CN111118138A - Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR - Google Patents
Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR Download PDFInfo
- Publication number
- CN111118138A CN111118138A CN201911282775.1A CN201911282775A CN111118138A CN 111118138 A CN111118138 A CN 111118138A CN 201911282775 A CN201911282775 A CN 201911282775A CN 111118138 A CN111118138 A CN 111118138A
- Authority
- CN
- China
- Prior art keywords
- seq
- gene
- inhibitor
- mthfr
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides a genotyping detection kit and a genotyping detection method for polymorphic sites of folate metabolism ability genes. The kit comprises a mutant reaction system and a wild reaction system; the reaction system comprises an rs1801133 group, an rs1801131 group and an rs1801394 group, and the structure of a primer, a probe and an inhibitor of each group is disclosed. The invention solves the problems of high requirement on the quality of the template and insufficient timeliness in the polymorphism typing detection of folate metabolism capability genes MTHFR and MTRR, can realize the instant detection of polymorphism of three sites of MTHFR genes 677C > T, 1298A > C and 66A > G only by a two-tube reaction system, one-time sample adding and one-time close detection, and has the advantages of stable system and good sensitivity and specificity.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a kit for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR and a using method thereof.
Background
Folic acid is an essential substance for cell growth and tissue repair, and is particularly important for pregnant women during embryonic development. According to serum sampling survey of women of premarital reproductive age in China, 21 percent and 38 percent of women in cities and rural areas in China are lack of folic acid respectively. According to the relevant reports of the Ministry of health and disease control center, 90 tens of thousands of newborn defective diseases are born in China every year, and the birth defects are ranked in the top 5 positions and comprise: congenital heart disease, neural tube malformation, cleft lip and palate, Down's syndrome, polydactyly (toe), which are related to folic acid deficiency in pregnant women.
The recent research shows that the difference of folate metabolism capability among individuals is related to polymorphism of partial gene sites, enzymes involved in folate metabolism pathways are various, including dimethyltetrahydrofolate reductase (MTHFR), methionine reductase (MTR), methionine synthetic reductase (MTRR), cystathiamidine β synthase (CBS) and the like, certain nucleotide polymorphisms of the enzymes can cause folate metabolism abnormality to cause diseases or birth defects, the C > T mutation at the 677 th base of the dimethyltetrahydrofolate reductase (MTHFR) is rs1801133, the alanine at the 222 th base of the MTHFR protein can be replaced by valine, the MTHFR heterozygous mutation (677CT) and the homozygous mutation (677) are 44% and 23% respectively in China, the homocysteine (Hcy) of MTHFR homozygous mutation (677TT) is remarkably increased, the hyperthyroid cysteine (Hcy) of the MTHFR homozygous mutation group is increased, the Hcy prevalence and clinical research Hcy are proved to be independent risk factors of cerebral stroke, the homocysteine mutation at the MTR 1298 th base C1808, the homocysteine mutation is reduced by the MTHFR 12% and the methionine mutation at the genotype, the urinary tract mutation, the methionine dehydrogenase (HA) of the urinary tract mutation is increased, the methionine dehydrogenase (18066), the urinary tract mutation is reduced by the urinary tract mutation, the urinary tract mutation of the urinary tract methionine dehydrogenase (urinary tract mutation, the urinary tract dysfunction of the urinary tract of MTHFR) of the urinary tract, the urinary tract dysfunction, the urinary tract of the urinary tract, the urinary tract of the urinary tract, the urinary tract of the urinary tract.
The genetic typing technology is utilized to detect the genetic polymorphism of folate metabolism related genotypes MRHFR and MTRR of the pregnant women, the utilization capacity of folic acid of a detected person is graded, and the folic acid supplement dosage is further adjusted in a targeted manner. Currently, there are many methods for detecting gene polymorphism in the market, including, for example, gene chip method, gene sequencing, Restriction Fragment Length Polymorphism (RFLP), melting curve, and the like. The gene sequencing is a gold standard for mutation detection, but the gene sequencing has long time and high cost, has strict requirements on material taking and limits the application in clinic. RFLP is only suitable for the condition that a proper specific restriction enzyme recognition sequence exists near the mutation site, and has larger application limitation. Typing of polymorphisms of folate metabolism ability genes MRHFR and MTRR by a lysis curve is also a commonly used method based on fluorescent quantitative PCR. But the result of the dissolution curve is not obvious, is easily influenced by the detection condition and the quality of the template, and has higher requirements on the operability and experience of detection personnel. ARMS-PCR and taq-man probes are also currently used for typing of MRHFR and MTRR gene polymorphisms, mainly by Ct values, and are susceptible to false positive and false negative results (Delgado-Plasenia, et al 2015; Saxena, et al 2016; Shi, et al 2019; Singh, et al 2015); in addition, the quality of the used DNA template is high, for example, the concentration of the DNA template needs to be detected and limited in advance, the detected Ct values obtained by the quality and concentration of the DNA template with different protein contents, small molecular impurity contents and the like are different, and the interpretation of the result is greatly influenced.
Disclosure of Invention
The invention aims to solve the problems of high template quality requirement and insufficient timeliness in the polymorphism typing detection of folate metabolism capability genes MTHFR and MTRR, and provides a genotyping detection kit and a genotyping detection method for folate metabolism capability gene polymorphic sites.
The purpose of the invention is realized by the following measures:
a genotype typing detection kit for polymorphic sites of folate metabolism ability genes comprises a mutant reaction system and a wild reaction system; the reaction system comprises upstream and downstream primers, a fluorescent probe and an inhibitor;
the mutant reaction system comprises an rs1801133 mutant group, an rs1801131 mutant group and an rs1801394 mutant group; the rs1801133 mutant group upstream primer is shown as SEQ ID NO.2, the downstream primer is shown as SEQ ID NO.3, the fluorescent probe is shown as SEQ ID NO.4, and the inhibitor is shown as SEQ ID NO. 6; the rs1801131 mutant group upstream primer is shown as SEQ ID NO.8, the downstream primer is shown as SEQ ID NO.9, the fluorescent probe is shown as SEQ ID NO.10, and the inhibitor is shown as SEQ ID NO. 12; the rs1801394 mutant group upstream primer is shown as SEQ ID NO.14, the downstream primer is shown as SEQ ID NO.15, the fluorescent probe is shown as SEQ ID NO.16, and the inhibitor is shown as SEQ ID NO. 18;
the wild type reaction system comprises an rs1801133 wild group, an rs1801131 wild group and an rs1801394 wild group; rs1801133 wild group upstream primer is shown as SEQ ID NO.1, downstream primer is shown as SEQ ID NO.3, fluorescent probe is shown as SEQ ID NO.4, and inhibitor is shown as SEQ ID NO. 5; rs1801131 wild group upstream primer is shown as SEQ ID NO.7, downstream primer is shown as SEQ ID NO.9, fluorescent probe is shown as SEQ ID NO.10, and inhibitor is shown as SEQ ID NO. 11; rs1801394 wild group upstream primer is shown as SEQ ID NO.13, downstream primer is shown as SEQ ID NO.15, fluorescent probe is shown as SEQ ID NO.16, and inhibitor is shown as SEQ ID NO. 17.
The invention can realize the instant detection of polymorphism of three sites of the MTHFR gene 677C, T, 1298A, C and the MTRR gene 66A and G only by adopting a 2-tube reaction system, one-time sample adding and one-time close detection, and has the advantages of stable system and good sensitivity and specificity.
