CN106755550A - The PCR detection method of vibrio alginolyticus in a kind of aquiculture animal body - Google Patents
The PCR detection method of vibrio alginolyticus in a kind of aquiculture animal body Download PDFInfo
- Publication number
- CN106755550A CN106755550A CN201710157709.6A CN201710157709A CN106755550A CN 106755550 A CN106755550 A CN 106755550A CN 201710157709 A CN201710157709 A CN 201710157709A CN 106755550 A CN106755550 A CN 106755550A
- Authority
- CN
- China
- Prior art keywords
- vibrio alginolyticus
- specific primer
- vibrio
- pcr
- aquiculture animal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of PCR detection method of vibrio alginolyticus in aquiculture animal body.Extract the STb gene of aquiculture animal tissue;It is template with the DNA for being extracted, using vibrio alginolyticus specific primer, enters performing PCR amplification;Described vibrio alginolyticus specific primer is directed to the specific primer P3 of specific primer P2, toxR gene of specific primer P1, toxR gene of the topA genes of strain vibrio alginolyticus;Ago-Gel imaging result according to pcr amplification product judges whether aquiculture animal is infected by vibrio alginolyticus.It is more easy the invention enables the detection that vibrio alginolyticus is remained in aquiculture animal body, provide necessary theoretical foundation and perfect method system to remain vibrio alginolyticus detection and analysis in aquiculture animal body from now on, while being that China's aquatic products detection of pathogens and China's food import and export lay the foundation safely.
Description
Technical field
The invention belongs to the pathogenic microorganism examination field, common cause of disease in a kind of Aquatic farming animals is specifically related to
Bacterium:The PCR detection method of vibrio alginolyticus (Vibrio alginolyticus).
Background technology
Vibrio alginolyticus (Vibrio alginolyticus) is a kind of gram-negative halophilic vibrio, in seawater, marine products
Recall rate in product and food is higher, and it is one of normal flora in ocean, is present in various marine animals, is fishes and shrimps shellfish etc.
The conditioned pathogen of marine cultured animal, huge economic loss is caused to culture fishery.Vibrio alginolyticus can also cause human body
Wound infection and septicemia.In recent years, vibrio alginolyticus causes the report of food poisoning and gastroenteritis of common occurrence, the main table of symptom
It is now the symptoms of digestive tract such as different degrees of headache, dizziness, weak, stomachache, nausea.Therefore, vibrio alginolyticus causes abdomen as one kind
The pathogen for rushing down bacterium and influence food security is increasingly subject to pay attention to.
Mainly there are bacteria bio method, immunological detection method, denaturation high to vibrio alginolyticus detection method both at home and abroad at present
Effect liquid phase chromatogram, loop-mediated isothermal amplification technology, molecular biosciences detection method.But it is complicated to there is detection method, sensitivity difference etc.
Problem.
The content of the invention
It is an object of the invention to provide vibrio alginolyticus in a kind of aquiculture animal (Vibrio alginolyticus)
PCR detection method.The method of the present invention can Rapid identification etiology, be that the safety and aquatic food of China's aquiculture animal are entered
Exit provides technical support.
The technical solution adopted by the present invention is:A kind of PCR detection method of vibrio alginolyticus in aquiculture animal body, method is as follows:
1) STb gene of aquiculture animal tissue is extracted;
2) it is template with the DNA for being extracted, using vibrio alginolyticus specific primer, enters performing PCR amplification;Described molten algae
The specificity that vibrios specific primer is directed to specific primer P1, toxR gene of the topA genes of vibrio alginolyticus is drawn
The specific primer P3 of thing P2, toxR gene;
The sequence of described specific primer P1 is:P1-F:TCGCTTCATGGACCGTGTC;P1-R:
GGCGCTTAGGTTAGTCGAGT。
The sequence of described specific primer P2 is:P2-F:CTGACGTTGAAGAAGCCACTT;P2-R:
GGCGTCATCACAGGTACATTTT。
The sequence of described specific primer P3 is:P3-F:CCTAAACGCGGTTATCAACTCA;P3-R:
GGCGTCATCACAGGTACATTTT。
PCR reaction conditions:First stage:94℃5min;
Second stage:94 DEG C of 30s, 60 DEG C or 69 DEG C of 30s, 72 DEG C of 30s;30 circulations;
Phase III:72℃5min;
Fourth stage:4 DEG C of preservations.
3) whether the Ago-Gel imaging result according to pcr amplification product judges aquiculture animal by vibrio alginolyticus sense
Dye.
Criterion is:
For specific primer P1, if the Ago-Gel imaging result of pcr amplification product has 484bp bands to produce,
Then aquiculture animal is infected by vibrio alginolyticus, is not infected otherwise.
For specific primer P2, if the Ago-Gel imaging result of pcr amplification product has 286bp bands to produce,
Then turbot is infected by vibrio alginolyticus, is not infected otherwise.
For specific primer P3, if the Ago-Gel imaging result of pcr amplification product has 353bp bands to produce,
Then sea cucumber is infected by vibrio alginolyticus, is not infected otherwise.
The PCR detection method of vibrio alginolyticus in a kind of above-mentioned aquiculture animal body, described aquiculture animal is
Turbot, sea cucumber, loach fish, crab, climb shrimp, freshwater shrimp or salmon.
The beneficial effects of the invention are as follows:
1. of the invention, the vibrio alginolyticus specific primer of design effectively can distinguish molten algae from each common causative bacterial strain
Vibrios, shows very strong specificity.
2. of the invention, the vibrio alginolyticus specific primer of design, sensitivity is high, can effectively detect aquaculture product animal body
The vibrio alginolyticus of interior residual, its minimal detectable concentration can reach 10-5ng/ul。
3. the present invention, remains the PCR detection method of vibrio alginolyticus in the aquiculture animal body for being provided so that aquatic products is supported
Grow residual vibrio alginolyticus detection in animal body more easy.In aquiculture animal, once there is pathogen vibrio alginolyticus, i.e.,
Rapid identification can be accomplished, imported and exported for China's aquatic products and effective inspection method is provided.
