CN111500751A

CN111500751A - Detection method and kit for rapidly detecting high-toxicity Klebsiella pneumoniae

Info

Publication number: CN111500751A
Application number: CN202010278740.7A
Authority: CN
Inventors: 刘洋; 龙丹; 万腊根; 孔蕴源; 向天新
Original assignee: Individual
Current assignee: Individual
Priority date: 2020-04-10
Filing date: 2020-04-10
Publication date: 2020-08-07
Anticipated expiration: 2040-04-10
Also published as: CN111500751B

Abstract

The invention discloses a detection method and a kit for rapidly detecting high-toxicity Klebsiella pneumoniae, wherein the method comprises the steps of extracting strain DNA, placing the extracted strain DNA and primers in a reaction solution for L AMP amplification reaction, wherein the reaction solution contains a guide, and the primers comprise an upstream outer primer F3: 5'-TGGGGTTATTCTTTCGCT-3', a downstream outer primer B3: 5'-TTTCCAAGCTTACTGCAATT-3', an upstream inner primer FIP 5 '-CCagCAAAacAGCCTAAATACATTG-TGGGGAGTATCTTTGAGAGG-3', a downstream inner primer BIP 5 '-TTGGGATACTGTGCTATTTTTCTCT-GGGAAGATGAGAAATACGAGC-3', an upstream loop primer L F5'-CGCCTCCGTGATGAGGATG-3', a downstream loop primer L B5'-GCAGAAAAGGGCTAGCGC-3' and L AMP amplification reaction is finished, and then detecting the reaction solution to judge whether high-toxicity Klebsiella pneumoniae exists.

Description

Detection method and kit for rapidly detecting high-toxicity Klebsiella pneumoniae

Technical Field

The invention relates to the technical field of microbial detection, in particular to a detection method and a kit for rapidly detecting high-toxicity Klebsiella pneumoniae.

Background

Klebsiella pneumoniae is a common pathogenic bacterium for community-acquired infections and hospital-acquired infections. The klebsiella pneumoniae has thick capsular polysaccharide and can effectively inhibit phagocytosis of neutrophils and the action of antibiotics, so that pneumonia, bloodstream infection, urinary tract infection and the like are more easily caused. Currently, with the difference of capsular polysaccharide types and the change of bacterial virulence, the infection caused by the high-virulence strain of Klebsiella pneumoniae becomes a worldwide infectious disease. Compared with classical Klebsiella pneumoniae (cKP) acquired in hospitals, the death rate of the HvKP infected vaccine is high, and severe complications such as sepsis and migratory infection are accompanied. In recent years, the drug resistance of hvKP bacteria and the relationship with bacterial adaptability/virulence have received worldwide attention. Particularly, the emergence of carbapenem drug-resistant hvKP (CR-hvKP) bacteria brings serious challenges to clinical treatment and basic research.

High-toxicity klebsiella pneumoniae is a common community-acquired and hospital-infected pathogen, can cause disseminated infections such as liver abscess, endophthalmitis and septicemia, is mostly related to serotyping and high-mucus phenotype of K1 and K2 capsules, and is often defined as high-toxicity klebsiella pneumoniae (hvKP). In recent 30 years, it has been found that klebsiella pneumoniae has gradually become the main pathogen of bacterial liver abscess, especially klebsiella pneumoniae with high toxicity, which is more common and is spreading as a new invasive syndrome. hvKP has strong invasiveness and biofilm formation ability, and the resulting infections include abdominal diseases (community-acquired liver abscess, spleen abscess, idiopathic peritonitis), chest diseases (pneumonia, empyema), endophthalmitis, central nervous system diseases (meningitis), skeletal muscle and soft tissue infections, urinary tract infections, mixed infections, bacteremia, among which community-acquired liver abscess are the most common.

The detection of the high-toxicity Klebsiella pneumoniae is an important means for judging the pathogenic causes of disseminated infection such as liver abscess, endophthalmitis, septicemia and the like. The traditional method for detecting high-toxicity Klebsiella pneumoniae comprises colony morphology, wiredrawing test, nematode test, neutrophil phagocytosis resistance test, serum resistance test and the like, and the methods are long in time consumption, cannot report clinic quickly and are easy to delay the disease condition. In addition, the traditional method has low detection sensitivity and weak specificity, and is difficult to distinguish by physiological and biochemical methods especially for strains with similar sources. Although bacteria can be quickly identified by applying the traditional PCR (Polymerase Chain Reaction), the traditional PCR method has expensive equipment, complex steps, high requirements on personnel and difficulty in large-area popularization.