Specifically, the sequence of group for detecting 677C > T site (rs1801133) of MTHFR gene is as follows, and the detection primer and the probe are designed according to the rs1801133 site:
wild-type ARMS upstream primer, 677-WF: AAGCTGCGTGATGATGACATAGG (SEQ ID NO.1)
Mutant ARMS forward primer, 677-MF: AAGCTGCGTGATGATGAAACTGA (SEQ ID NO.2)
Common downstream primer, 677-R: AAGGCCACCCCGAAGCAGGGA (SEQ ID NO.3)
Fluorescent probe, 677-P: FAM-ACCTGAAGCACTTGAAGGAGAAGGTGTCT-BHQ1(SEQ ID NO.4)
Wild-type template inhibitor, 677-WB: AAGCTGCGTGATGATGAAACTGA-ddC (SEQ ID NO.5)
Mutant template inhibitor, 677-MB: AAGCTGCGTGATGATGACATAGG-ddC (SEQ ID NO.6)
The sequence of a group of detection MTHFR gene 1298A > C site (rs1801131) is as follows, and the detection primer and the probe are designed according to the rs1801131 site:
wild-type ARMS upstream primer, 1298-WF: GGGGAGGAGCTGACCAGAGACGA (SEQ ID NO.7)
Mutant ARMS forward primer, 1298-MF: GGGGAGGAGCTGACCAGTGCATC (SEQ ID NO.8)
Common downstream primer, 1298-R: CCACTCCAGCATCACTCACTT (SEQ ID NO.9)
Fluorescent probe, 1298-P: VIC-ACCTCTCGGGAGAACCAAACCGGAAT-BHQ1(SEQ ID NO.10)
Wild-type templating inhibitor, 1298-WB: GGGGAGGAGCTGACCAGTGCATC-ddC (SEQ ID NO.11)
Mutant template inhibitor, 1298-MB: GGGGAGGAGCTGACCAGAGACGA-ddC (SEQ ID NO.12)
The sequence of the group of 66A > G sites (rs1801394) of MTRR gene is detected as follows, and the detection primer and the probe are designed according to the rs1801394 site:
wild-type ARMS upstream primer, 66-WF: GCAAAGGCCATCGCAGAAGACATA (SEQ ID NO.13)
Mutant ARMS forward primer, 66-MF: GCAAAGGCCATCGCAGAAGACAGG (SEQ ID NO.14)
Common downstream primer, 66-R: CTTCAAAGCACAAAACGGTAA (SEQ ID NO.15)
Fluorescent probe, 66-P: CY5-AAGCTGTGGTACATGGATTTTCTGCAGAT-BHQ2(SEQ ID NO.16)
Wild-type template inhibitor, 66-WB: GCAAAGGCCATCGCAGAAGACAGG-ddC (SEQ ID NO.17)
Mutant template inhibitors, 66-MB: GCAAAGGCCATCGCAGAAGACATA-ddC (SEQ ID NO. 18).
The fluorescent group at the 5 'end of the fluorescent probe used for detection is a conventionally used fluorescent reporter group suitable for fluorescent quantitative PCR analysis, preferably FAM, VIC, HEX, cy5 or ROX, the quenching group at the 3' end is a conventionally used fluorescent quenching group suitable for fluorescent quantitative PCR, and preferably TAMRA, BHQ1, BHQ2, MGB or Dabcy 1. More preferably, the 5 ' end fluorescent group of the probe for detecting the MTHFR gene 677C > T is FAM, the 5 ' end fluorescent group of the probe for detecting the MTHFR gene 1298A > C mutation is VIC, and the 5 ' end fluorescent group of the probe for detecting the MTRR gene 66A > G mutation is CY 5; the fluorescence quenching group at the 3 ' end for detecting MTHFR gene 677C > T is BHQ1, the fluorescence quenching group at the 3 ' end for detecting MTHFR gene 1298A > C mutation is BHQ1, and the fluorescence quenching group at the 3 ' end for detecting MTRR gene 66A > G mutation is BHQ 2.
The specific inhibitor used above is specifically modified at the 3 'end, preferably C3 spacer, phosphorylation, thio, MGB, dideoxycytidine (ddC), etc., and more preferably, the inhibitor used for detection of the above polymorphic site is modified at the 3' end with ddC.
The mass ratio of the upstream primer, the downstream primer, the probe and the inhibitor of the kit is 2:2:2: 3.
The kit also provides a PCR reaction solution for detecting the polymorphism of three sites of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G, and the PCR reaction solution is divided into a wild type reaction system (A tube) and a mutant type reaction system (B tube). The PCR reaction solution contains the above-described primers, probes and inhibitors, as well as hot-start taq enzyme, buffer, magnesium ions, dNTPs, and the like required for the PCR reaction. The composition of the reaction solution of the tube A and the tube B is as follows:
the kit comprises the primers, the probes, the inhibitor and the reaction liquid, and also comprises positive quality control and negative quality control. The positive quality control is a DNA mixed sample which simultaneously contains 3 sites of heterozygous polymorphism such as MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G, and the concentration is preferably 10 ng/mu l; the negative quality control is sterilized deionized water; the instructions contain a description of the method of use of the kit, and the preferred PCR amplification conditions are:
the conditions for pre-denaturation were: at 95 ℃ for 2 minutes;
the PCR reaction consists of two stages:
the first phase consists of 5 amplification cycles with the conditions: denaturation: 95 ℃ for 10 seconds; annealing: 60 ℃, 20 seconds; extension: 72 ℃ for 20 seconds;
the second phase consists of 40 amplification cycles with the conditions: denaturation: 95 ℃ for 10 seconds; annealing: setting fluorescence signal collection at 72 ℃ for 20 seconds; extension: 72 ℃ for 20 seconds;
the specification of the invention also provides an interpretation method of the detection result of the kit, which comprises the following steps: observing whether the fluorescence detection signals in the tube A and the tube B form a logarithmic amplification S-shaped curve or not under the conditions of the PCR reaction system and the circulation program; if a logarithmic amplification "S" curve is formed, the sample to be detected contains the polymorphic site to be detected. FAM signal is used for detecting MTHFR gene 677C > T, VIC signal is used for detecting MTHFR gene 1298A > C, CY5 is used for detecting MTRR gene 66A > G.
The detection result is interpreted according to the following scheme:
1) in the negative control reaction, FAM, VIC and CY5 should not peak, and there is no Ct value; if FAM, VIC or CY5 peaks in the negative control, it indicates that the reaction system is contaminated, please remove the contamination and then re-perform the reaction.
2) In the positive control reaction, FAM, VIC and CY5 should all peak normally and exhibit an "S" type curve; if any of FAM, VIC and CY5 signals do not normally peak in the positive control reaction, please check the reaction program setup for correctness.
3) Satisfying 1) and 2) results, the detection signals in tube A and tube B were observed:
if FAM signal rises in the tube A and no FAM signal rises in the tube B, the MTHFR gene 677C > T is CC; if no FAM signal rises in the tube A and FAM signal rises in the tube B, the MTHFR gene 677C > T is TT; if FAM signal rises in tube A and FAM signal rises in tube B, then MTHFR gene 677C > T is CT.
If the VIC signal in the tube A rises and the VIC signal in the tube B does not rise, the MTHFR gene 1298A > C is AA; if no VIC signal rises in tube A and a VIC signal rises in tube B, the MTHFR gene 1298A > C is CC; if there is a rise in the VIC signal in tube A and a rise in the VIC signal in tube B, the MTHFR gene 1298A > C is AC.
If CY5 signal rises in tube A and no CY5 signal rises in tube B, the MTHFR gene 66A > G is AG; if the CY5 signal does not rise in the tube A and the CY5 signal rises in the tube B, the MTHFR gene 66A > G is GG; if CY5 signal is elevated in tube A and CY5 signal is elevated in tube B, the MTHFR gene 66A > G is AG.
Advantageous effects
1. The result of the invention is simple and accurate to interpret: the kit does not need to adjust the concentration of the DNA template, and can clearly distinguish genotypes aiming at the concentration of 1-200ng of DNA; the kit elaborately sets a double quality control detection system of positive quality control and negative quality control, can analyze whether the DNA to be detected can be normally amplified, eliminates the reason that PCR failure is possibly caused, and ensures the reliability and traceability of the experiment.
2. The invention has high detection sensitivity, adopts specially designed primers, probes and specific inhibitors aiming at the template, has very high PCR detection specificity, has no non-specific amplification, can specifically identify the polymorphism information of three sites of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G, has high detection sensitivity, can ensure high specificity and objective interpretation of the detection result, does not need to manually calculate △ CT value, has simple and clear result interpretation and can meet the clinical requirement.
3. The invention has short reaction period: the method adopts a hot start taq enzyme premixing system, is stable at normal temperature, comprises a primer, a probe, a reaction buffer solution, a hot start taq enzyme and the like, is mixed into a reaction tube in advance, is used for one-time sample adding and one-time close detection, does not need product post-treatment and sequencing result verification, can finish the detection within 60 minutes, obviously shortens the detection time and improves the detection efficiency.
4. The invention has low detection cost: based on a fluorescent quantitative platform, the Arms-PCR and taqman probe technology is adopted, the detection primers and the probes are low in price, the experiment consumption and the labor cost are saved in the experiment process, and the cost of detecting three sites of the MTHFR gene 677C > T, MTHFR gene 1298A > C and the MTRR gene 66A > G at one time is equivalent to that of 2 PCR reactions. Compared with sequencing and other methods, the method greatly saves the detection cost.
5. The invention integrates ARMS-PCR technology and fluorescent quantitative PCR technology, adds specific inhibitor, uses two reaction tubes to detect the same sample to be detected, and the interpretation of the typing result is simple and clear; the detection time is short, and the detection can be finished in 60 minutes; the detection cost is low, so that the development of a common folate metabolism related gene detection screen in clinic is expected to become possible, and the detection result can be quickly and accurately obtained by the detected person.
Drawings
FIG. 1 negative control amplification Signal
Tube A: the wild type detection tube is used for detecting whether the 677 position of the MTHFR gene contains C base, whether the 1298 position of the MTHFR gene contains A base and whether the 66 position of the MTRR gene contains A base. And (B) tube: the mutant detection tube detects whether the 677 th site of MTHFR gene contains T base, 1298 th site of MTHFR gene contains C base and 66 th site of MTRR gene contains G base. FAM: detecting 677 site of MTHFR gene; VIC: detecting 1298 th site of MTHFR gene; cy5: detecting 677 site of MTHFR gene.
FIG. 2 Positive control amplification signals
Tube A: the wild type detection tube is used for detecting whether the 677 position of the MTHFR gene contains C base, whether the 1298 position of the MTHFR gene contains A base and whether the 66 position of the MTRR gene contains A base. And (B) tube: the mutant detection tube detects whether the 677 th site of MTHFR gene contains T base, 1298 th site of MTHFR gene contains C base and 66 th site of MTRR gene contains G base. FAM: detecting 677 site of MTHFR gene; VIC: detecting 1298 th site of MTHFR gene; cy5: detecting 677 site of MTHFR gene.
FIG. 3 interpretation of test results
MTRR (66AA), wherein the 66 th site of MTRR gene is an AA homozygous sample; MTRR (66AC) 66 sites of MTRR gene are AG heterozygous samples; MTRR (66GG) 66 sites of MTRR gene are GG homozygous samples. MTHFR (677CC), wherein the site 677 of MTHFR gene is CC homozygous sample; MTHFR (677CT), wherein the site 677 of MTHFR gene is a CT heterozygous sample; MTHFR (677TT), wherein the site 677 of the MTHFR gene is a TT homozygous sample; MTHFR (1298AA), wherein the 1298 site of the MTHFR gene is an AA homozygous sample;
MTHFR (1298AC), wherein the 1298 site of the MTHFR gene is an AC heterozygous sample; MTHFR (1298CC) MTHFR gene 1298 locus was a CC homozygous sample. Tube A, Cy5 is used for detecting whether the 677 position of the MTRR gene contains A base, and tube B, Cy5 is used for detecting whether the 677 position of the MTRR gene contains G base; VIC detects whether the 677 site of the MTHFR gene contains C base or not, and VIC detects whether the 677 site of the MTHFR gene contains T base or not; FAM detects whether 1298 position of MTHFR gene contains A base or not, and B tube FAM detects whether 1298 position of MTHFR gene contains C base or not.
FIG. 4 detection of Signal Effect by inhibitor Multi-reaction System
A and B: and (3) detecting the detection influence on samples of homozygous AA (Cy5: MTRR (66AA)) and homozygous GG (Cy5: MTRR (66GG)) at the 66 th site of the MTRR gene before and after adding a mutant template inhibitor (66-MB) in a wild type reaction system. C and D: detecting the detecting influence on samples of homozygous AA (Cy5: MTRR (66AA)) and homozygous GG (Cy5: MTRR (66GG)) at the 66 th site of the MTRR gene before and after adding a wild-type template inhibitor (66-WB) in a mutant reaction system. E and F: the detection effect on samples of homozygous CC (FAM: MTHFR (677CC)) and homozygous TT (FAM: MTHFR (677TT)) at the 677 locus of the MTHFR gene before and after addition of the mutant template inhibitor (677-MB) was examined in a wild-type reaction system. G and H: the effect of detection on samples of homozygous CC (FAM: MTHFR (677CC)) and homozygous TT (FAM: MTHFR (677TT)) at the 677 site of the MTHFR gene before and after addition of a wild-type template inhibitor (677-WB) was examined in a mutant reaction system. I and J: the effect of detection on samples of homozygous AA (FAM: MTHFR (1298AA)) and homozygous CC (FAM: MTHFR (1298CC)) at position 1298 of the MTHFR gene before and after addition of mutant template inhibitor (1298-MB) was examined in a wild-type reaction system. K and K: the effect of detection on samples homozygous for AA (FAM: MTHFR (1298AA)) and homozygous CC (FAM: MTHFR (1298CC)) at the 1298 locus of the MTHFR gene before and after addition of the wild-type template inhibitor (1298-WB) was examined in mutant reaction systems.
FIG. 5 detection System sensitivity
Tube A Cy5: MTRR (66AG) is a template added into tube A and hybridized by AG at position 66 of MTRR gene; tube B Cy5: MTRR (66AG) is a template added into tube B and hybridized by AG at position 66 of MTRR gene; MTHFR (677CT) A tube is added with a template with MTHFR gene 677 as CT hybrid; MTRR (677CT) B tube is added with a template with MTHFR gene 677 position as CT heterozygous; adding a template with 1298AC position of MTHFR gene in an A tube VIC (MTHFR 1298AC) A tube; MTHFR (1298AC) A template heterozygous for AC at position 1298 of the MTHFR gene was added to tube B VIC.
Detailed Description
The following detailed description of the present invention is provided in conjunction with the accompanying drawings, but it should be understood that the scope of the present invention is not limited to the specific embodiments.
Example 1
1. Primer, probe and inhibitor for detecting polymorphism of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G
1) Specific arms-PCR primers and probes were designed with reference to premier primer5.0, based on the MTHFR Gene sequence published by the NCBI database (Gene ID:4524), with reference to the 677C > T site (rs1801133) of the MTHFR Gene. The mutant plasmid and the wild plasmid constructed by genetic engineering are used as templates to establish a real-time fluorescent PCR detection system, so that the rs1801133 can be detected with high sensitivity and high specificity.
The primer and the probe for detecting the mutation of the MTHFR gene 677C > T are characterized in that the primer and the probe are designed according to the rs1801133 locus of the MTHFR gene and have the following sequences:
wild-type ARMS upstream primer, 677-WF: AAGCTGCGTGATGATGACATAGG
Mutant ARMS forward primer, 677-MF: AAGCTGCGTGATGATGAAACTGA
Common downstream primer, 677-R: AAGGCCACCCCGAAGCAGGGA
Fluorescent probe, 677-P: FAM-ACCTGAAGCACTTGAAGGAGAAGGTGTCT-BHQ1
The 5 'end fluorescent group of the probe for detecting MTHFR gene 677C > T mutation is a conventionally used fluorescent reporter group suitable for fluorescent quantitative PCR analysis, preferably FAM, VIC, HEX, cy5 or ROX, the 3' end quenching group is a conventionally used fluorescent quenching group suitable for fluorescent quantitative PCR analysis, preferably TAMRA, BHQ1, BHQ2, MGB or Dabcy1, more preferably the 5 'end fluorescent group of the probe for detecting BMTHFR gene 677C > T mutation is FAM, and the 3' end fluorescent quenching group of the probe for detecting MTHFR gene 677C > T mutation is BHQ 1.
The invention combines the arms-pcr and the taq-man probe fluorescence quantitative pcr, the detection sensitivity can reach more than 1 percent, but the invention has certain limitation, and false positive can appear in the arms-pcr technology. In order to solve the problem, aiming at a wild type template and a mutant type template, a specific inhibitor is designed through a large amount of experimental optimization, the mutant type amplification can be specifically inhibited when the wild type template is detected, and the wild type amplification can be specifically inhibited when the mutant type template is detected. Inhibitor for the detection of the 677C > T mutation of the MTHFR gene, characterized in that the sequence of said inhibitor is designed to:
wild-type template inhibitor, 677-WB: AAGCTGCGTGATGATGAAACTGA-ddC
Mutant template inhibitor, 677-MB: AAGCTGCGTGATGATGACATAGG-ddC
The above-mentioned inhibitor for specifically detecting wild type or mutant type of MTHFR gene 677C > T has a specific modification at the 3 'end, preferably C3 spacer, phosphorylation, thio, MGB, dideoxycytidine (ddC), etc., and more preferably a modification at the 3' end of the inhibitor for specifically detecting wild type or mutant type of MTHFR gene 677C > T. The inhibitor can specifically bind with the template of MTHFR gene 677C > T wild type or mutant type, and inhibit non-specific amplification.
2) Specific arms-PCR primers and probes were designed with reference to premier primer5.0, based on the MTHFR Gene sequence published by the NCBI database (Gene ID:4524), with reference to the MTHFR Gene 1298A > C mutation site (rs 1801131). A real-time fluorescence PCR detection system is established by taking a mutant plasmid and a wild plasmid constructed by genetic engineering as templates, so that high-sensitivity and high-specificity detection of the 1298A > C mutation of the MTHFR gene is realized.
The primer and the probe for detecting the MTHFR gene 1298A > C mutation are characterized in that the detection primer and the probe are designed according to the rs1801131 site, and have the following sequences:
wild-type ARMS upstream primer, 1298-WF: GGGGAGGAGCTGACCAGAGACGA
Mutant ARMS forward primer, 1298-MF: GGGGAGGAGCTGACCAGTGCATC
Common downstream primer, 1298-R: CCACTCCAGCATCACTCACTT
Fluorescent probe, 1298-P: VIC-ACCTCTCGGGAGAACCAAACCGGAAT-BHQ1
The 5 'end fluorescent group of the probe for detecting the MTHFR gene 1298A > C mutation is a conventionally used fluorescent reporter group suitable for fluorescent quantitative PCR analysis, preferably FAM, VIC, HEX, cy5 or ROX, the 3' end quenching group is a conventionally used fluorescent quenching group suitable for fluorescent quantitative PCR analysis, preferably TAMRA, BHQ1, BHQ2, MGB or Dabcy1, more preferably the 5 'end fluorescent group of the probe for detecting the MTHFR gene 1298A > C mutation is FAM, and the 3' end fluorescent quenching group of the probe for detecting the MTHFR gene 1298A > C mutation is BHQ 1.
Aiming at a wild type template and a mutant type template, a specific inhibitor is designed through a large amount of experimental optimization, the mutant type amplification can be specifically inhibited when the wild type template is detected, and the wild type amplification can be specifically inhibited when the mutant type template is detected. Inhibitor for the detection of the 1298A > C mutation of the MTHFR gene, characterized in that the sequence of said inhibitor is designed to:
wild-type templating inhibitor, 1298-WB: GGGGAGGAGCTGACCAGTGCATC-ddC
Mutant template inhibitor, 1298-MB: GGGGAGGAGCTGACCAGAGACGA-ddC
The above inhibitor for specifically detecting wild type or mutant type MTHFR gene 1298A > C has a specific modification at the 3' end, preferably C3 spacer, phosphorylation, thio, MGB, dideoxycytidine (ddC), etc., and more preferably ddC for specifically detecting wild type or mutant type MTHFR gene 1298A > C. The inhibitor can be specifically combined with a wild type or mutant template of MTHFR gene 1298A > C to inhibit non-specific amplification.
3) Specific arms-PCR primers and probes were designed using primer primer primer primer5.0 from premier, based on MTRR Gene sequences published by NCBI database (Gene ID:4552) with reference to the MTRR Gene 66A > G mutation site (rs 1801394). The mutant plasmid and the wild plasmid constructed by genetic engineering are used as templates to establish a real-time fluorescent PCR detection system and realize high-sensitivity and high-specificity detection on the site 66A > G of the MTRR gene.
The primer and the probe for detecting the 66A > G locus of the MTRR gene are characterized in that the primer and the probe for detecting are designed according to the rs1801394 locus and have the following sequences:
wild-type ARMS upstream primer, 66-WF: GCAAAGGCCATCGCAGAAGACATA
Mutant ARMS forward primer, 66-MF: GCAAAGGCCATCGCAGAAGACAGG
Common downstream primer, 66-R: CTTCAAAGCACAAAACGGTAA
Fluorescent probe, 66-P: CY5-AAGCTGTGGTACATGGATTTTCTGCAGAT-BHQ2
The 5 'end fluorescent group of the probe for detecting MTRR gene 66A > G mutation is a conventionally used fluorescent reporter group suitable for fluorescent quantitative PCR analysis, preferably FAM, VIC, HEX, cy5 or ROX, the 3' end quenching group is a conventionally used fluorescent quenching group suitable for fluorescent quantitative PCR, preferably TAMRA, BHQ1, BHQ2, MGB or Dabcy1, more preferably the 5 'end fluorescent group of the probe for detecting MTRR gene 66A > G mutation is FAM, and the 3' end fluorescent quenching group of the probe for detecting MTRR gene 66A > G mutation is BHQ 2.
Aiming at a wild type template and a mutant type template, a specific inhibitor is designed through a large amount of experimental optimization, the mutant type amplification can be specifically inhibited when the wild type template is detected, and the wild type amplification can be specifically inhibited when the mutant type template is detected. Inhibitor for the detection of the MTRR gene 66A > G, characterized in that the sequence of the inhibitor is designed to:
wild-type template inhibitor, 66-WB: GCAAAGGCCATCGCAGAAGACAGG-ddC
Mutant template inhibitors, 66-MB: GCAAAGGCCATCGCAGAAGACATA-ddC
The above-mentioned inhibitor for specifically detecting wild type or mutant type of MTRR gene 66A > G mutation is modified at the 3' end with a specific modification, preferably C3 spacer, phosphorylation, thio, MGB and dideoxycytidine (ddC), and more preferably ddC for specifically detecting wild type or mutant type of MTRR gene 66A > G. The inhibitor can be specifically combined with a template of a wild type or a mutant type of MTRR gene 66A > G to inhibit non-specific amplification.
2. Positive and negative quality control
In order to increase the contrast of the detection result, the method introduces positive control and negative quality control.
The positive quality control of the invention comprises three site heterozygous information of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G which are designed according to the three site sequences of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G published by NCBI database, and the construction of mutant plasmid is carried out by a gene engineering construction method. A real-time fluorescence PCR detection system is established by taking heterozygous polymorphic plasmids containing MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G constructed by genetic engineering as a template, and the positive control detection of mutation of three sites of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G is realized.
The method is characterized in that the positive quality control sequence is as follows:
MTHFR gene 677C > T (SEQ ID NO.19& SEQ ID NO. 20);
MTHFR gene 1298A > C (SEQ ID NO.21& SEQ ID NO. 22);
MTRR gene 66A > G (SEQ ID NO.23& SEQ ID NO. 24);
the positive quality control used in the present invention is a mixed sample of heterozygote type containing equal amounts of 677C > T, MTHFR gene 1298A > C of MTHFR gene and 66A > G3 sites of MTRR gene at a concentration of preferably 10 ng/. mu.l.
The negative control in the present invention was sterilized deionized water.
3. Template extraction to be tested
The sample selected by the invention can be blood or other samples to be detected containing genome DNA such as oral cavity testers and the like. Extraction of sample DNA was performed using commercially available small-scale nucleic acid extraction kits. In the invention, a cosmetic biological nucleic acid extraction Kit HiPure Blood DNA Midi Kit II (D3113-03, magenta) is adopted, and a specific use method is carried out by referring to a Kit instruction. And extracting DNA from the sample to be detected by adopting a commercial kit and then storing for later use.
4. Reaction system
In order to ensure the stability of the PCR reaction system, the PCR reaction system adopts a reaction system containing reagents such as hot start taq enzyme, buffer solution, magnesium ions, dNTP and the like. Experimental consumables such as hot start taq enzyme (M7406, Promega), buffer, magnesium ions and dNTP (U1515, Promega) were purchased from Promega Biotech Inc.
In order to ensure the accuracy and the rigor of detection, the invention is provided with a positive quality control and negative quality control dual-quality control detection system, which can analyze whether the DNA to be detected can be normally amplified and eliminate the reason which can cause PCR failure. Each sample to be tested needs to be subjected to two-tube reaction, and the reaction is divided into an A tube (wild type reaction system) and a B tube (mutant type reaction system). The PCR reaction solution contains the above-described primers, probes and inhibitors, as well as hot-start taq enzyme, buffer, magnesium ions, dNTPs, and the like required for the PCR reaction. The composition of the reaction solution of the tube A and the tube B is as follows:
tube A:
and (B) tube:
5. PCR reaction
Each sample to be detected needs to be subjected to two-tube reaction and is divided into a tube A and a tube B. Meanwhile, each test sample should be provided with a positive control reaction and a negative control reaction. 10ng of each DNA sample was added to the tube A and tube B reaction system as described above, and the reactions were mixed and made up to 20. mu.l with sterilized deionized water. The prepared reaction system is subjected to fluorescent quantitative PCR reaction, and the instrument used in the scheme of the invention is ABI 7500. In the present invention, the fluorescence channels are selected from FAM, VIC and CY5, and the preferred PCR amplification conditions are:
the conditions for pre-denaturation were: at 95 ℃ for 2 minutes;
the PCR reaction consists of two stages:
the first phase consists of 5 amplification cycles with the conditions:
denaturation: 95 ℃ for 10 seconds;
annealing: 60 ℃, 20 seconds;
extension: 72 ℃ for 20 seconds;
the second phase consists of 40 amplification cycles with the conditions:
denaturation: 95 ℃ for 10 seconds;
annealing: setting fluorescence signal collection at 60 ℃ for 20 seconds;
extension: 72 ℃ for 20 seconds;
6. analysis of detection results
Under the conditions of the PCR reaction system and the temperature cycle program, the reaction system and the result are evaluated according to the signal conditions of the positive quality control, the negative quality control and the A tube and the B tube. In the present invention, the Ct value is determined by using a 10-fold standard deviation of the fluorescence value at 3 to 15 cycles before the amplification process as a threshold value and by using the cycle number at which the fluorescence value exceeds the threshold value as a threshold cycle number (Ct value). FAM signal is used for detecting MTHFR gene 677C > T, VIC signal is used for detecting MTHFR gene 1298A > C, CY5 is used for detecting MTRR gene 66A > G three site sequence (rs number). The detection result is interpreted according to the following scheme:
1) in the negative control reaction, FAM, VIC and CY5 should not peak and have no Ct value (see FIG. 1); if FAM, VIC or CY5 peaks in the negative control, it indicates that the reaction system is contaminated, please remove the contamination and then re-perform the reaction.
2) In the positive control reaction, FAM, VIC and CY5 should all peak normally and exhibit an "S" type curve (see fig. 2); if any of FAM, VIC and CY5 signals do not normally peak in the positive control reaction, please check the reaction program setup for correctness.
3) Satisfying 1) and 2) results, the detection signals in tube A and tube B were observed (see FIG. 3):
if FAM signal rises in the tube A and no FAM signal rises in the tube B, the MTHFR gene 677C > T is CC; if no FAM signal rises in the tube A and FAM signal rises in the tube B, the MTHFR gene 677C > T is TT; if FAM signal rises in tube A and FAM signal rises in tube B, then MTHFR gene 677C > T is CT.
If the VIC signal in the tube A rises and the VIC signal in the tube B does not rise, the MTHFR gene 1298A > C is AA; if no VIC signal rises in tube A and a VIC signal rises in tube B, the MTHFR gene 1298A > C is CC; if there is a rise in the VIC signal in tube A and a rise in the VIC signal in tube B, the MTHFR gene 1298A > C is AC.
If CY5 signal rises in tube A and no CY5 signal rises in tube B, the MTHFR gene 66A > G is AG; if the CY5 signal does not rise in the tube A and the CY5 signal rises in the tube B, the MTHFR gene 66A > G is GG; if CY5 signal is elevated in tube A and CY5 signal is elevated in tube B, the MTHFR gene 66A > G is AG.
7. Sensitivity analysis
The system of the invention adds inhibitors aiming at wild type templates and mutant templates, the 3 'end adopts special modification, the preferred modes are C3 spacer, phosphorylation, thio, MGB, dideoxycytidine (ddC) and the like, and the more preferred scheme is that the 3' end of the inhibitor for specifically blocking three of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G adopts ddC modification. The blocker can specifically bind with three sequences of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G, and can perform non-specific amplification (see figure 4)
By a quantitative method, samples containing three heterozygous polymorphic sites of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G are dissolved in an aqueous solution and mixed into 200ng/ul, 100ng/ul, 50ng/ul, 10ng/ul, 5ng/ul and 1ng/ul control substances. The diluted sample DNA is detected according to the method of example 1, and the result shows that the invention can detect three polymorphism samples of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G under the background condition of 1-200ng DNA (see figure 5). The extraction range of the existing blood nucleic acid extraction kit is mainly 1-200ng/ul, so that the method can identify three polymorphisms of MTHFR gene 677C > T, MTHFR gene 1298A > C and MTRR gene 66A > G without measuring the concentration of a DNA template, and is simple and rapid.
The quality of the template DNA is important for the PCR reaction, and OD260/OD280 is an index for evaluating the quality of the DNA. If OD is greater than the total260/OD280The value of 1.8 indicates that the quality of DNA is better; OD260/OD280>1.9, indicating RNA contamination; OD260/OD280<1.6, protein, phenol, etc. contamination was indicated. The system of the invention is used to test different quality of template DNA and is found in OD260/OD280>1.9 and OD260/OD280<1.6 the MTHFR gene 677C can still be identified>T, MTHFR Gene 1298A>C and MTRR Gene 66A>G three polymorphisms (see example 2).
Example 2
The use of the kit of the present invention is described in detail below with reference to specific example 2, and example 2 is implemented on the premise of the technology of the present invention, and a detailed implementation mode and a specific operation process are given. Example 2 blood samples of 19 samples were collected and designated as samples nos. 1-19, respectively, and the results of the detection by the method of the present invention were compared with the results of the first-generation sequencing to confirm the accuracy of the present invention.
1.19 example extraction of genomic DNA from blood sample
Extraction of sample DNA was performed using commercially available small-scale nucleic acid extraction kits. In the invention, a cosmetic biological nucleic acid extraction Kit HiPure Blood DNA Midi Kit II (D3113-03, magenta) is adopted, and a specific use method is carried out by referring to a Kit instruction. And extracting DNA from the sample to be detected by adopting a commercial kit and then storing for later use.
DNA from 19 samples was detected using an ultraviolet spectrophotometer for determination of DNA concentration and quality. OD of 19 sample DNAs260/OD280The detection results are as follows:
2. reaction system configuration
Tube A reaction system:
b tube reaction system:
3. addition of sample template DNA
Taking the template DNA of each sample, directly and respectively taking 1uL without detecting the concentration, respectively adding the 1uL into the A/B tube reaction system, carefully covering a tube cover, quickly centrifuging, then placing into a fluorescent quantitative PCR instrument for detection, and carrying out simultaneous operation with positive quality control and negative control. The instrument used in the protocol of the invention is ABI 7500. In the present invention, the fluorescent channels are selected from FAM, VIC and CY 5.
4. Reaction conditions
The conditions for pre-denaturation were: at 95 ℃ for 2 minutes;
the PCR reaction consists of two stages:
the first phase consists of 5 amplification cycles with the conditions:
denaturation: 95 ℃ for 10 seconds;
annealing: 60 ℃, 20 seconds;
extension: 72 ℃ for 20 seconds;
the second phase consists of 40 amplification cycles with the conditions:
denaturation: 95 ℃ for 10 seconds;
annealing: setting fluorescence signal collection at 60 ℃ for 20 seconds;
extension: 72 ℃ for 20 seconds.
5. The result of the detection
Samples nos. 1-19 were tested by the present invention and the results were compared using first generation sequencing. The statistics of the detection results and the sequencing results of the samples No.1 to No.19 through the invention are shown in the following table:
6. conclusion
The results show that the kit has good accuracy when used for detecting the polymorphism of the folate metabolism ability gene, the concentration of a DNA template does not need to be determined, the detection result is completely consistent with the sequencing result, and the accuracy reaches 100%.
SEQUENCE LISTING
<110> Chongqing Puluotong Gene medical research institute Co., Ltd
<120> folate metabolism ability gene MTHFR and MTRR polymorphism detection kit and method
<160>
<210>1
<211>23
<212>
<213> Artificial (Artificial sequence)
<400>1
aagctgcgtg atgatgacat agg 23
<210>2
<211>23
<212>
<213> Artificial (Artificial sequence)
<400>2
aagctgcgtg atgatgaaac tga 23
<210>3
<211>21
<212>
<213> Artificial (Artificial sequence)
<400>3
aaggccaccc cgaagcaggg a 21
<210>4
<211>29
<212>
<213> Artificial (Artificial sequence)
<400>4
acctgaagca cttgaaggag aaggtgtct 29
<210>5
<211>23
<212>
<213> Artificial (Artificial sequence)
<400>5
aagctgcgtg atgatgaaac tga 23
<210>6
<211>23
<212>
<213> Artificial (Artificial sequence)
<400>6
aagctgcgtg atgatgacat agg 23
<210>7
<211>23
<212>
<213> Artificial (Artificial sequence)
<400>7
ggggaggagc tgaccagaga cga 23
<210>8
<211>23
<212>
<213> Artificial (Artificial sequence)
<400>8
ggggaggagc tgaccagtgc atc 23
<210>9
<211>21
<212>
<213> Artificial (Artificial sequence)
<400>9
ccactccagc atcactcact t 21
<210>10
<211>26
<212>
<213> Artificial (Artificial sequence)
<400>10
acctctcggg agaaccaaac cggaat 26
<210>11
<211>23
<212>
<213> Artificial (Artificial sequence)
<400>11
ggggaggagc tgaccagtgc atc 23
<210>12
<211>23
<212>
<213> Artificial (Artificial sequence)
<400>12
ggggaggagc tgaccagaga cga 23
<210>13
<211>24
<212>
<213> Artificial (Artificial sequence)
<400>13
gcaaaggcca tcgcagaaga cata 24
<210>14
<211>24
<212>
<213> Artificial (Artificial sequence)
<400>14
gcaaaggcca tcgcagaaga cagg 24
<210>11
<211>21
<212>
<213> Artificial (Artificial sequence)
<400>15
<210>15
<211>21
<212>
<213> Artificial (Artificial sequence)
cttcaaagca caaaacggta a 21
<400>16
<211>29
<212>
<213> Artificial (Artificial sequence)
<400>16
aagctgtggt acatggattt tctgcagat 29
<210>17
<211>24
<212>
<213> Artificial (Artificial sequence)
<400>17
gcaaaggcca tcgcagaaga cagg 24
<210>18
<211>24
<212>
<213> Artificial (Artificial sequence)
<400>18
gcaaaggcca tcgcagaaga cata 24
<210>19
<211>
<212>
<213> Artificial (Artificial sequence)
<400>19
agcccccaaa gcagaggact ctctctgccc agtccctgtg gtctcttcat ccctcgcctt 60
gaacaggtgg aggccagcct ctcctgactg tcatccctat tggcaggtta ccccaaaggc 120
caccccgaag cagggagctt tgaggctgac ctgaagcact tgaaggagaa ggtgtctgcg 180
ggagccgatt tcatcatcac gcagcttttc tttgaggctg acacattctt ccgctttgtg 240
aaggcatgca ccgacatggg catcacttgc cccatcgtcc ccgggatctt tcccatccag 300
gtgaggggcc caggagagcc cataagctcc ctccacccca ctctcaccgc accgtcctcg 360
c 361
<210>20
<211>
<212>
<213> Artificial (Artificial sequence)
<400>20
agcccccaaa gcagaggact ctctctgccc agtccctgtg gtctcttcat ccctcgcctt 60
gaacaggtgg aggccagcct ctcctgactg tcatccctat tggcaggtta ccccaaaggc 120
caccccgaag cagggagctt tgaggctgac ctgaagcact tgaaggagaa ggtgtctgcg 180
ggagtcgatt tcatcatcac gcagcttttc tttgaggctg acacattctt ccgctttgtg 240
aaggcatgca ccgacatggg catcacttgc cccatcgtcc ccgggatctt tcccatccag 300
gtgaggggcc caggagagcc cataagctcc ctccacccca ctctcaccgc accgtcctcg 360
c 361
<210>21
<211>
<212>
<213> Artificial (Artificial sequence)
<400>21
gtgccctgac ctctgggcac ccctctgcca ggggcaattc ctcttcccct gcctttgggg 60
agctgaagga ctactacctc ttctacctga agagcaagtc ccccaaggag gagctgctga 120
agatgtgggg ggaggagctg accagtgaag aaagtgtctt tgaagtcttc gttctttacc 180
tctcgggaga accaaaccgg aatggtcaca aagtgagtga tgctggagtg gggaccctgg 240
ttcatcccct gcccctggcc tgaccccagc tgcaggccag gctgcggggc tgtgacttcc 300
ccatcc 306
<210>22
<211>
<212>
<213> Artificial (Artificial sequence)
<400>22
gtgccctgac ctctgggcac ccctctgcca ggggcaattc ctcttcccct gcctttgggg 60
agctgaagga ctactacctc ttctacctga agagcaagtc ccccaaggag gagctgctga 120
agatgtgggg ggaggagctg accagtgaag caagtgtctt tgaagtcttc gttctttacc 180
tctcgggaga accaaaccgg aatggtcaca aagtgagtga tgctggagtg gggaccctgg 240
ttcatcccct gcccctggcc tgaccccagc tgcaggccag gctgcggggc tgtgacttcc 300
ccatcc 306
<210>23
<211>
<212>
<213> Artificial (Artificial sequence)
<400>23
atctttaggt tgttactgct tcattaaaaa gaggatcttt tttcccccat ttttcagttt 60
cactgttaca tgccttgaag tgatgaggag gtttctgtta ctatatgcta cacagcaggg 120
acaggcaaag gccatcgcag aagaaatatg tgagcaagct gtggtacatg gattttctgc 180
agatcttcac tgtattagtg aatccgataa ggttagagcc gttacagtgg attttaccgt 240
tttgtgcttt gaagaattt 259
<210>24
<211>
<212>
<213> Artificial (Artificial sequence)
<400>24
atctttaggt tgttactgct tcattaaaaa gaggatcttt tttcccccat ttttcagttt 60
cactgttaca tgccttgaag tgatgaggag gtttctgtta ctatatgcta cacagcaggg 120
acaggcaaag gccatcgcag aagaaatgtg tgagcaagct gtggtacatg gattttctgc 180
agatcttcac tgtattagtg aatccgataa ggttagagcc gttacagtgg attttaccgt 240
tttgtgcttt gaagaattt 259
Claims (8)
1. A genotype typing detection kit for polymorphic sites of folate metabolism ability genes comprises a mutant reaction system and a wild reaction system; the reaction system comprises upstream and downstream primers, a fluorescent probe and an inhibitor;
the mutant reaction system comprises an rs1801133 mutant group, an rs1801131 mutant group and an rs1801394 mutant group; the rs1801133 mutant group upstream primer is shown as SEQ ID NO.2, the downstream primer is shown as SEQ ID NO.3, the fluorescent probe is shown as SEQ ID NO.4, and the inhibitor is shown as SEQ ID NO. 6; the rs1801131 mutant group upstream primer is shown as SEQ ID NO.8, the downstream primer is shown as SEQ ID NO.9, the fluorescent probe is shown as SEQ ID NO.10, and the inhibitor is shown as SEQ ID NO. 12; the rs1801394 mutant group upstream primer is shown as SEQ ID NO.14, the downstream primer is shown as SEQ ID NO.15, the fluorescent probe is shown as SEQ ID NO.16, and the inhibitor is shown as SEQ ID NO. 18;
the wild type reaction system comprises an rs1801133 wild group, an rs1801131 wild group and an rs1801394 wild group; rs1801133 wild group upstream primer is shown as SEQ ID NO.1, downstream primer is shown as SEQ ID NO.3, fluorescent probe is shown as SEQ ID NO.4, and inhibitor is shown as SEQ ID NO. 5; rs1801131 wild group upstream primer is shown as SEQ ID NO.7, downstream primer is shown as SEQ ID NO.9, fluorescent probe is shown as SEQ ID NO.10, and inhibitor is shown as SEQ ID NO. 11; rs1801394 wild group upstream primer is shown as SEQ ID NO.13, downstream primer is shown as SEQ ID NO.15, fluorescent probe is shown as SEQ ID NO.16, and inhibitor is shown as SEQ ID NO. 17.
2. The kit for genotyping and detecting the polymorphic site of the folate metabolism capability gene of claim 1, wherein the mass ratio of the upstream primer, the downstream primer, the probe and the inhibitor is 2:2:2: 3.
3. The kit for genotyping and detecting the polymorphic site of the folate metabolism capability gene of claim 1 or 2, wherein the reaction system further comprises hot-start taq enzyme, buffer solution, magnesium ions and dNTP.
4. The kit for genotyping and detecting the polymorphic site of the folate metabolism capability gene according to any one of claims 1 to 3, further comprising a positive quality control and a negative quality control, wherein the positive quality control sequence is shown in SEQ ID NO.19 to 21, and the negative quality control is water.
5. The kit for genotyping and detecting a polymorphic site in a folate metabolism gene according to any one of claims 1 to 3, wherein the positive quality control concentration is 10ng/μ l.
6. The method for detecting a genotype test kit for a polymorphic site in a folate metabolizing ability gene according to any one of claims 1 to 5, comprising PCR amplification by a combination of real-time fluorescent quantitative PCR and a mutant amplification PCR system (Arms-PCR).
7. The method for detecting the genotyping detection kit for the polymorphic sites of the folate metabolism ability gene of claim 6, wherein the PCR amplification conditions comprise:
the conditions for pre-denaturation were: at 95 ℃ for 2 minutes;
the PCR reaction consists of two stages:
the first phase consists of 5 amplification cycles with the conditions: denaturation: 95 ℃ for 10 seconds; annealing: 60 ℃, 20 seconds; extension: 72 ℃ for 20 seconds;
the second phase consists of 40 amplification cycles with the conditions: denaturation: 95 ℃ for 10 seconds; annealing: setting fluorescence signal collection at 72 ℃ for 20 seconds; extension: 72 ℃ for 20 seconds.
8. The method for detecting the genotyping detection kit for the polymorphic site of the folate metabolism ability gene of claim 6 or 7, comprising an interpretation method, wherein the interpretation method is used for observing whether fluorescence detection signals in a wild reaction system and a mutation reaction system form a logarithmic amplification "S" curve or not under the conditions of the PCR reaction system and a cycle program; if a logarithmic amplification "S" curve is formed, the sample to be detected contains the polymorphic site to be detected.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911282775.1A CN111118138A (en) | 2019-12-13 | 2019-12-13 | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911282775.1A CN111118138A (en) | 2019-12-13 | 2019-12-13 | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111118138A true CN111118138A (en) | 2020-05-08 |
Family
ID=70498661
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911282775.1A Pending CN111118138A (en) | 2019-12-13 | 2019-12-13 | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111118138A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111808943A (en) * | 2020-06-18 | 2020-10-23 | 重庆浦洛通基因医学研究院有限公司 | Gene detection method for individual medication of mental |
| CN111876482A (en) * | 2020-09-21 | 2020-11-03 | 郑州安图生物工程股份有限公司 | Kit for simultaneously detecting human MTHFR and MTRR genes |
| CN112094899A (en) * | 2020-09-24 | 2020-12-18 | 江苏先声医疗器械有限公司 | Detection method of folic acid metabolism capability based on MassArray nucleic acid mass spectrum and application thereof |
| CN117305477A (en) * | 2023-11-27 | 2023-12-29 | 北京纳百生物科技有限公司 | Fluorescence detection kit for genotyping of cat blood group |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107630073A (en) * | 2017-10-30 | 2018-01-26 | 厦门基源医疗科技有限公司 | A kind of genotype detection method and kit of folic acid metabolism gene polymorphism sites |
| CN108251510A (en) * | 2018-03-13 | 2018-07-06 | 普迈德（北京）科技有限公司 | A kind of kit, detection method and its application of folic acid metabolism ability Genotyping |
| CN108753944A (en) * | 2018-05-10 | 2018-11-06 | 深圳市亿立方生物技术有限公司 | Detect the primer and probe and kit of folic acid metabolism related gene loci genotype |
| CN109182501A (en) * | 2018-09-28 | 2019-01-11 | 江门市妇幼保健院 | A kind of folic acid metabolism genetic polymorphism detection primer and kit |
-
2019
- 2019-12-13 CN CN201911282775.1A patent/CN111118138A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107630073A (en) * | 2017-10-30 | 2018-01-26 | 厦门基源医疗科技有限公司 | A kind of genotype detection method and kit of folic acid metabolism gene polymorphism sites |
| CN108251510A (en) * | 2018-03-13 | 2018-07-06 | 普迈德（北京）科技有限公司 | A kind of kit, detection method and its application of folic acid metabolism ability Genotyping |
| CN108753944A (en) * | 2018-05-10 | 2018-11-06 | 深圳市亿立方生物技术有限公司 | Detect the primer and probe and kit of folic acid metabolism related gene loci genotype |
| CN109182501A (en) * | 2018-09-28 | 2019-01-11 | 江门市妇幼保健院 | A kind of folic acid metabolism genetic polymorphism detection primer and kit |
Non-Patent Citations (1)
| Title |
|---|
| HAO WM等: "modified proofreading pcr for detection of point mutations, insertions and deletions using a ddNTP-Blocked primer", 《PLOS ONE》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111808943A (en) * | 2020-06-18 | 2020-10-23 | 重庆浦洛通基因医学研究院有限公司 | Gene detection method for individual medication of mental |
| CN111808943B (en) * | 2020-06-18 | 2021-07-20 | 重庆浦洛通基因医学研究院有限公司 | Gene detection method for individual medication of mental |
| CN111876482A (en) * | 2020-09-21 | 2020-11-03 | 郑州安图生物工程股份有限公司 | Kit for simultaneously detecting human MTHFR and MTRR genes |
| CN112094899A (en) * | 2020-09-24 | 2020-12-18 | 江苏先声医疗器械有限公司 | Detection method of folic acid metabolism capability based on MassArray nucleic acid mass spectrum and application thereof |
| CN112094899B (en) * | 2020-09-24 | 2021-06-25 | 江苏先声医疗器械有限公司 | Detection method of folic acid metabolism capability based on MassArray nucleic acid mass spectrum and application thereof |
| CN117305477A (en) * | 2023-11-27 | 2023-12-29 | 北京纳百生物科技有限公司 | Fluorescence detection kit for genotyping of cat blood group |
| CN117305477B (en) * | 2023-11-27 | 2024-03-08 | 北京纳百生物科技有限公司 | Fluorescence detection kit for genotyping of cat blood group |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111118138A (en) | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR | |
| CN108690876A (en) | Detect primer, probe and application, kit and the detection method of ACE gene pleiomorphisms | |
| CN107828870A (en) | One kind detects MTHFR and MTRR gene pleiomorphisms kit and method simultaneously using molecular beacon probe melting curve method | |
| CN111235272B (en) | Composition for once detecting multiple gene mutation of lung cancer and application thereof | |
| CN106701987A (en) | PCR (polymerase chain reaction) amplification system for genotyping of three SNP (single-nucleotide polymorphism) loci related to human folic acid metabolism and detection kit | |
| CN108913757B (en) | Primer group and detection kit for chromosome aneuploid number abnormality and application thereof | |
| JP5290957B2 (en) | Probes for detecting polymorphisms in immune-related genes and uses thereof | |
| CN106834434B (en) | Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism | |
| CN114214402B (en) | Primer group, kit and detection method for detecting blood hypercoagulability or venous thrombosis risk gene polymorphism and application | |
| CN106939334B (en) | Method for detecting fetal DNA content in plasma of pregnant woman | |
| EP2450443B1 (en) | Target sequence amplification method, polymorphism detection method, and reagents for use in the methods | |
| CN114107488A (en) | Primer group and kit for detecting MTHFR gene polymorphism | |
| CN111235268B (en) | SNP locus genotype detection reagent and application in corresponding kit and kit | |
| CN105624315A (en) | Primers and reagent kit for detecting polymorphism of ALDH2 gene c.1510 locus | |
| CN105950766B (en) | Primer group and kit for detecting HLA-B5801 allele | |
| CN110878351A (en) | Method for detecting MTHFR gene polymorphism by fluorescent quantitative PCR | |
| CN110863040A (en) | Method for detecting CYP3A5 gene polymorphism by fluorescent quantitative PCR | |
| CN113913530B (en) | Molecular marker related to sheep body height and application thereof | |
| CN106636365B (en) | Nucleic acid, kit and method for detecting A1166C polymorphic site of AGTR1 gene | |
| CN111235252A (en) | Method for distinguishing individual medication of nitrendipine by mass spectrometry through detecting product | |
| CN116949143A (en) | Sequence composition for detecting MTHFR and MTRR genes, kit and application | |
| CN112779322A (en) | Gene mutation detection kit based on non-fluorescence labeled probe and high-resolution melting curve, detection method and application thereof | |
| CN110819709A (en) | Method for detecting CYP2C9 and VKORC1 gene polymorphism by fluorescent quantitative PCR (polymerase chain reaction) | |
| CN112029851A (en) | Method and kit for detecting gene polymorphism of clopidogrel medication and application of kit | |
| CN111334568A (en) | Multiple connection probe amplification probe combination and kit for screening congenital heart disease gene copy number variation and susceptible persons |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200508 |
|
| RJ01 | Rejection of invention patent application after publication |