4. detection method of the invention can effectively detect the high-risk pathogenic bacteria vibrio alginolyticus in aquiculture animal body, experience
This detection method high specificity is demonstrate,proved, sensitivity is high.Being asserted for the detection method remains cause of disease in aquiculture animal body from now on
The detection and analysis of bacterium vibrio alginolyticus provide necessary theoretical foundation and perfect method system, and only China's aquatic products do not enter
Export food safely provides technical support, while being made that contribution for China's aquaculture product food security develops in a healthy way.
Brief description of the drawings
Fig. 1 is the PCR reaction condition optimizations of the vibrio alginolyticus specific primer P1 of embodiment 1;
Wherein, M:Marker D, 1-5:Annealing temperature is respectively 65 DEG C, 66 DEG C, 67 DEG C, 68 DEG C, 69 DEG C.
Fig. 2 is the specificity verification of the vibrio alginolyticus specific primer P1 of embodiment 1;
Wherein, 1.Vibrio furnissi;2.Vibrio vulnificus;3.Vibrio hollisae;4.Vibrio
parahemolyticus5.Vibrio harveyi;6.Vibrio fluvialis;7.Vibrio campbellii;
8.Vibrio alginolyticus;9.Vibrio metschnikovii;10.Vibrio mimicus;11.Vibrio
cyclitrophicus;12.Aeromonas hydrophila;13.Aeromonas salmonicida;14.Aeromonas
sobria 15.Aeromonas veronii 16.Pseudomonas helmanticensis;17.Pseudomonas
aeruginosa;18.Pseudomonas kilonensis, M:Marker D.
Fig. 3 is the PCR draw properties checking of the vibrio alginolyticus specific primer P1 of embodiment 1.
Wherein, M:Marker D, 1-7:Template concentrations are respectively 101Ng/ul, 100Ng/ul, 10-1Ng/ul, 10-2ng/
Ul, 10-3Ng/ul, 10-4Ng/ul, 10-5ng/ul。
Fig. 4 be the vibrio alginolyticus specific primer P1 of embodiment 1 to the gel of different aquiculture animal pcr amplification products into
As result;
Wherein, M:Marker D, 1-7 are respectively turbot, sea cucumber, loach fish, the crab of injection 0.1ml vibrio alginolyticus bacterium solutions
Crab, climb shrimp, freshwater shrimp, salmon tissue;8-14 is respectively turbot, sea cucumber, loach fish, the crab of 0.90% physiological saline of injection
Crab, climb shrimp, freshwater shrimp, salmon tissue.
Fig. 5 is the PCR reaction condition optimizations of the vibrio alginolyticus specific primer P2 of embodiment 2;
Wherein, M:Marker DL 2000,1-5:Annealing temperature is respectively 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C.
Fig. 6 is the specificity verification of the vibrio alginolyticus specific primer P2 of embodiment 2;
Wherein, 1.Vibrio furnissi;2.Vibrio vulnificus;3.Vibrio hollisae;4.Vibrio
parahemolyticus;5.Vibrio harveyi;6.Vibrio fluvialis;7.Vibrio alginolyticus;
8.Vibrio campbellii;9.Vibrio metschnikovii;10.Vibrio mimicus 11.Vibrio
gigantis;12.Vibrio cyclitrophicus;13.Aeromonas hydrophila;14.Aeromonas
salmonicida;15.Aeromonas veronii;16.Pseudomonas helmanticensis;17.Pseudomonas
aeruginosa 18.Pseudomonas kilonensis;19.Bordetella trematum;M:Marker DL 2000.
Fig. 7 is the PCR draw properties checking of the vibrio alginolyticus specific primer P2 of embodiment 2.
Wherein, M:Marker D, 1-7:Template concentrations are respectively 102Ng/ul, 101Ng/ul, 100Ng/ul, 10-1Ng/ul,
10-2Ng/ul, 10-3Ng/ul, 10-4ng/ul。
Fig. 8 is that the vibrio alginolyticus specific primer P2 of embodiment 2 infects vibrio alginolyticus pcr amplification product to turbot artificial
Gel imaging result;
Wherein, M:Marker D, 1-7 are respectively the turbot musculature of injection 0.1ml vibrio alginolyticus bacterium solutions, 8-14 points
The turbot musculature of 0.90% physiological saline Wei not injected.
Fig. 9 is the PCR reaction condition optimizations of the vibrio alginolyticus specific primer P3 of embodiment 3;
Wherein, M:Marker DL 2000,1-5:Annealing temperature is respectively 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C.
Figure 10 is the specificity verification of the vibrio alginolyticus specific primer P3 of embodiment 3;
Wherein, 1.Vibrio furnissi;2.Vibrio vulnificus;3.Vibrio parahemolyticus;
4.Vibrio hollisae;5.Vibrio harveyi;6.Vibrio fluvialis;7.Vibrio campbellii;
8.Vibrio alginolyticus;9.Vibrio metschnikovii;10.Vibrio mimicus 11.Vibrio
gigantis;12.Vibrio cyclitrophicus;13.Aeromonas hydrophila;14.Aeromonas
salmonicida;15.Aeromonas veronii;16.Pseudomonas helmanticensis;17.Pseudomonas
aeruginosa 18.Pseudomonas kilonensis;19.Bordetella trematum;M:Marker DL 2000.
Figure 11 is the PCR draw properties checking of the vibrio alginolyticus specific primer P3 of embodiment 3.