The loop-mediated isothermal amplification technology (L oop-mediated isothermal amplification, L AMP) is a novel nucleic acid in-vitro amplification technology under a constant temperature condition, and has the characteristics of isothermality, rapidness, high specificity, high sensitivity, simple and convenient product detection and the like.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. Therefore, the first purpose of the invention is to provide a detection method for rapidly detecting high-toxicity Klebsiella pneumoniae.

The second purpose of the invention is to provide a detection kit for rapidly detecting high-toxicity Klebsiella pneumoniae.

In order to achieve the above object, in a first aspect, a detection method for rapidly detecting high virulence klebsiella pneumoniae according to an embodiment of the invention includes the steps of:

extracting strain DNA;

placing the extracted strain DNA and the primer into a reaction solution to carry out L AMP amplification reaction;

the reaction solution comprises a primer, and the primer comprises:

the upstream outer primer F3: 5'-TGGGGTTATTCTTTCGCT-3', respectively;

downstream outer primer B3: 5'-TTTCCAAGCTTACTGCAATT-3', respectively;

an upstream inner primer FIP: 5 '-CCagCAAAacAGCCTAAATACATTG-TGGGGAGTATCTTTGAGAGG-3';

the downstream inner primer BIP: 5 '-TTGGGATACTGTGCTATTTTTCTCT-GGGAAGATGAGAAATACGAGC-3';

an upstream loop primer L F: 5'-CGCCTCCGTGATGAGGATG-3';

downstream loop primer L B: 5'-GCAGAAAAGGGCTAGCGC-3';

l after the AMP amplification reaction is finished, the reaction solution is tested to determine whether there is Klebsiella pneumoniae with high toxicity.

Further, according to an embodiment of the present invention, the method for extracting DNA from a strain comprises:

experimental bacteria were inoculated on MH agar plates and cultured overnight in an incubator at 37 ℃;

scraping appropriate amount of bacteria from MH agar plate, placing in 500ul of EP tube containing autoclaved double distilled water, and boiling in water bath for 10 min;

cooling in refrigerator for 10 min;

centrifuging at 12000g for 10min at 4 deg.C, and collecting supernatant.

Further, according to an embodiment of the present invention, the mixed solution of the reaction solution is configured to:

12.5 μ L2 × HNB L AMP;

2.5 μ L10 ×L AMP primer mix;

0.8M betaine;

1.0 μ L Bst DNA polymerase;

1 μ L template DNA;

25 μ L sterile water.

Further, according to an embodiment of the present invention, the 2.5 μ L10 ×L AMP primer mixture concentration is configured as:

the concentrations of the upstream outer primer F3 and the downstream outer primer B3 are respectively as follows: 0.5 uM;

the concentrations of the upstream inner primer FIP and the downstream inner primer BIP are respectively as follows: 8 uM;

the concentration of the upstream loop primer L F and the downstream loop primer L B was 2uM, respectively.

Further, according to one embodiment of the present invention, the reaction conditions of the L AMP amplification reaction are:

placing the mixed solution of L AMP amplification reaction in a water bath environment;

the reaction temperature is as follows: a gradient is formed at every 5 ℃ between 55 and 85 ℃;

the reaction time is as follows: and gradient every 5min for 40-70 min.

Further, according to an embodiment of the present invention, the reaction conditions of the L AMP amplification reaction are specifically:

the reaction temperature is as follows: 65 ℃;

the reaction time is as follows: 60 min;

the termination reaction temperature was: 85 ℃;

the reaction termination time was: and 5 min.

Further, according to an embodiment of the present invention, the detecting the reaction result to determine whether there is klebsiella pneumoniae with high virulence includes:

taking reaction liquid, detecting a PCR amplification result by using agarose gel electrophoresis, if a gradient band is positioned and the minimum band is 180bp, indicating that the Klebsiella pneumoniae with high toxicity exists, and if not, indicating that the Klebsiella pneumoniae with high toxicity does not exist;

or adding SYBR green I into the reaction liquid for fluorescence detection, if the reaction liquid is green, indicating that the high-toxicity Klebsiella pneumoniae exists, otherwise, indicating that the high-toxicity Klebsiella pneumoniae does not exist.

On the other hand, the invention also provides a detection kit for rapidly detecting the high-toxicity Klebsiella pneumoniae, which comprises:

l AMP amplification reaction liquid, wherein the L AMP amplification reaction liquid contains primers which are respectively:

the upstream outer primer F3: 5'-TGGGGTTATTCTTTCGCT-3', respectively;

downstream outer primer B3: 5'-TTTCCAAGCTTACTGCAATT-3', respectively;

an upstream loop primer L F: 5'-CGCCTCCGTGATGAGGATG-3';

the downstream loop primer L B: 5'-GCAGAAAAGGGCTAGCGC-3'.

Further, according to an embodiment of the present invention, the mixed solution of the reaction solution is configured such that:

12.5 μ L2 × HNB L AMP;

2.5 μ L10 ×L AMP primer mix;

0.8M betaine;

1.0 μ L Bst DNA polymerase;

1 μ L template DNA;

25 μ L sterile water.

In addition, the specific primers designed for the peg-344 gene of the high-toxicity Klebsiella pneumoniae are optimized under conditions, results can be obtained within 60min at 65 ℃, electrophoresis detection is not needed, the operation is simple and convenient, the result judgment is simple, and the detection cost is reduced, the lowest detection limit of the L AMP reaction system for the high-toxicity Klebsiella pneumoniae to a genome is 0.475/mu L, the sensitivity is 100 times higher than that of the traditional PCR method, the detection sensitivity is improved, and the specific characteristics are better.

In addition, the establishment of the method provided by the embodiment of the invention can quickly detect the high-toxicity Klebsiella pneumoniae, so that the technology is worthy of further popularization in the primary medical unit, can also be used as a quick primary screening test for monitoring the catering industry environment and food safety by the primary epidemic prevention department, and has important significance in epidemiology.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the structures shown in the drawings without creative efforts.

FIG. 1 is a flow chart of a detection method for rapidly detecting Klebsiella pneumoniae with high virulence according to an embodiment of the present invention;

FIG. 2 is a flow chart of a method for extracting DNA from a strain according to an embodiment of the present invention;

FIG. 3 is a flowchart of another method for rapidly detecting Klebsiella pneumoniae with high virulence according to the embodiment of the present invention;

FIG. 4 is a flowchart of another method for rapidly detecting Klebsiella pneumoniae with high virulence according to the embodiment of the present invention;

FIG. 5 shows the result of detection of L AMP after amplification reaction in 2% agarose gel;

FIG. 6 is a graph showing the results of a sensitivity test of the L AMP method provided in an example of the present invention;

FIG. 7 is a diagram showing the results of gel electrophoresis results of the L AMP method for detecting the products of loop-mediated isothermal amplification of Klebsiella pneumoniae template DNA according to the embodiment of the present invention;

FIG. 8 shows the result of gel electrophoresis of the L AMP method to detect the high-virulence Klebsiella pneumoniae template DNA loop-mediated isothermal amplification products of different strains according to the embodiment of the invention;

the implementation, functional features and advantages of the objects of the present invention will be further explained with reference to the accompanying drawings.

Detailed Description

The present invention will be further explained with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The following examples do not indicate specific conditions as experimental methods, and the strains referred to in the examples are generally known in the art and readily available from published commercial sources to those skilled in the art, according to the conditions in the conventional practice or according to the manufacturer's recommendations.

In one aspect, the invention provides a detection method for rapidly detecting high-toxicity klebsiella pneumoniae, which comprises the following steps: s101, extracting strain DNA.

S102, placing the extracted strain DNA and the primers into a reaction solution to carry out L AMP amplification reaction.

Upstream outer primer F3(5 '→ 3'): TGGGGTTATTCTTTCGCT are provided.

Downstream outer primer B3(5 '→ 3'): TTTCCAAGCTTACTGCAATT are provided.

Upstream inner primer FIP (5 '→ 3'): CCagCAAAacAGCCTAAATACATTG-TGGGGAGTATCTTTGAGAGG.

Downstream inner primer BIP (5 '→ 3'): TTGGGATACTGTGCTATTTTTCTCT-GGGAAGATGAGAAATACGAGC.

The upstream loop primer L F (5 '→ 3'): CGCCTCCGTGATGAGGATG.

The downstream loop primer L B (5 '→ 3'): GCAGAAAAGGGCTAGCGC.

S103 and L, detecting a reaction solution after the AMP amplification reaction is finished to judge whether high-toxicity Klebsiella pneumoniae exists, wherein the reaction solution contains a guide substance, and the primers are respectively as follows:

specifically, in step S101, a strain DNA is extracted by a thermal cracking method, in the embodiment of the present invention, a specific gene peg-344 of klebsiella pneumoniae with high virulence is selected as a target gene and a primer set is designed, and in step S102, the strain DNA and the primer set are placed in a L AMP reaction system to perform an amplification reaction of L AMP (L oop-mediated isothermal amplification technique), after the diffusion reaction, the diffusion reaction result is observed in step S103 to determine whether klebsiella pneumoniae with high virulence is contained in the extracted strain DNA.

In addition, the embodiment of the invention designs specific primers aiming at the specific gene peg-344 gene of the high toxicity Klebsiella pneumoniae, can obtain results within 60min at 65 ℃ through condition optimization without electrophoresis detection, can directly observe by fluorescence, is simple and convenient to operate, has simple result judgment and reduces the detection cost, and the lowest detection limit of the high toxicity Klebsiella pneumoniae L AMP reaction system on a genome is 0.475 pg/mu L, has 100 times higher sensitivity than that of the traditional PCR method, improves the detection sensitivity, and has better specificity characteristics.

Further, in one embodiment of the present invention, the method for extracting DNA from a strain comprises the steps of: s201, experimental bacteria were inoculated on MH agar plates and cultured in an incubator at 37 ℃ overnight.

S202, scraping a proper amount of bacteria from an MH agar plate, placing the bacteria in an EP tube of 500ul of autoclaved double distilled water, and carrying out boiling water bath for 10 min.

And S203, cooling in a refrigerator for 10 min.

S204, centrifuging at 12000g for 10min at the temperature of 4 ℃, and taking supernatant.

Specifically, the preparation of the PCR template strain DNA can be completed through steps S201 to S204, and the whole operation process is aseptic operation.

Further, in a preferred embodiment of the present invention, the mixed solution of the reaction solution is configured such that:

12.5 μ L2 × HNB L AMP.

2.5 μ L10 ×L AMP primer mix.

0.8M betaine.

1.0 μ L Bst DNA polymerase.

1 μ L template DNA.

25 μ L sterile water.

The L AMP reaction satisfies preferable reaction conditions by preparing a mixed solution of the reaction solution.

Further, in a preferred embodiment of the present invention, the concentration of the 2.5 μ L10 ×L AMP primer mixture is configured as follows:

the concentrations of the upstream outer primer F3 and the downstream outer primer B3 are respectively as follows: 0.5 uM.

The concentrations of the upstream inner primer FIP and the downstream inner primer BIP are respectively as follows: 8 uM.

Further, in a preferred embodiment of the present invention, the reaction conditions for the L AMP amplification reaction are:

the reaction time is 40-70 min, and a gradient is formed every 5min, so that the L AMP reaction meets the better reaction condition through the reaction temperature and time condition of the mixed solution of the reaction liquid.

Further, in a preferred embodiment of the present invention, the reaction conditions of the L AMP amplification reaction are specifically:

the reaction temperature is as follows: and 65 ℃.

The reaction time is as follows: and (5) 60 min.

The termination reaction temperature was: 85 ℃.

The reaction termination time was: and 5 min.

The L AMP reaction satisfies preferable reaction conditions by the conditions of the reaction temperature and time of the liquid mixture of the reaction solution.

The step of detecting the reaction result to judge whether the high-toxicity Klebsiella pneumoniae exists comprises the following steps:

s303, taking reaction liquid, detecting a PCR amplification result by using agarose gel electrophoresis, wherein if a gradient band is positioned and the minimum band is 180bp, the existence of the Klebsiella pneumoniae with high toxicity is indicated, and otherwise, the existence of the Klebsiella pneumoniae with high toxicity is not indicated; or adding SYBR green I into the reaction liquid for fluorescence detection, if the reaction liquid is green, indicating that the high-toxicity Klebsiella pneumoniae exists, otherwise, indicating that the high-toxicity Klebsiella pneumoniae does not exist.

When the reaction solution is taken out and the PCR amplification result is detected by agarose gel electrophoresis, the method comprises the following steps:

s403, mixing the stress solution with a 10 ×L-loading buffer, adding the mixture into a sample loading hole of agarose gel, carrying out electrophoresis at 120V for 20min, taking out a gel block, and obtaining a PCR amplification result through an electrophoresis strip in an ultraviolet imaging system, wherein if a gradient strip is positioned and the minimum strip is 180bp, the existence of high-toxicity Klebsiella pneumoniae is indicated, and otherwise, the existence of no high-toxicity Klebsiella pneumoniae is indicated.

Further, in one embodiment of the invention, the content of the liquid for releasing is 0.5u L.

The 10 ×L loading buffer is 4.5u L.

The removed aliquot was mixed with a 10 ×L loading buffer and added to the loading well of a 2% agarose gel.

Specifically, in steps S203 and S303, after the L AMP reaction is finished, (1) 0.5 mu L of reaction liquid is sucked by a gun head, mixed with 4.5 mu L10 ×L of loading buffer and added into a loading hole of 2% agarose gel, electrophoresis is carried out for 20min at 120V, a gel block is taken out, an electrophoresis strip is observed in an ultraviolet imaging system, photographing is carried out for recording, and the specific standard for determining whether the target bacteria exist in the sample is that the PCR amplification result is detected by the agarose gel electrophoresis, and if a gradient strip exists, and the minimum strip is 180bp, the existence of the high-toxicity Klebsiella pneumoniae is indicated.

(2) Adding 1 mu L SYBR green I dye into the reaction liquid, and determining whether the target bacteria exist in the sample according to the specific standard that if the reaction liquid is green, the existence of the high-toxicity Klebsiella pneumoniae is indicated.

Referring to fig. 5, a comparison graph of L AMP amplification results is shown, where P is a positive control, N is a negative control, (a) P appears green after SYBR green I is added under natural illumination conditions, N appears yellowish, (B) P appears bright green after SYBR green I is added under ultraviolet illumination conditions, N appears yellowish, (C) (as in fig. 5) appears a stepped band after 2% agarose gel electrophoresis, and N has no band at all, it can be known from the comparison of fig. 5 and fig. 5 that the detection method for rapidly detecting klebsiella pneumoniae with high virulence can realize rapid detection and judgment of klebsiella pneumoniae with high virulence of pneumonia.

On the other hand, the invention also provides a detection kit for rapidly detecting the high-toxicity Klebsiella pneumoniae, which comprises L AMP amplification reaction liquid, wherein the L AMP amplification reaction liquid comprises primers which are respectively:

upstream outer primer F3(5 '→ 3'): TGGGGTTATTCTTTCGCT are provided.

Downstream outer primer B3(5 '→ 3'): TTTCCAAGCTTACTGCAATT are provided.

Upstream inner primer FIP (5 '→ 3'):

CCagCAAAacAGCCTAAATACATTG-TGGGGAGTATCTTTGAGAGG。

downstream inner primer BIP (5 '→ 3'):

TTGGGATACTGTGCTATTTTTCTCT-GGGAAGATGAGAAATACGAGC。

the upstream loop primer L F (5 '→ 3'): CGCCTCCGTGATGAGGATG.

The downstream loop primer L B (5 '→ 3'): GCAGAAAAGGGCTAGCGC.

In addition, the embodiment of the invention designs specific primers aiming at the peg-344 gene of the specific gene of the Klebsiella pneumoniae with high toxicity, can obtain results within 60min at 65 ℃ by condition optimization without electrophoretic detection, can directly observe by fluorescence, is simple and convenient to operate, has simple result judgment and reduces the detection cost, and the minimum detection limit of the Klebsiella pneumoniae L AMP reaction system on a genome is 0.475 pg/mu L, has 100 times higher sensitivity than that of the traditional PCR method, improves the detection sensitivity and has better specificity characteristics.

In addition, the kit provided by the embodiment of the invention can be used for quickly detecting the high-toxicity Klebsiella pneumoniae, so that the technology is worthy of further popularization in the primary medical unit, can also be used as a quick primary screening test for monitoring the catering industry environment and food safety in the primary epidemic prevention department, and has important significance in epidemiology.

Further, in one embodiment of the present invention, the mixed solution of the reaction solution is configured to:

12.5 μ L2 × HNB L AMP.

2.5 μ L10 ×L AMP primer mix.

0.8M betaine.

1.0 μ L Bst DNA polymerase.

1 μ L template DNA.

25 μ L sterile water.

Further, in an embodiment of the present invention, the concentration of the 2.5 μ L10 ×L AMP primer mixture is configured as follows:

The sensitivity test result of the L AMP method provided by the embodiment of the invention is as follows:

referring to FIG. 6, a graph of the sensitivity test results of the L AMP method provided by the embodiments of the present invention is obtained by measuring the initial concentration of Klebsiella pneumoniae genome, which is 475 ng/. mu. L, by using the Take3 program of a microplate spectrophotometer, subjecting the template DNA to concentration gradient dilution, and then performing isothermal amplification by using the original concentrations, 10-1, 10-2, 10-3, 10-4, 10-5, 10-6, 10-7 and 10-8 dilutions as templates, respectively, and observing the reaction results by electrophoresis, comparing the sensitivity of the L AMP method with that of the conventional PCR method, wherein the lowest detection limit of the PCR method is 47.5pg 475/. mu. L AMP method is 0.475 pg/. mu. L (FIG. 6), and the L AMP method established in the present test has higher sensitivity in detecting Klebsiella pneumoniae.

Wherein the meaning of each letter or number in fig. 6 is:

m is D L2000 DNA marker.

N is: and (5) negative control.

1 to 9 are reaction solutions with DNA concentrations of 475, 47.5, 4.75 × 10-1, 4.75 × 10-2, 4.75 × 10-3, 4.75 × 10-4, 4.75 × 10-5 and 4.75 × 10-6 ng/. mu. L, respectively.

The specific test result of the L AMP method provided by the embodiment of the invention is as follows:

referring to fig. 7 and table 1, different kinds of standard strains were inoculated on MH plates, and DNA template solutions were prepared by picking up after overnight in an incubator, respectively, and the results of the detection showed that no other bacteria except high virulence klebsiella pneumoniae could be amplified, as shown in fig. 7 and table 1. Tests prove that the detection method has good specificity and good detection effect when being used for detection.

As shown in FIG. 7, after each strain of Klebsiella pneumoniae was amplified, the product was subjected to gel electrophoresis, and a band of the specifically amplified product was observed. Wherein 1 is a positive control; strains 2 to 16 correspond to Table 1, respectively.

In addition, each common non-virulent Klebsiella pneumoniae amplification product can be observed by naked eyes to be transparent dark orange. Wherein 1 is a positive control; 2-16 strains are shown in Table 1

TABLE 1 specificity test of the 1L AMP method

The detection result of the L AMP method provided by the embodiment of the invention on clinical specimens is as follows:

referring to FIG. 8 and Table 2, using 15 strains of highly virulent Klebsiella pneumoniae genomic DNA such as AY9630, AY9293, AY8972, AY4992, AY4970, AY2075, AY11489, AP2841, JDZK01, GZK01, GZK02, GZK03, GZK20, XY1298, AP15127 and the like as templates, respectively, L AMP amplification, agarose gel electrophoresis (FIG. 8) and direct visual observation are performed on test strains, and results are observed and detected.

As shown in FIG. 8, after each high-virulence Klebsiella pneumoniae is amplified, the product thereof is subjected to gel electrophoresis, and a product band of specific amplification can be seen. l, AY 9630; 2, AY 9293; 3, AY 8972; 4, AY 4992; 5, AY 4970; 6, AY 2075; 7, AY 11489; 8, AP 2841; 9, JDZK 01; 10, GZK 01; 11, GZK 02; 12, GZK 03; 13, GZK 20; 14, XY 1298; 15, AP 15127.

In addition, human eye observation shows that the high-toxicity Klebsiella pneumoniae amplified products of all the strains present characteristic bright green compared with negative control.

TABLE 2 results of clinical strain testing of 2L AMP method

The above-mentioned embodiments are only used for illustrating the technical solutions of the present invention, and not for limiting the same; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; such modifications and substitutions do not substantially depart from the spirit and scope of the embodiments of the present invention, and are intended to be included within the scope of the present invention.

Claims

1. A detection method for rapidly detecting Klebsiella pneumoniae with high toxicity is characterized by comprising the following steps:

extracting strain DNA;

the reaction solution comprises a primer, and the primer comprises:

the upstream outer primer F3: 5'-TGGGGTTATTCTTTCGCT-3', respectively;

downstream outer primer B3: 5'-TTTCCAAGCTTACTGCAATT-3', respectively;

an upstream inner primer FIP: 5'

-CCagCAAAacAGCCTAAATACATTG-TGGGGAGTATCTTTGAGAGG-3’；

The downstream inner primer BIP: 5'

-TTGGGATACTGTGCTATTTTTCTCT-GGGAAGATGAGAAATACGAGC-3’；

An upstream loop primer L F: 5'-CGCCTCCGTGATGAGGATG-3';

downstream loop primer L B: 5'-GCAGAAAAGGGCTAGCGC-3';

2. The method for rapidly detecting Klebsiella pneumoniae with high virulence according to claim 1, wherein the method for extracting the DNA of the strain comprises:

cooling in refrigerator for 10 min;

centrifuging at 12000g for 10min at 4 deg.C, and collecting supernatant.

3. The method for rapidly detecting Klebsiella pneumoniae with high virulence according to claim 1, wherein the mixture of the reaction solution is configured as follows:

12.5 μ L2 × HNB L AMP;

2.5 μ L10 ×L AMP primer mix;

0.8M betaine;

1.0 μ L Bst DNA polymerase;

1 μ L template DNA;

25 μ L sterile water.

4. The method for rapidly detecting Klebsiella pneumoniae with high virulence according to claim 3, wherein the concentration of the primer mixture of 2.5 μ L10 and 10 ×L AMP is configured as follows:

5. The method for rapidly detecting Klebsiella pneumoniae with high virulence according to claim 4, wherein the reaction conditions of the L AMP amplification reaction are as follows:

the reaction time is as follows: and gradient every 5min for 40-70 min.

6. The method for rapidly detecting Klebsiella pneumoniae with high virulence according to claim 5, wherein the reaction conditions of the L AMP amplification reaction are as follows:

the reaction temperature is as follows: 65 ℃;

the reaction time is as follows: 60 min;

the termination reaction temperature was: 85 ℃;

the reaction termination time was: and 5 min.

7. The method for rapidly detecting Klebsiella pneumoniae with high virulence according to any one of claims 1-6, wherein the step of detecting the reaction result to determine whether Klebsiella pneumoniae with high virulence exists comprises:

taking reaction liquid, detecting an amplification result by using agarose gel electrophoresis, if a gradient band is positioned and the minimum band is 180bp, indicating that the Klebsiella pneumoniae with high toxicity exists, and if not, indicating that the Klebsiella pneumoniae with high toxicity does not exist;

8. A detection kit for rapidly detecting high-toxicity Klebsiella pneumoniae is characterized by comprising:

the upstream outer primer F3: 5'-TGGGGTTATTCTTTCGCT-3', respectively;

downstream outer primer B3: 5'-TTTCCAAGCTTACTGCAATT-3', respectively;

an upstream inner primer FIP: 5'

-CCagCAAAacAGCCTAAATACATTG-TGGGGAGTATCTTTGAGAGG-3’；

The downstream inner primer BIP: 5'

-TTGGGATACTGTGCTATTTTTCTCT-GGGAAGATGAGAAATACGAGC-3’；

An upstream loop primer L F: 5'-CGCCTCCGTGATGAGGATG-3';

the downstream loop primer L B: 5'-GCAGAAAAGGGCTAGCGC-3'.

9. The detection kit for rapidly detecting klebsiella pneumoniae with high virulence according to claim 8, wherein the mixture of the reaction solution is configured as follows:

12.5 μ L2 × HNB L AMP;

2.5 μ L10 ×L AMP primer mix;

0.8M betaine;

1.0 μ L Bst DNA polymerase;

1 μ L template DNA;

25 μ L sterile water.

10. The detection kit for rapidly detecting klebsiella pneumoniae with high virulence according to claim 9, wherein the concentration of the 2.5 μ L10 ×L AMP primer mixture is configured as follows: