ IDNo.4;
PyrH gene primer pair:
Upstream primer pyrH-F sequence is: AAAGAACTGGTTGAACTGGGTG, as shown in sequence table SEQ IDNo.5;
Downstream primer pyrH-R sequence is: CCATCAACTTTCGTCGCTTT, as shown in sequence table SEQ IDNo.6.
Second aspect present invention provides a kind of method detecting vibrios, it is characterized in that: described method comprises the step that the following one or more pairs of primer pair template of use carries out pcr amplification:
ToxR gene primer pair:
Upstream primer toxR-F sequence is: TGCAAGTAAAGATCCTGATG, as shown in sequence table SEQ IDNo.1;
Downstream primer toxR-R sequence is: GTCGTAAACAAAATGACACAA, as shown in sequence table SEQ IDNo.2;
FlaA gene primer pair:
Upstream primer flaA-F sequence is: TTACGCAGAAGCGGTGAT, as shown in sequence table SEQ IDNo.3;
Downstream primer flaA-R sequence is: GCTGTTGGATGAAGGGTC, as shown in sequence table SEQ IDNo.4;
PyrH gene primer pair:
Upstream primer pyrH-F sequence is: AAAGAACTGGTTGAACTGGGTG, as shown in sequence table SEQ IDNo.5;
Downstream primer pyrH-R sequence is: CCATCAACTTTCGTCGCTTT, as shown in sequence table SEQ IDNo.6.
Preferably, the annealing temperature of described pcr amplification is 54-56 DEG C.Ensure effectively annealing, primer is fully combined with template, effectively reduces non-specific binding simultaneously.
Be more preferably, the response procedures of described pcr amplification is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 54-56 DEG C of annealing 30s, 72 DEG C extend 30-75s, 35 circulations; 72 DEG C of reaction 5min.
Preferably, the preparation method of described template is: by centrifugal for gained bacterium liquid after shaking culture 12-24h at 35-38 DEG C, tested bacteria sample, collects thalline and dilutes with 150 μ L sterilized waters and obtain template.Directly utilize viable bacteria to build PCR system as template, eliminate the step extracting DNA from bacterium, operate more simple and convenient.
Be more preferably, described cultivation adopts LB liquid nutrient medium.
Be more preferably, the reaction system of described pcr amplification is the reaction system of 25 μ L, and it comprises: PCR damping fluid 2-3 μ L, the dNTP2 μ L of 10mmol/L, archaeal dna polymerase 0.2-0.4 μ L, upstream primer, downstream primer each 0.8-1 μ L, template 0.8-1 μ L, sterilized water surplus.
Preferred further, the concentration of described upstream primer, downstream primer is 9-11 μm of ol/L.
Below in conjunction with embodiment, vibrios detection primer provided by the invention and detection method are further described.
Embodiment 1: the detection method of vibrios
The present embodiment adopts toxR gene primer to detect separately vibrios according to following key step:
(1) bacterium special primer preparation
NCBI downloads the toxin expression regulation protein gene toxR of vibrio fluvialis, and primer sequence is designed by PrimerPremier5.0, toxR gene primer to sequence in table 1.
Table 1toxR gene primer pair
(2) acquisition of microbial culture and template
The single colony inoculation of vibrio fluvialis cultivated according to the requirement picking of aseptic technique is placed in 38 DEG C in 5mLLB liquid nutrient medium, 200rpm shaking culture 12 ~ 24h, until bacterium liquid is muddy, take out 1.5mL bacterium liquid and be placed in 1.5mLEP pipe, the centrifugal 1min of 12000rpm collects thalline, dilutes thalline as pcr template with sterilized water 150 μ L.Described vibrio fluvialis derives from country of The Ministry of Agriculture of the People's Republic of China, MOA hydrocoles cause of disease storehouse.
(3) pcr amplification
Adopt the reaction system of 25 μ L to carry out pcr amplification, reaction system is: bacterium liquid template 1 μ L, and concentration is 10 μm of each 1 μ L of ol/L primer toxR-F, toxR-R, PCR damping fluid 2.5 μ L, the archaeal dna polymerase 0.25 μ L of 10mMdNTP2 μ L, 5 Μ/μ L, sterilized water 17.25 μ L.
The response procedures of pcr amplification amplification is: 95 DEG C of denaturation 5min, 95 DEG C of sex change 30s, 55 DEG C of annealing 30s, and 72 DEG C extend 30s, 35 circulations, 72 DEG C of reaction 5min.
(4) detected result judges
Get 0.3g agarose and be dissolved in 30ml electrophoretic buffer, boil after mixing, to be cooled to about 60 DEG C time add the ethidium bromide that final concentration is 0.5 μ g/ml, topple over gel slab.After gel cooled and solidified, pcr amplification product 5 μ l is mixed with equivalent sample-loading buffer, adds in gel pore and carry out electrophoresis, 5V/cm electrophoresis 40min.Electrophoresis terminates to observe under rear taking-up gel is placed in ultraviolet lamp, take pictures.The band of pcr amplification is 228bp, consistent with object stripe size, has namely identified vibrios, and can confirm as vibrio fluvialis further.
Embodiment 2: the detection method of vibrios
The present embodiment adopts flaA gene primer to detect separately to vibrios according to following key step:
(1) bacterium special primer preparation
NCBI downloads the flagellin flaA gene of Vibrio anguillarum, and primer sequence is designed by PrimerPremier5.0, flaA gene primer to sequence in table 2.
Table 2flaA gene primer pair
(2) acquisition of microbial culture and template
The single colony inoculation of Vibrio anguillarum cultivated according to the requirement picking of aseptic technique is placed in 37 DEG C in 5mLLB liquid nutrient medium, 200rpm shaking culture 12 ~ 24h, until bacterium liquid is muddy, take out 1.5mL bacterium liquid and be placed in 1.5mLEP pipe, the centrifugal 1min of 12000rpm collects thalline, dilutes thalline as pcr template with sterilized water 175 μ L.Described Vibrio anguillarum derives from country of The Ministry of Agriculture of the People's Republic of China, MOA hydrocoles cause of disease storehouse.
(3) pcr amplification
Adopt the reaction system of 25 μ L to carry out pcr amplification, reaction system is: template 0.8 μ L, and concentration is 10 μm of each 1 μ L of ol/L primer toxR-F, toxR-R, PCR damping fluid 2.5 μ L, the archaeal dna polymerase 0.5 μ L of 10mMdNTP1 μ L, 5 Μ/μ L, sterilized water 18.2 μ L.
The response procedures of pcr amplification amplification is: 94 DEG C of denaturation 5min, 94 DEG C of sex change 60s, 56 DEG C of annealing 30s, and 71 DEG C extend 75s, 35 circulations, 72 DEG C of reaction 5min.
(4) detected result judges
Get 0.3g agarose and be dissolved in 30ml electrophoretic buffer, boil after mixing, to be cooled to about 60 DEG C time add the ethidium bromide that final concentration is 0.5 μ g/ml, topple over gel slab.After gel cooled and solidified, pcr amplification product 5 μ l is mixed with equivalent sample-loading buffer, adds in gel pore and carry out electrophoresis, 5V/cm electrophoresis 40min.Electrophoresis terminates to observe under rear taking-up gel is placed in ultraviolet lamp, take pictures.The band of pcr amplification is 1665bp, consistent with object stripe size, has namely identified vibrios, and can confirm as Vibrio anguillarum further.
Embodiment 3: the detection method of vibrios
The present embodiment adopts pyrH gene primer to detect separately to vibrios according to following key step:
(1) bacterium special primer preparation
NCBI downloads the pyrH gene of vibrio alginolyticus, and primer sequence is designed by PrimerPremier5.0, pyrH gene primer to sequence in table 3.
Table 3pyrH gene primer pair
(2) acquisition of microbial culture and template
The single colony inoculation of vibrio alginolyticus cultivated according to the requirement picking of aseptic technique is placed in 37 DEG C in 5mLLB liquid nutrient medium, 200rpm shaking culture 12 ~ 24h, until bacterium liquid is muddy, take out 1.5mL bacterium liquid and be placed in 1.5mLEP pipe, the centrifugal 1min of 12000rpm collects thalline, dilutes thalline as pcr template with sterilized water 130 μ L.Described vibrio alginolyticus derives from country of The Ministry of Agriculture of the People's Republic of China, MOA hydrocoles cause of disease storehouse.
(3) pcr amplification
Adopt the reaction system of 25 μ L to carry out pcr amplification, reaction system is: template 1 μ L, and concentration is 10 μm of each 1 μ L of ol/L primer pyrH-F, pyrH-R, PCR damping fluid 2.5 μ L, the archaeal dna polymerase 0.25 μ L of 10mMdNTP1.5 μ L, 5 Μ/μ L, sterilized water 17.75 μ L.
The response procedures of pcr amplification amplification is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, 54 DEG C of annealing 35s, and 72 DEG C extend 35s, 35 circulations, 72 DEG C of reaction 5min.
(4) detected result judges
Get 0.3g agarose and be dissolved in 30ml electrophoretic buffer, boil after mixing, to be cooled to about 60 DEG C time add the ethidium bromide that final concentration is 0.5 μ g/ml, topple over gel slab.After gel cooled and solidified, pcr amplification product 5 μ l is mixed with equivalent sample-loading buffer, adds in gel pore and carry out electrophoresis, 5V/cm electrophoresis 40min.Electrophoresis terminates to observe under rear taking-up gel is placed in ultraviolet lamp, take pictures.The band of pcr amplification is 383bp, consistent with object stripe size, has namely identified vibrios, and can confirm as vibrio alginolyticus further.
The specific detection that embodiment 4:toxR gene primer is right to, pyrH gene primer to, flaA gene primer
In order to verify toxR gene primer pair, flaA gene primer pair, the specificity that pyrH gene primer is right, adopt toxR gene primer to respectively to vibrio fluvialis template, Vibrio anguillarum template, vibrio alginolyticus template, Vibrio parahaemolyticus template carries out pcr amplification, adopt flaA gene primer to respectively to vibrio fluvialis template, Vibrio anguillarum template, vibrio alginolyticus template, Vibrio parahaemolyticus template carries out pcr amplification, adopt pyrH gene primer to respectively to vibrio fluvialis template, Vibrio anguillarum template, vibrio alginolyticus template, Vibrio parahaemolyticus template carries out pcr amplification, the product of these 12 groups of pcr amplification gained is carried out detected through gel electrophoresis, judge whether non-specific amplification.
Wherein, described vibrio fluvialis template is template used with embodiment 1, and described Vibrio anguillarum template is template used with embodiment 2, and described vibrio alginolyticus template is template used with embodiment 3.
Described Vibrio parahaemolyticus template is prepared as follows: the single colony inoculation of Vibrio parahaemolyticus cultivated according to the requirement picking of aseptic technique is placed in 37 DEG C in 5mLLB liquid nutrient medium, 200rpm shaking culture 12 ~ 24h, until bacterium liquid is muddy, take out 1.5mL bacterium liquid and be placed in 1.5mLEP pipe, the centrifugal 1min of 12000rpm collects thalline, dilutes thalline as Vibrio parahaemolyticus template with sterilized water 150 μ L.Described Vibrio parahaemolyticus derives from country of The Ministry of Agriculture of the People's Republic of China, MOA hydrocoles cause of disease storehouse.
The reaction system of described pcr amplification is: template 1 μ L, and concentration is 10 μm of ol/L upstream primers, each 1 μ L of downstream primer, the archaeal dna polymerase 0.5 μ L of PCR damping fluid 2.5 μ L, 10mMdNTP1.5 μ L, 5 Μ/μ L, sterilized water 17.5 μ L.
The response procedures of described pcr amplification is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 50s, 55 DEG C of annealing 50s, and 72 DEG C extend 70s, 35 circulations, 72 DEG C of reaction 5min.
By increasing, the product obtained carries out detected through gel electrophoresis respectively.Get 0.3g agarose and be dissolved in 30ml electrophoretic buffer, boil after mixing, to be cooled to about 60 DEG C time add the ethidium bromide that final concentration is 0.5 μ g/ml, topple over gel slab.After gel cooled and solidified, respectively 12 groups of pcr amplification product 5 μ l are mixed with equivalent sample-loading buffer, add in gel pore and carry out electrophoresis, 5V/cm electrophoresis 40min.Electrophoresis terminates to observe under rear taking-up gel is placed in ultraviolet lamp, take pictures, and specific detection result as shown in Figure 1.
Embodiment 5: the sensitivity test of detection method
Test the sensitivity of detection method, measure the minimum template concentrations of the vibrios amplified band that can detect, step is as follows:
The vibrio fluvialis cultivated according to the requirement picking of aseptic technique, Vibrio anguillarum and the single bacterium colony of vibrio alginolyticus are inoculated in respectively in 5mLLB liquid nutrient medium and are placed in 37 DEG C, 200rpm shaking culture 12 ~ 24h, in 1:100 ratio respectively renewed vaccination be incubated in 5mLLB liquid nutrient medium, 37 DEG C, the cultivation of 200rpm shaken overnight, until bacterium liquid is muddy, take out 1.5mL cultivation bacterium liquid and be placed in 1.5mlEP pipe, the centrifugal 1min of 12000rpm collects thalline.With the deionized water of sterilizing, by the dilution gradient dilution to 10 of 10 times
-8, carry out pcr amplification with difference dilution bacterium liquid 4 μ L for template respectively, carry out negative control with sterilized water simultaneously.Separately get 10
-5~ 10
-7three dilution gradients are coated on LB agar plate respectively, count, estimate the bacterial concentration under each dilution gradient according to count results after 37 DEG C of cultivation 12h.
Adopt toxR gene primer to carrying out pcr amplification to the vibrio fluvialis template of different concns respectively, adopting flaA gene primer to carrying out pcr amplification to the Vibrio anguillarum template of different concns respectively, adopting pyrH gene primer to carrying out pcr amplification to the vibrio alginolyticus template of different concns respectively.
The reaction system of described pcr amplification is: template 4 μ L, and concentration is 11 μm of ol/L upstream primers, each 1 μ L of downstream primer, the archaeal dna polymerase 0.5 μ L of PCR damping fluid 2.5 μ L, 10mMdNTP1.5 μ L, 5 Μ/μ L, sterilized water 15.5 μ L.
The response procedures of described pcr amplification is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 50s, 55 DEG C of annealing 50s, and 72 DEG C extend 70s, 35 circulations, 72 DEG C of reaction 5min.
By increasing, the product obtained carries out detected through gel electrophoresis respectively.Get 0.3g agarose and be dissolved in 30ml electrophoretic buffer, boil after mixing, to be cooled to about 60 DEG C time add the ethidium bromide that final concentration is 0.5 μ g/ml, topple over gel slab.After gel cooled and solidified, respectively pcr amplification product 5 μ l is mixed with equivalent sample-loading buffer, add in gel pore and carry out electrophoresis, 5V/cm electrophoresis 40min.Electrophoresis terminates to observe under rear taking-up gel is placed in ultraviolet lamp, take pictures, and determines the minimum template concentrations that bacterium amplified band can be detected according to electrophoresis detection result.To the sensitivity test result of vibrio fluvialis as shown in Figure 2, to the sensitivity test result of Vibrio anguillarum as shown in Figure 3, to the sensitivity test result of vibrio alginolyticus as shown in Figure 4.
The appraisable minimum template concentrations of vibrio fluvialis is 5.21 × 10 as seen from Figure 2
2cfu/mL, the appraisable minimum template concentrations of Vibrio anguillarum is 2.70 × 10 as seen from Figure 3
4cfu/mL, the appraisable minimum template concentrations of vibrio alginolyticus is 2.48 × 10 as seen from Figure 4
2cfu/mL.
Embodiment 6: the method simultaneously detecting two or three vibrios in vibrio fluvialis, Vibrio anguillarum and vibrio alginolyticus
Mix vibrio fluvialis template, Vibrio anguillarum template, vibrio alginolyticus template, each 0.5 μ L of Vibrio parahaemolyticus template as pcr template, the preparation method of each template is with embodiment 4.
Experimental group 1 is set respectively, experimental group 2, experimental group 3, experimental group 4 and blank group, wherein experimental group 1 adopts flaA gene primer pair, toxR gene primer carries out multiplexed PCR amplification to pyrH gene primer to pcr template, experimental group 2 adopts flaA gene primer to carry out double PCR amplification to toxR gene primer to pcr template, experimental group 3 adopts toxR gene primer to carry out double PCR amplification to pyrH gene primer to pcr template, experimental group 4 adopts flaA gene primer to carry out double PCR amplification to pyrH gene primer to pcr template, blank group is not for adopt primer to carry out pcr amplification.
The reaction system of described pcr amplification is 25 μ L reaction systems, is specially: pcr template 2 μ L, and concentration is 10 μm of ol/L upstream primers, each 1 μ L of downstream primer, PCR damping fluid 2.5 μ L, the archaeal dna polymerase 0.5 μ L of 10mMdNTP1.5 μ L, 5 Μ/μ L, surplus is sterilized water.
The response procedures of described pcr amplification is: 95 DEG C of denaturation 3min, 95 DEG C of sex change 50s, 55 DEG C of annealing 50s, and 72 DEG C extend 70s, 35 circulations, 72 DEG C of reaction 5min.
By increasing, the product obtained carries out detected through gel electrophoresis respectively.Get 0.3g agarose and be dissolved in 30ml electrophoretic buffer, boil after mixing, to be cooled to about 60 DEG C time add the ethidium bromide that final concentration is 0.5 μ g/ml, topple over gel slab.After gel cooled and solidified, respectively pcr amplification product 5 μ l is mixed with equivalent sample-loading buffer, add in gel pore and carry out electrophoresis, 5V/cm electrophoresis 40min.Electrophoresis terminates to observe under rear taking-up gel is placed in ultraviolet lamp, take pictures, and electrophoresis result as shown in Figure 5.
As can be seen from Figure 5, toxR gene primer can amplify size to the combination of the primer pair with flaA gene simultaneously and be respectively 1665bp and 228bp two goal gene bands; ToxR gene primer can amplify size to the combination right with pyrH gene primer simultaneously and be respectively 228bp and 383bp two goal gene bands; FlaA gene primer can amplify size to the combination right with pyrH gene primer simultaneously and be respectively 1665bp and 383bp two goal gene bands; ToxR gene primer is respectively 1665bp, 228bp, 383bp tri-goal gene bands to can amplify size with the primer pair of flaA gene and the right combination of pyrH gene primer simultaneously.Namely by adding the difference of the combination of primer pair, can realize detecting to determine pathogenic bacterium kind while two or three vibrios in vibrio fluvialis, Vibrio anguillarum and vibrio alginolyticus, and target stripe is very clear, occurs without other assorted bands, specificity is high, and test result accurately and reliably.
ToxR gene is the ancestral gene of vibrios, and its coding comprises the transmembrane protein in transcriptional activity district, cross-film district and pericentral siphon district, mainly plays virulence gene expression and regulates and controls; The flagellum of vibrios is the virulence organoid infecting fish, and the fibril of flagellum is by flagellin A, i.e. flaA, and the flagellin flaB that 3 additional, and C, D form, and wherein flaA plays vital effect in the invasion and attack of host; PyrH is one of principal causative gene of vibrios.Thus the present invention devises vibrio fluvialis toxR gene respectively, the special primer of the flaA gene of Vibrio anguillarum and the pyrH gene of vibrio alginolyticus, adopt PCR method, establish the detection method that can detect separately these three kinds of vibrios and detect these three kinds of vibrios simultaneously, the kind of pathogenic bacterium can be detected quickly and easily, improve determination rates, the band of vibrio fluvialis, Vibrio anguillarum and vibrio alginolyticus substance pcr amplification is respectively 228bp, 1665bp, 383bp, and high specificity consistent with object stripe size; Three kinds of detectable minimum concentrations of vibrios are 5.21 × 10
2cfu/mL, 2.70 × 10
4cfu/mL, 2.48 × 10
2cfu/mL, sensitivity is higher, and result accuracy is high.
The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (8)
1. detect the primer sets of vibrios, it is characterized in that: comprise following one or more pairs of primer:
ToxR gene primer pair:
Upstream primer toxR-F sequence is: TGCAAGTAAAGATCCTGATG, i.e. sequence table SEQ IDNo.1;
Downstream primer toxR-R sequence is: GTCGTAAACAAAATGACACAA, i.e. sequence table SEQ IDNo.2;
FlaA gene primer pair:
Upstream primer flaA-F sequence is: TTACGCAGAAGCGGTGAT, i.e. sequence table SEQ IDNo.3;
Downstream primer flaA-R sequence is: GCTGTTGGATGAAGGGTC, i.e. sequence table SEQ IDNo.4;
PyrH gene primer pair:
Upstream primer pyrH-F sequence is: AAAGAACTGGTTGAACTGGGTG, i.e. sequence table SEQ IDNo.5;
Downstream primer pyrH-R sequence is: CCATCAACTTTCGTCGCTTT, i.e. sequence table SEQ IDNo.6.
2. detect a method for vibrios, it is characterized in that: described method comprises the step that the following one or more pairs of primer pair template of use carries out pcr amplification:
ToxR gene primer pair:
Upstream primer toxR-F sequence is: TGCAAGTAAAGATCCTGATG, i.e. sequence table SEQ IDNo.1;
Downstream primer toxR-R sequence is: GTCGTAAACAAAATGACACAA, i.e. sequence table SEQ IDNo.2;
FlaA gene primer pair:
Upstream primer flaA-F sequence is: TTACGCAGAAGCGGTGAT, i.e. sequence table SEQ IDNo.3;
Downstream primer flaA-R sequence is: GCTGTTGGATGAAGGGTC, i.e. sequence table SEQ IDNo.4;
PyrH gene primer pair:
Upstream primer pyrH-F sequence is: AAAGAACTGGTTGAACTGGGTG, i.e. sequence table SEQ IDNo.5;
Downstream primer pyrH-R sequence is: CCATCAACTTTCGTCGCTTT, i.e. sequence table SEQ IDNo.6.
3. the method detecting vibrios as claimed in claim 2, is characterized in that: the annealing temperature of described pcr amplification is 54-56 DEG C.
4. the method detecting vibrios as claimed in claim 3, is characterized in that: the response procedures of described pcr amplification is: 94-95 DEG C of denaturation 5min; 94-95 DEG C of sex change 30s, 54-56 DEG C of annealing 30s, 72 DEG C extend 30-75s, 35 circulations; 72 DEG C of reaction 5min.
5. the method for the detection vibrios as described in any one of claim 2 to 4 claim, it is characterized in that: the preparation method of described template is: by centrifugal for gained bacterium liquid after shaking culture 12-24h at 35-38 DEG C, tested bacteria sample, collect thalline and dilute with 150 μ L sterilized waters and obtain template.
6. the method detecting vibrios as claimed in claim 5, is characterized in that: described cultivation adopts LB liquid nutrient medium.
7. the method detecting vibrios as claimed in claim 5, it is characterized in that: the reaction system of described pcr amplification is the reaction system of 25 μ L, it comprises: PCR damping fluid 2-3 μ L, the dNTP2 μ L of 10mmol/L, archaeal dna polymerase 0.2-0.4 μ L, upstream primer, downstream primer each 0.8-1 μ L, template 0.8-1 μ L, sterilized water surplus.
8. the method detecting vibrios as claimed in claim 7, is characterized in that: the concentration of described upstream primer, downstream primer is 9-11 μm of ol/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510438179.3A CN105132532A (en) | 2015-07-24 | 2015-07-24 | Vibrio detecting primer group and detecting method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510438179.3A CN105132532A (en) | 2015-07-24 | 2015-07-24 | Vibrio detecting primer group and detecting method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105132532A true CN105132532A (en) | 2015-12-09 |
Family
ID=54718098
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510438179.3A Pending CN105132532A (en) | 2015-07-24 | 2015-07-24 | Vibrio detecting primer group and detecting method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105132532A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755550A (en) * | 2017-03-16 | 2017-05-31 | 辽宁大学 | The PCR detection method of vibrio alginolyticus in a kind of aquiculture animal body |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1113473A (en) * | 1994-03-29 | 1995-12-20 | 三洋电机株式会社 | Electric bicycle |
| CN101067155A (en) * | 2007-06-05 | 2007-11-07 | 宁波大学 | Marine vibrio multiple PCR reaction reagent kit and detecting method thereof |
| CN101140243A (en) * | 2007-09-29 | 2008-03-12 | 上海水产大学 | Method for detecting vibrio parahaemolyticus |
| CN101633952A (en) * | 2009-03-20 | 2010-01-27 | 邵碧英 | Detecting kit for five kinds of pathogenic vibrio in aquatic product and detecting method thereof |
| CN102816840A (en) * | 2012-07-19 | 2012-12-12 | 宁波检验检疫科学技术研究院 | Multiplex fluorescent PCR kit for detection of vibrios in water body and detection method. |
| CN103103266A (en) * | 2013-01-18 | 2013-05-15 | 大连海洋大学 | Multiplex-polymerase chain reaction (PCR) detection method capable of simultaneously detecting vibrio parahaemolyticus, vibrio vulnificus and vibrio alginolyticus |
| CN103614486A (en) * | 2013-12-12 | 2014-03-05 | 胡成进 | Detection kit for vibrio alginnolyficus |
| KR101531289B1 (en) * | 2015-02-12 | 2015-06-24 | 대한민국 | Method for Detecting Vibrio Bacteria Including Vibrio scophthalmi Using Multiplex PCR |
-
2015
- 2015-07-24 CN CN201510438179.3A patent/CN105132532A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1113473A (en) * | 1994-03-29 | 1995-12-20 | 三洋电机株式会社 | Electric bicycle |
| CN101067155A (en) * | 2007-06-05 | 2007-11-07 | 宁波大学 | Marine vibrio multiple PCR reaction reagent kit and detecting method thereof |
| CN101140243A (en) * | 2007-09-29 | 2008-03-12 | 上海水产大学 | Method for detecting vibrio parahaemolyticus |
| CN101633952A (en) * | 2009-03-20 | 2010-01-27 | 邵碧英 | Detecting kit for five kinds of pathogenic vibrio in aquatic product and detecting method thereof |
| CN102816840A (en) * | 2012-07-19 | 2012-12-12 | 宁波检验检疫科学技术研究院 | Multiplex fluorescent PCR kit for detection of vibrios in water body and detection method. |
| CN103103266A (en) * | 2013-01-18 | 2013-05-15 | 大连海洋大学 | Multiplex-polymerase chain reaction (PCR) detection method capable of simultaneously detecting vibrio parahaemolyticus, vibrio vulnificus and vibrio alginolyticus |
| CN103614486A (en) * | 2013-12-12 | 2014-03-05 | 胡成进 | Detection kit for vibrio alginnolyficus |
| KR101531289B1 (en) * | 2015-02-12 | 2015-06-24 | 대한민국 | Method for Detecting Vibrio Bacteria Including Vibrio scophthalmi Using Multiplex PCR |
Non-Patent Citations (4)
| Title |
|---|
| ANGELA等: "A collagenase-targeted multiplex PCR Assay for Identification of Vibrio alginolyticus, Vibrio cholerae, and Vibrio papahaemolyticus", 《JOURNAL OF FOOD PROTECTION》 * |
| 刘阳等: "多重PCR技术同时检测副溶血弧菌和溶藻弧菌方法的建立与初步应用", 《中国畜牧兽医学会畜牧兽医生物技术学分会暨中国免疫学会兽医免疫分会第九次学术研讨会 论文集》 * |
| 李贵阳等: "六种弧菌多重PCR快速检测方法的建立", 《现代生物医学进展》 * |
| 贾清等: "河弧菌Taqman实时荧光PCR检测方法建立", 《中国公共卫生》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755550A (en) * | 2017-03-16 | 2017-05-31 | 辽宁大学 | The PCR detection method of vibrio alginolyticus in a kind of aquiculture animal body |
| CN106755550B (en) * | 2017-03-16 | 2020-12-08 | 辽宁大学 | PCR detection method for vibrio alginolyticus in aquaculture animal |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Effects of potential probiotic Bacillus velezensis K2 on growth, immunity and resistance to Vibrio harveyi infection of hybrid grouper (Epinephelus lanceolatus♂× E. fuscoguttatus♀) | |
| Qi et al. | Ammonia exposure alters the expression of immune-related and antioxidant enzymes-related genes and the gut microbial community of crucian carp (Carassius auratus) | |
| Liu et al. | Characterization of two pathogenic Photobacterium strains isolated from Exopalaemon carinicauda causing mortality of shrimp | |
| Sreedharan et al. | Characterization and virulence potential of phenotypically diverse Aeromonas veronii isolates recovered from moribund freshwater ornamental fishes of Kerala, India | |
| Aguilera-Rivera et al. | A vibriosis outbreak in the Pacific white shrimp, Litopenaeus vannamei reared in biofloc and clear seawater | |
| El-Sayed et al. | Pathogenicity, genetic typing, and antibiotic sensitivity of Vibrio alginolyticus isolated from Oreochromis niloticus and Tilapia zillii | |
| Barnes | Enteric redmouth disease (ERM)(Yersinia ruckeri). | |
| Azandégbé et al. | Occurrence and seasonality of Vibrio aestuarianus in sediment and Crassostrea gigas haemolymph at two oyster farms in France | |
| Zheng et al. | Grass carp (Ctenopharyngodon idellus) infected with multiple strains of Aeromonas hydrophila | |
| Gao et al. | Pathogenicity of non-O1/O139 Vibrio cholerae and its induced immune response in Macrobrachium rosenbergii | |
| Qiao et al. | Microbiological characteristics of Vibrio scophthalmi isolates from diseased olive flounder Paralichthys olivaceus | |
| Kumar et al. | Wildlife (Boselaphus tragocamelus)–small ruminant (goat and sheep) interface in the transmission of ‘Bison type’genotype of Mycobacterium avium subspecies paratuberculosis in India | |
| Mallik et al. | Characterization and pathogenicity of Aeromonas veronii associated with mortality in cage farmed grass carp, Ctenopharyngodon idella (Valenciennes, 1844) from the Central Himalayan region of India | |
| Grove et al. | Previously unrecognised division within Moritella viscosa isolated from fish farmed in the North Atlantic | |
| CN104152368A (en) | Tilapia mossambica source streptococcus agalactiae low virulent strain and application thereof | |
| Santos et al. | Plesiomonas | |
| Kumru et al. | Genomic diversity in flavobacterial pathogens of aquatic origin | |
| CN104073450A (en) | Goat source arcanobacterium pyogenes and application thereof | |
| Aboyadak et al. | Non-selectivity of RS media for Aeromonas hydrophila and TCBS media for Vibrio species isolated from diseased Oreochromis niloticus | |
| Madhusudana et al. | Detection of ctx gene positive non-O1/non-O139 V. cholerae in shrimp aquaculture environments | |
| Galvis et al. | Vibrio neptunius produces piscibactin and amphibactin and both siderophores contribute significantly to virulence for clams | |
| Li et al. | Enterobacter asburiae E7, a novel potential probiotic, enhances resistance to Aeromonas veronii infection via stimulating the immune response in Common carp (Cyprinus carpio) | |
| Bhat et al. | Lethal dose and histopathological alterations induced by Aeromonas salmonicida in experimentally challenged common carp, Cyprinus carpio | |
| Song et al. | Isolation and characterization of Aeromonas veronii from ornamental fish species in China | |
| Pradhan et al. | Isolation of Aeromonas salmonicida subspecies salmonicida from aquaculture environment in India: Polyphasic identification, virulence characterization, and antibiotic susceptibility |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151209 |