Wherein, M:Marker D, 1-7:Template concentrations are respectively 102Ng/ul, 101Ng/ul, 100Ng/ul, 10-1Ng/ul,
10-2Ng/ul, 10-3Ng/ul, 10-4ng/ul。
Figure 12 is the vibrio alginolyticus specific primer P3 of embodiment 3 to sea cucumber artificial challenge's vibrio alginolyticus pcr amplification product
Gel imaging result;
Wherein, M:Marker D, 1-7 are respectively the sea cucumber tissue of injection 0.1ml vibrio alginolyticus bacterium solutions, and 8-14 is respectively note
Penetrate the sea cucumber tissue of 0.90% physiological saline.
Specific embodiment
The following examples will be further described to the present invention, but not thereby limiting the invention.
Embodiment 1
(1) design of vibrio alginolyticus specific primer P1
The present embodiment is directed to the topA genes of strain vibrio alginolyticus (Vibrio alginolyticus), using software
LSPrimer(http://ccsipb.lnu.edu.cn/primer/) and MEGA6 softwares, design to vibrio alginolyticus (Vibrio
Alginolyticus) there are high specificity and sensitivity a pair of specific primer P1 high, the vibrio alginolyticus specific primer
Specifying information is as shown in table 1.
Table 1
(2) exploration of the optimal PCR reaction conditions of vibrio alginolyticus specific primer P1
1st, the extraction of vibrio alginolyticus DNA
Using Ezup posts bordetella gene group DNA extraction agents box (bacterium), vibrio alginolyticus (Vibrio is extracted
Alginolyticus DNA), comprises the following steps that:
1.1) bacterium solution containing strain vibrio alginolyticus (Vibrio alginolyticus) of 1ml incubated overnights is taken, is added
In 1.5ml centrifuge tubes, room temperature 8000rmp centrifugation 1min abandon supernatant, and collects thalline adds 180ul Buffer Digestion,
20ul Proteinase K solution is added, concussion is mixed.56 DEG C of water-bath 1h are cracked to cell completely.During water-bath, every 10
Minute reverse mixing once, promotes cell cracking.
1.2) 200ul Buffer BD are added, it is fully reverse to mix.After adding Buffer BD, produced if any precipitation, can
70 DEG C of water-baths 10 minutes.
1.3) absolute ethyl alcohol of 200ul is added, it is fully reverse to mix.There may be translucent fibre after addition absolute ethyl alcohol
Shape suspension, the extraction and application of DNA are not influenceed.
1.4) adsorption column is put into collecting pipe, with pipettor by step 1.3) solution that obtains and translucent fibre shape it is outstanding
Float is all added in adsorption column, stands 2min, and 1min is centrifuged in 12000rmp room temperatures, outwells the waste liquid in collecting pipe.
1.5) in adsorption column being placed back in into collecting pipe, 500ul PW Solution, 10000rmp centrifugation 30s are added,
Fall collecting pipe filtrate.
1.6) adsorption column is placed back in into collecting pipe, adds 500ul Wash Solution, 10000rmp centrifugation 30s,
Fall filtrate.
1.7) in adsorption column being placed back in into collecting pipe, 2min is centrifuged in 12000rmp room temperatures, discards the Wash of residual
Solution.Adsorption column is opened into lid and places several minutes in room temperature, thoroughly to dry the Wash remained in sorbing material
The residual of Solution, Wash Solution can influence the yield of genomic DNA and follow-up experiment.
1.8) adsorption column is taken out, is put into a new 1.5ml centrifuge tube, add 50-200ul CE Buffer to stand
3min, 12000rmp room temperature are centrifuged 2min, collect DNA solution, the as DNA of vibrio alginolyticus.The DNA of extraction can be carried out down immediately
One step is tested or -20 DEG C of preservations.
2nd, the exploration of vibrio alginolyticus specific primer P1 optimum annealing temperatures
The DNA of the vibrio alginolyticus to extract is PCR and expands as template respectively, and the annealing temperature of purpose primer is set respectively
It is set to 65 DEG C, 66 DEG C, 67 DEG C, 68 DEG C, 69 DEG C, pcr amplification product electrophoresis in 1% agarose 1 × TAE buffer systems, per hole
Sample-adding 5ul, is observed and photographic recording with gel imaging system, determines that vibrio alginolyticus is special according to the Gel electrophoresis results after PCR
The optimum annealing temperature of property primer.Specific PCR reaction conditions and system are as shown in table 2, as a result such as Fig. 1.
The optimal PCR reactions exploration condition of the purpose primer of table 2
As seen from Figure 1, temperature is to the primer and has no significant effect, but according to PCR basic principles, temperature is more high more is conducive to
The specific binding of primer, therefore determine that optimum annealing temperature is 69 DEG C.
(3) the special sex exploration of vibrio alginolyticus specific primer P1
1st, the extraction of bacterial strain DNA to be tried
Using Ezup posts bordetella gene group DNA extraction agents box (bacterium), different strain as shown in table 3 is extracted respectively
DNA, specific steps step 1 in (two) as described above.
2nd, special sex exploration
Respectively with table 3, the DNA of the different strain of extraction does PCR amplifications, specific PCR reaction conditions and system for template
As shown in table 4, the Gel electrophoresis results after PCR are as shown in Figure 2.
The bacterial strain to be tried of table 3 is as follows:
The optimal PCR reaction conditions of the purpose primer of table 4
From Figure 2 it can be seen that vibrio alginolyticus specific primer of the invention is in vibrio, and Aeromonas and false unit cell
Very strong specificity is shown in Pseudomonas, specific amplification, rather than purpose bacterial strain can only be produced with purpose bacterial strain vibrio alginolyticus
Specific amplification is not produced.Therefore visible its shows very strong specificity.
(4) exploration of the sensitivity of vibrio alginolyticus specific primer P1
1st, the extraction of vibrio alginolyticus DNA
Using Ezup posts bordetella gene group DNA extraction agents box (bacterium), vibrio alginolyticus (Vibrio is extracted
Alginolyticus) the DNA of strain, specific steps step 1 in (two) as described above.
2nd, the exploration of sensitivity
The DNA concentration of vibrio alginolyticus is adjusted to 101Ng/ul, and 10 are diluted to successively0ng/ul、10-1ng/ul、10- 2ng/ul、10-3ng/ul、10-4ng/ul、10-5Ng/ul, takes 1ul DNA as PCR reaction templates respectively, and specific PCR reacts bar
As shown in table 5, the Gel electrophoresis results after PCR are as shown in Figure 3 for part and system.
The optimal PCR reactions exploration condition of the purpose primer of table 5
As seen from Figure 3, vibrio alginolyticus specific primer of the invention is 10 in vibrio alginolyticus DNA concentration1ng/ul、100ng/
ul、10-1ng/ul、10-2ng/ul、10-3ng/ul、10-4ng/ul、10-5Ng/ul, when can produce specific amplification, its is minimum
Detectable concentration can reach 10-5ng/ul。
(5) in aquiculture animal body vibrio alginolyticus PCR detection method
1st, the STb gene of aquiculture animal tissue is extracted;
Using Ezup Zhu Shi Animal genome DNA extraction agent boxes, the DNA of aquiculture animal tissue, specific step are extracted
It is rapid as follows:
1.1) the 25mg aquiculture animals for not injecting vibrio alginolyticus and injection 0.1ml vibrio alginolyticus bacteria suspensions about are taken respectively
Tissue, with liquid nitrogen grinding into powder, is added in 1.5ml centrifuge tubes, adds 180ul Buffer ACL, adds 20ul
Proteinase K solution, concussion is mixed.56 DEG C of water-bath 1h are cracked to cell completely.
1.2) 200ul Buffer CL are added, it is fully reverse to mix.After adding Buffer CL, produced if any precipitation, can
70 DEG C of water-baths 10 minutes.
1.3) absolute ethyl alcohol of 200ul is added, it is fully reverse to mix.There may be translucent fibre after addition absolute ethyl alcohol
Shape suspension, the extraction and application of DNA are not influenceed.
1.4) adsorption column is put into collecting pipe, with pipettor by step 1.3) solution that obtains and translucent fibre shape it is outstanding
Float is all added in adsorption column, stands 2min, and 1min is centrifuged in 12000rmp room temperatures, outwells the waste liquid in collecting pipe.
1.5) in adsorption column being placed back in into collecting pipe, 500ul CW1 Solution, 10000rmp centrifugation 30s are added,
Outwell collecting pipe filtrate.
1.6) adsorption column is placed back in into collecting pipe, adds 500ul CW2 Solution, 10000rmp centrifugation 30s,
Fall filtrate.
1.7) in adsorption column being placed back in into collecting pipe, 2min is centrifuged in 12000rmp room temperatures, discards the CW2 of residual
Solution.Adsorption column is opened into lid and places several minutes in room temperature, thoroughly to dry the CW2 remained in sorbing material
The residual of Solution, CW2 Solution can influence the yield of genomic DNA and follow-up experiment.
1.8) adsorption column is taken out, is put into a new 1.5ml centrifuge tube, add 50-200ul CE Buffer to stand
3min, 12000rmp room temperature are centrifuged 2min, collect DNA solution, the as STb gene of aquiculture animal tissue.The DNA of extraction can
Next step experiment or -20 DEG C of preservations are carried out immediately.
2nd, PCR method amplification
It is template with the DNA for extracting, using vibrio alginolyticus specific primer P1, is expanded using PCR method, obtains PCR products
Thing;
P1-F:TCGCTTCATGGACCGTGTC
P1-R:GGCGCTTAGGTTAGTCGAGT
PCR reaction conditions:First stage:94℃5min;
Second stage:94 DEG C of 30s, 69 DEG C of 30s, 72 DEG C of 30s;30 circulations;
Phase III:72℃5min;
Fourth stage:4 DEG C of preservations.
3rd, pcr amplification product electrophoresis in 1% agarose 1 × TAE buffer systems, 5ul is loaded per hole, uses gel imaging system
Overall view is examined and photographic recording, as shown in Figure 4.
M:Marker D, 1-7 are respectively the turbot of injection 0.1ml vibrio alginolyticus bacterium solutions, sea cucumber, loach fish, crab, climb
Shrimp, freshwater shrimp, salmon tissue;8-14 is respectively the injection turbot of 0.90% physiological saline, sea cucumber, loach fish, crab, climbs
Shrimp, freshwater shrimp, salmon tissue.
4th, criterion:Ago-Gel imaging result according to pcr amplification product judges the actually detected effect of the primer;
There are 484bp bands to produce if Ago-Gel is presented result, it is actually detected to work well.If Ago-Gel is not presented
Result has 484bp bands to produce, then actually detected effect is undesirable.
From fig. 4, it can be seen that the injection turbot of 0.1ml vibrio alginolyticus bacterium solutions, sea cucumber, loach fish, crab, climbing shrimp, freshwater shrimp, three
Literary fish tissues (1-7) produce 484bp size strips, and inject turbot, sea cucumber, loach fish, the crab of 0.90% physiological saline
Crab, climb shrimp, freshwater shrimp, salmon tissue (8-14) and do not produce 484bp size strips, it can be seen that, the present invention is according to vibrio alginolyticus
Specific primer designed by topA genes has preferable detectability, may be used on it is actually detected in.
Embodiment 2
(1) design of vibrio alginolyticus specific primer
The present embodiment is directed to the toxR genes of strain vibrio alginolyticus (Vibrio alginolyticus), using software
LSPrimer(http://ccsipb.lnu.edu.cn/primer/) and MEGA6 softwares, design to vibrio alginolyticus (Vibrio
Alginolyticus) there are high specificity and sensitivity a pair of specific primer P2 high, the vibrio alginolyticus specific primer
Specifying information is as shown in table 6.
Table 6
(2) exploration of the optimal PCR reaction conditions of vibrio alginolyticus specific primer P2
1st, the extraction of vibrio alginolyticus DNA:With embodiment 1
2nd, the exploration of vibrio alginolyticus specific primer P2 optimum annealing temperatures
The DNA of the vibrio alginolyticus to extract is PCR and expands as template respectively, and the annealing temperature of purpose primer is set respectively
It is set to 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, pcr amplification product electrophoresis in 1% agarose 1 × TAE buffer systems, per hole
Sample-adding 5ul, is observed and photographic recording with gel imaging system, determines that vibrio alginolyticus is special according to the Gel electrophoresis results after PCR
The optimum annealing temperature of property primer P2.Specific PCR reaction conditions and system are as shown in table 7, as a result such as Fig. 5.
The optimal PCR reactions exploration condition of the purpose primer of table 7
As seen from Figure 5, temperature is to the primer and has no significant effect, but according to PCR basic principles, temperature is more high more is conducive to
The specific binding of primer, therefore determine that optimum annealing temperature is 60 DEG C.
(3) the special sex exploration of vibrio alginolyticus specific primer piece
1st, the extraction of bacterial strain DNA to be tried
Using Ezup posts bordetella gene group DNA extraction agents box (bacterium), different strain as shown in table 8 is extracted respectively
Step 1 in (two) of DNA, specific steps such as embodiment 1.
2nd, special sex exploration
Respectively with table 8, the DNA of the different strain of extraction does PCR amplifications, specific PCR reaction conditions and system for template
As shown in table 9, the Gel electrophoresis results after PCR are as shown in Figure 6.
The bacterial strain to be tried of table 8 is as follows:
The optimal PCR reaction conditions of the purpose primer of table 9
As seen from Figure 6, vibrio alginolyticus specific primer of the invention is in vibrio, and Aeromonas and false unit cell
Very strong specificity is shown in Pseudomonas, specific amplification, rather than purpose bacterial strain can only be produced with purpose bacterial strain vibrio alginolyticus
Specific amplification is not produced.Therefore visible its shows very strong specificity.
(4) exploration of the sensitivity of vibrio alginolyticus specific primer P2
1st, the extraction of vibrio alginolyticus DNA:With embodiment 1
2nd, the exploration of sensitivity
The DNA concentration of vibrio alginolyticus is adjusted to 102Ng/ul, and 10 are diluted to successively1ng/ul、100ng/ul、10-1ng/
ul、10-2ng/ul、10-3ng/ul、10-4Ng/ul, takes 1ul DNA as PCR reaction templates respectively, specific PCR reaction conditions and
As shown in table 10, the Gel electrophoresis results after PCR are as shown in Figure 7 for system.
The optimal PCR reactions exploration condition of the purpose primer of table 10
As seen from Figure 7, vibrio alginolyticus specific primer of the invention is 10 in vibrio alginolyticus DNA concentration2ng/ul、101ng/
ul、10-1Specific amplification can be produced during ng/ul, its minimal detectable concentration can reach 10-1ng/ul。
(5) PCR of vibrio alginolyticus is detected in turbot breeding process
1st, the STb gene of turbot tissue is extracted
Using Ezup Zhu Shi Animal genome DNA extraction agent boxes, the DNA of turbot tissue is extracted, comprised the following steps that:
1.1) the 25mg turbot tissues for not injecting vibrio alginolyticus and injection 0.1ml vibrio alginolyticus bacteria suspensions about are taken respectively,
With liquid nitrogen grinding into powder, it is added in 1.5ml centrifuge tubes, adds 180ul Buffer ACL, adds 20ul Proteinase
K solution, concussion is mixed.56 DEG C of water-bath 1h are cracked to cell completely.
1.2) 200ul Buffer CL are added, it is fully reverse to mix.After adding Buffer CL, produced if any precipitation, can
70 DEG C of water-baths 10 minutes.
1.3) absolute ethyl alcohol of 200ul is added, it is fully reverse to mix.There may be translucent fibre after addition absolute ethyl alcohol
Shape suspension, the extraction and application of DNA are not influenceed.
1.4) adsorption column is put into collecting pipe, with pipettor by step 1.3) solution that obtains and translucent fibre shape it is outstanding
Float is all added in adsorption column, stands 2min, and 1min is centrifuged in 12000rmp room temperatures, outwells the waste liquid in collecting pipe.
1.5) in adsorption column being placed back in into collecting pipe, 500ul CW1 Solution, 10000rmp centrifugation 30s are added,
Outwell collecting pipe filtrate.
1.6) adsorption column is placed back in into collecting pipe, adds 500ul CW2 Solution, 10000rmp centrifugation 30s,
Fall filtrate.
1.7) in adsorption column being placed back in into collecting pipe, 2min is centrifuged in 12000rmp room temperatures, discards the CW2 of residual
Solution.Adsorption column is opened into lid and places several minutes in room temperature, thoroughly to dry the CW2 remained in sorbing material
The residual of Solution, CW2 Solution can influence the yield of genomic DNA and follow-up experiment.
1.8) adsorption column is taken out, is put into a new 1.5ml centrifuge tube, add 50-200ul CE Buffer to stand
3min, 12000rmp room temperature are centrifuged 2min, collect DNA solution, the as STb gene of turbot tissue.The DNA of extraction can enter immediately
Row next step is tested or -20 DEG C of preservations.
2nd, PCR method amplification
It is template with the DNA for extracting, using vibrio alginolyticus specific primer P2, is expanded using PCR method, obtains PCR products
Thing;
P2-F:CTGACGTTGAAGAAGCCACTT
P2-R:GGCGTCATCACAGGTACATTTT
PCR reaction conditions:First stage:94℃5min;
Second stage:94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s;30 circulations;
Phase III:72℃5min;
Fourth stage:4 DEG C of preservations.
3rd, pcr amplification product electrophoresis in 1% agarose 1 × TAE buffer systems, 5ul is loaded per hole, uses gel imaging system
Overall view is examined and photographic recording, as shown in Figure 8.
4th, criterion:Ago-Gel imaging result according to pcr amplification product judges the actually detected effect of the primer;
There are 286bp bands to produce if Ago-Gel is presented result, it is actually detected to work well.If Ago-Gel is not presented
Result has 286bp bands to produce, then actually detected effect is undesirable.
As seen from Figure 8, the turbot tissue (1-7) of injection 0.1ml vibrio alginolyticus bacterium solutions produces 286bp size strips,
And the turbot tissue (8-14) for injecting 0.90% physiological saline does not produce 286bp size strips, it can be seen that, basis of the present invention
Specific primer designed by vibrio alginolyticus toxR genes has preferable detectability, may be used on actually detected middle
Embodiment 3
(1) design of vibrio alginolyticus specific primer
The present embodiment is directed to the toxR genes of strain vibrio alginolyticus (Vibrio alginolyticus), using software
LSPrimer(http://ccsipb.lnu.edu.cn/primer/) and MEGA6 softwares, design to vibrio alginolyticus (Vibrio
Alginolyticus) there are high specificity and sensitivity a pair of specific primer P3 high, the vibrio alginolyticus specific primer
Specifying information is as shown in table 11.
Table 11
(2) exploration of the optimal PCR reaction conditions of vibrio alginolyticus specific primer P3
1st, the extraction of vibrio alginolyticus DNA:With embodiment 1.
2nd, the exploration of vibrio alginolyticus specific primer P3 optimum annealing temperatures
The DNA of the vibrio alginolyticus to extract is PCR and expands as template respectively, and the annealing temperature of purpose primer is set respectively
It is set to 56 DEG C, 57 DEG C, 58 DEG C, 59 DEG C, 60 DEG C, pcr amplification product electrophoresis in 1% agarose 1 × TAE buffer systems, per hole
Sample-adding 5ul, is observed and photographic recording with gel imaging system, determines that vibrio alginolyticus is special according to the Gel electrophoresis results after PCR
The optimum annealing temperature of property primer.Specific PCR reaction conditions and system are as shown in table 12, as a result such as Fig. 9.
The optimal PCR reactions exploration condition of the purpose primer of table 12
As seen from Figure 9, temperature is to the primer and has no significant effect, but according to PCR basic principles, temperature is more high more is conducive to
The specific binding of primer, therefore determine that optimum annealing temperature is 60 DEG C.
(3) the special sex exploration of vibrio alginolyticus specific primer P3
1st, the extraction of bacterial strain DNA to be tried
Using Ezup posts bordetella gene group DNA extraction agents box (bacterium), different strain as shown in table 13 is extracted respectively
Step 1 in (two) of DNA, specific steps such as embodiment 1.
2nd, special sex exploration
Respectively with table 13, the DNA of the different strain of extraction does PCR amplifications, specific PCR reaction conditions and system for template
As shown in table 14, the Gel electrophoresis results after PCR are as shown in Figure 10.
The bacterial strain to be tried of table 13 is as follows:
The optimal PCR reaction conditions of the purpose primer of table 14
As seen from Figure 10, vibrio alginolyticus specific primer of the invention is in vibrio, and Aeromonas and vacation list
Very strong specificity is shown in born of the same parents Pseudomonas, specific amplification, rather than purpose bacterium can only be produced with purpose bacterial strain vibrio alginolyticus
Strain does not produce specific amplification.Therefore visible its shows very strong specificity.
(4) exploration of the sensitivity of vibrio alginolyticus specific primer
1st, the extraction of vibrio alginolyticus DNA:With embodiment 1
2nd, the exploration of sensitivity
The DNA concentration of vibrio alginolyticus is adjusted to 102Ng/ul, and 10 are diluted to successively1ng/ul、100ng/ul、10-1ng/
ul、10-2ng/ul、10-3ng/ul、10-4Ng/ul, takes 1ul DNA as PCR reaction templates respectively, specific PCR reaction conditions and
As shown in Table 15, the Gel electrophoresis results after PCR are as shown in figure 11 for system.
The optimal PCR reactions exploration condition of the purpose primer of table 15
As seen from Figure 11, vibrio alginolyticus specific primer of the invention is 10 in vibrio alginolyticus DNA concentration2ng/ul、
101ng/ul、100Specific amplification can be produced during ng/ul, its minimal detectable concentration can reach 100ng/ul。
(5) during holothruian cultures vibrio alginolyticus PCR detection method
1st, the STb gene of sea cucumber tissue is extracted;
Using Ezup Zhu Shi Animal genome DNA extraction agent boxes, the DNA of sea cucumber tissue is extracted, comprised the following steps that:
1.1) the 25mg sea cucumbers tissue for not injecting vibrio alginolyticus and injection 0.1ml vibrio alginolyticus bacteria suspensions about is taken respectively, is used
Liquid nitrogen grinding is added in 1.5ml centrifuge tubes into powder, adds 180ul Buffer ACL, adds 20ul Proteinase K
Solution, concussion is mixed.56 DEG C of water-bath 1h are cracked to cell completely.
1.2) 200ul Buffer CL are added, it is fully reverse to mix.After adding Buffer CL, produced if any precipitation, can
70 DEG C of water-baths 10 minutes.
1.3) absolute ethyl alcohol of 200ul is added, it is fully reverse to mix.There may be translucent fibre after addition absolute ethyl alcohol
Shape suspension, the extraction and application of DNA are not influenceed.
1.4) adsorption column is put into collecting pipe, with pipettor by step 1.3) solution that obtains and translucent fibre shape it is outstanding
Float is all added in adsorption column, stands 2min, and 1min is centrifuged in 12000rmp room temperatures, outwells the waste liquid in collecting pipe.
1.5) in adsorption column being placed back in into collecting pipe, 500ul CW1 Solution, 10000rmp centrifugation 30s are added,
Outwell collecting pipe filtrate.
1.6) adsorption column is placed back in into collecting pipe, adds 500ul CW2 Solution, 10000rmp centrifugation 30s,
Fall filtrate.
1.7) in adsorption column being placed back in into collecting pipe, 2min is centrifuged in 12000rmp room temperatures, discards the CW2 of residual
Solution.Adsorption column is opened into lid and places several minutes in room temperature, thoroughly to dry the CW2 remained in sorbing material
The residual of Solution, CW2 Solution can influence the yield of genomic DNA and follow-up experiment.
1.8) adsorption column is taken out, is put into a new 1.5ml centrifuge tube, add 50-200ul CE Buffer to stand
3min, 12000rmp room temperature are centrifuged 2min, collect DNA solution, the as STb gene of sea cucumber tissue.The DNA of extraction can be carried out immediately
Next step is tested or -20 DEG C of preservations.
2nd, PCR method amplification
It is template with the DNA for extracting, using vibrio alginolyticus specific primer P3, is expanded using PCR method, obtains PCR products
Thing;
P3-F:CCTAAACGCGGTTATCAACTCA
P3-R:GGCGTCATCACAGGTACATTTT
PCR reaction conditions:First stage:94℃5min;
Second stage:94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s;30 circulations;
Phase III:72℃5min;
Fourth stage:4 DEG C of preservations.
3rd, pcr amplification product electrophoresis in 1% agarose 1 × TAE buffer systems, 5ul is loaded per hole, uses gel imaging system
Overall view is examined and photographic recording, as shown in figure 12.
4th, criterion:Ago-Gel imaging result according to pcr amplification product judges the actually detected effect of the primer;
There are 353bp bands to produce if Ago-Gel is presented result, it is actually detected to work well.If Ago-Gel is not presented
Result has 353bp bands to produce, then actually detected effect is undesirable.
As seen from Figure 12, sea cucumber tissue (1-7) of injection 0.1ml vibrio alginolyticus bacterium solutions produces 353bp size strips, and
Sea cucumber tissue (8-14) for injecting 0.90% physiological saline does not produce 353bp size strips, it can be seen that, the present invention is according to molten algae
Specific primer designed by vibrios toxR genes has preferable detectability, may be used on it is actually detected in.
Claims (6)
1. in a kind of aquiculture animal body vibrio alginolyticus PCR detection method, it is characterised in that:Method is as follows:
1) STb gene of aquiculture animal tissue is extracted;
2) it is template with the DNA for being extracted, using vibrio alginolyticus specific primer, enters performing PCR amplification;Described vibrio alginolyticus is special
Specific primer is directed to specific primer P2, toxR base of specific primer P1, toxR gene of the topA genes of vibrio alginolyticus
The specific primer P3 of cause;
3) the Ago-Gel imaging result according to pcr amplification product judges whether aquiculture animal is infected by vibrio alginolyticus.
2. in a kind of aquiculture animal body according to claim 1 vibrio alginolyticus PCR detection method, its feature exists
In:
Described vibrio alginolyticus is Vibrio alginolyticus.
3. in a kind of aquiculture animal body according to claim 1 vibrio alginolyticus PCR detection method, its feature exists
In:
The sequence of described specific primer P1 is:
P1-F:TCGCTTCATGGACCGTGTC
P1-R:GGCGCTTAGGTTAGTCGAGT
The sequence of described specific primer P2 is:
P2-F:CTGACGTTGAAGAAGCCACTT
P2-R:GGCGTCATCACAGGTACATTTT
The sequence of described specific primer P3 is:
P3-F:CCTAAACGCGGTTATCAACTCA
P3-R:GGCGTCATCACAGGTACATTTT。
4. in a kind of aquiculture animal body according to claim 1 vibrio alginolyticus PCR detection method, its feature exists
In:
The reaction system and reaction condition of PCR amplifications are as follows:
PCR reaction conditions:First stage:94℃5min;
Second stage:94 DEG C of 30s, 60 DEG C or 69 DEG C of 30s, 72 DEG C of 30s;30 circulations;
Phase III:72℃5min;
Fourth stage:4 DEG C of preservations.
5. in a kind of aquiculture animal body according to claim 1 vibrio alginolyticus PCR detection method, its feature exists
In,
Step 3) in, criterion is,
For specific primer P1, if the Ago-Gel imaging result of pcr amplification product has 484bp bands to produce, water
Produce cultivated animals to be infected by vibrio alginolyticus, be not infected otherwise;
For specific primer P2, if the Ago-Gel imaging result of pcr amplification product has 286bp bands to produce, greatly
Brill is infected by vibrio alginolyticus, is not infected otherwise;
For specific primer P3, if the Ago-Gel imaging result of pcr amplification product has 353bp bands to produce, sea
Ginseng is infected by vibrio alginolyticus, is not infected otherwise.
6. in a kind of aquiculture animal body according to claim 1 vibrio alginolyticus PCR detection method, its feature exists
In described aquiculture animal is turbot, sea cucumber, loach fish, crab, climb shrimp, freshwater shrimp or salmon.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710157709.6A CN106755550B (en) | 2017-03-16 | 2017-03-16 | PCR detection method for vibrio alginolyticus in aquaculture animal |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710157709.6A CN106755550B (en) | 2017-03-16 | 2017-03-16 | PCR detection method for vibrio alginolyticus in aquaculture animal |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106755550A true CN106755550A (en) | 2017-05-31 |
CN106755550B CN106755550B (en) | 2020-12-08 |
Family
ID=58966176
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710157709.6A Active CN106755550B (en) | 2017-03-16 | 2017-03-16 | PCR detection method for vibrio alginolyticus in aquaculture animal |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106755550B (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2249183A1 (en) * | 1996-03-26 | 1997-10-02 | Nippon Suisan Kaisha, Ltd. | Oligonucleotides used for detecting vibrio parahaemolyticus and method of detection therewith |
CN105002280A (en) * | 2015-07-24 | 2015-10-28 | 长江大学 | Fluorogenic quantitative PCR detecting method of vibrios |
CN105132532A (en) * | 2015-07-24 | 2015-12-09 | 长江大学 | Vibrio detecting primer group and detecting method |
CN105255996A (en) * | 2014-07-15 | 2016-01-20 | 中国人民解放军海军总医院 | Primers and kit for Vibrio alginolyticus on-site detection, and applications of primers and kit |
-
2017
- 2017-03-16 CN CN201710157709.6A patent/CN106755550B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2249183A1 (en) * | 1996-03-26 | 1997-10-02 | Nippon Suisan Kaisha, Ltd. | Oligonucleotides used for detecting vibrio parahaemolyticus and method of detection therewith |
CN105255996A (en) * | 2014-07-15 | 2016-01-20 | 中国人民解放军海军总医院 | Primers and kit for Vibrio alginolyticus on-site detection, and applications of primers and kit |
CN105002280A (en) * | 2015-07-24 | 2015-10-28 | 长江大学 | Fluorogenic quantitative PCR detecting method of vibrios |
CN105132532A (en) * | 2015-07-24 | 2015-12-09 | 长江大学 | Vibrio detecting primer group and detecting method |
Non-Patent Citations (6)
Title |
---|
A.CANO-GOMEZ等: "A multiplex PCR-based protocol for identification and quantification of Vibrio harveyi-related species", 《AQUACULTURE》 * |
CHEN C等: "Characterization of role of the toxR gene in the physiology and pathogenicity of Vibrio alginolyticus", 《ANTONIE VAN LEEUWENHOEK》 * |
HOFFMANN M等: "Genetic and phylogenetic evidence for misidentification of Vibrio species within the Harveyi clade", 《LETT APPL MICROBIOL》 * |
崔婧等: "华南地区海水养殖鱼类主要弧菌病原的分离与鉴定", 《海南大学学报自然科学版》 * |
李杰等: "应用SYBR Green Ⅰ荧光PCR方法快速检测溶藻弧菌", 《中国预防医学杂志》 * |
韩一凡等: "溶藻弧菌的PCR快速检测方法", 《中国海洋大学学报》 * |
Also Published As
Publication number | Publication date |
---|---|
CN106755550B (en) | 2020-12-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Amini et al. | Molecular detection of invA and spv virulence genes in Salmonella enteritidis isolated from human and animals in Iran | |
Rivoal et al. | Genomic diversity of Campylobacter coli and Campylobacter jejuni isolates recovered from free-range broiler farms and comparison with isolates of various origins | |
CN101356927B (en) | Use of Bdellovibrio in eliminating pathogenicity vibrio in marine products and breeding water body thereof | |
CN104073469B (en) | The separation of cracking aquatic pathogenic bacteria phage and screening technique | |
Ayres et al. | The distribution of Vibrio parahaemolyticus in British coastal waters: report of a collaborative study 1975–6 | |
CN107338198A (en) | A kind of Lactobacillus plantarum and its application | |
CN109554449B (en) | Multiplex PCR method capable of simultaneously detecting 7 virulence genes of aeromonas | |
CN108588248A (en) | Multiple PCR primer group, kit and detection method for detecting 5 kinds of fimbriae genes of enterotoxigenic escherichia coli | |
CN110484513A (en) | Bacteriophage pAhMJG and its application in the fish disease that treatment Aeromonas hydrophila causes | |
CN105506153A (en) | Kit and method for detecting aeromonas veronii | |
Einarsdottir et al. | Moritella viscosa in lumpfish (Cyclopterus lumpus) and Atlantic salmon (Salmo salar) | |
CN106755552A (en) | The PCR detection method of Vibrio vulnificus in a kind of aquiculture animal or aquatic food | |
CN101381767B (en) | Universal real time fluorescent PCR detection method of trichinella | |
CN107502622A (en) | Sip gene recombined vectors, chitosan PLGA parcel Sip gene DNA vaccines and its preparation method and application | |
CN101724692B (en) | Primer and diagnosis method used for diagnosing mulberry bacterial wilt disease | |
CN105734166A (en) | Multiplex-PCR primer and application thereof in cultivation process of turbots | |
Buttimer et al. | Temperate bacteriophages infecting the mucin-degrading bacterium Ruminococcus gnavus from the human gut | |
CN106755550A (en) | The PCR detection method of vibrio alginolyticus in a kind of aquiculture animal body | |
Akter et al. | Prevalence of Shigella boydii in Bangladesh: isolation and characterization of a rare phage MK-13 that can robustly identify shigellosis caused by Shigella boydii type 1 | |
CN105734165A (en) | Aeromonas schubertii specific primer and application thereof in turbot farming process | |
Abdella et al. | Pathogenicity and antibiotic susceptibility of two bacterial pathogens associated with the clam Tapes decussatus in some Egyptian fisheries | |
CN106884051A (en) | The PCR detection method of vibrio parahaemolytious in a kind of aquiculture animal body | |
CN106868129A (en) | A kind of Maxwell vibrios specific primer and the application in Maxwell vibrios in detection aquiculture animal body | |
CN106939347B (en) | Dual PCR (polymerase chain reaction) rapid detection kit and method for pathogenic vibrio natriegens of portunus trituberculatus | |
CN108424866A (en) | A kind of sturgeon source Aeromonas media AMth-1 and PCR detection primer and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |