CN112301105A - RDA method and kit for rapidly detecting neisseria gonorrhoeae - Google Patents

RDA method and kit for rapidly detecting neisseria gonorrhoeae Download PDF

Info

Publication number
CN112301105A
CN112301105A CN202010081197.1A CN202010081197A CN112301105A CN 112301105 A CN112301105 A CN 112301105A CN 202010081197 A CN202010081197 A CN 202010081197A CN 112301105 A CN112301105 A CN 112301105A
Authority
CN
China
Prior art keywords
neisseria gonorrhoeae
rda
seq
probe
kit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202010081197.1A
Other languages
Chinese (zh)
Other versions
CN112301105B (en
Inventor
陈翀
刘华勇
谢婵芳
叶月娥
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Pushi Lihua Technology Co ltd
Original Assignee
Guangzhou Pushi Lihua Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Pushi Lihua Technology Co ltd filed Critical Guangzhou Pushi Lihua Technology Co ltd
Priority to CN202010081197.1A priority Critical patent/CN112301105B/en
Publication of CN112301105A publication Critical patent/CN112301105A/en
Application granted granted Critical
Publication of CN112301105B publication Critical patent/CN112301105B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an RDA method and a kit for rapidly detecting Neisseria gonorrhoeae, which comprise a specific primer pair and an RDA fluorescence labeling probe, so as to realize the safe, specific, sensitive and simple detection of Neisseria Gonorrhoeae (NG), thereby making up the defects of the existing traditional detection technology. The kit provided by the method can save the step of nucleic acid extraction, can realize the detection of Neisseria gonorrhoeae within 20min at the constant temperature of 37-42 ℃, has the specificity of 100 percent, and is very suitable for on-site rapid detection. Compared with the common PCR method, the RDA fluorescence method is a reaction at constant temperature, does not need temperature change, does not need complex instruments, and has short reaction time. Therefore, the method and the kit thereof have the characteristics of simple and rapid operation, good specificity, high sensitivity, low cost and the like, provide an effective technical means for the field rapid detection and screening of the neisseria gonorrhoeae, and have wide application prospects.

Description

RDA method and kit for rapidly detecting neisseria gonorrhoeae
Technical Field
The invention belongs to the technical field of molecular biology. More particularly, relates to a primer pair, a probe and a related kit for detecting nucleic acid of neisseria gonorrhoeae based on an RDA fluorescence detection technology.
Background
Neisseria Gonorrhoeae (NG), commonly known as gonococcus, is a gram-negative diplococcus, the major causative agent of common Sexually Transmitted Diseases (STDs) in humans, primarily colonizing leukocytes of the purulent secretions of acute urethritis and vaginitis. The human is the only natural host of Neisseria gonorrhoeae, and the bacterium can cause purulent inflammation of genitourinary tract after infecting the human, if the bacterium is not treated in time, symptoms such as hyposexuality, erectile dysfunction, impotence, premature ejaculation, neurasthenia and the like can be easily caused, and infertility and the like can be induced.
Gonorrhea is widely prevalent in the world, and according to the recent estimate of the WHO in 2017, there are about 7830 million new cases of gonorrhea worldwide each year. In China, the gonorrhea is located in the fifth place of the number of reported infectious diseases of the second law, and becomes the second infectious disease for key prevention and treatment specified in the infectious disease prevention and treatment law of the people's republic of China. It has been found that the prevalence of gonorrhea in women (0.08%) is higher than in men (0.02%), and about 60% of women with gonorrhea present a recessive infection or a state of bacteria. The existence of a large number of asymptomatic women infected persons increases the risk of spreading gonorrhea, delays the opportunity for timely treatment, and is more likely to cause complications and cause adverse consequences such as infertility, ectopic pregnancy and the like. Therefore, early screening of female gonorrhea patients in pre-pregnancy physical examination is of great significance for preventing gonorrhea in newborns and executing a prepotency policy.
The etiological detection method of neisseria gonorrhoeae infection mainly comprises a smear inspection method and a NG cell culture method, but the method has high misdiagnosis and missed diagnosis rate and relatively low positive detection rate. The molecular biological detection method of neisseria gonorrhoeae is mostly based on PCR, a fluorescence labeled probe is used for real-time detection, a PCR instrument or an expensive real-time quantitative PCR instrument and other various supporting equipment are required for detection, and a special PCR laboratory and professional operators are required, so that the cost and the application range are limited to a certain extent. With the silent rise of in vitro isothermal amplification of nucleic acids, the limitations of the traditional amplification technology are changed, and in the past decade, isothermal nucleic acid amplification technologies, such as LAMP (loop-mediated nucleic acid amplification technology), HDA (helicase dependent isothermal nucleic acid amplification technology), etc., which make the in vitro amplification of nucleic acids simpler and more convenient, have been rapidly developed to amplify target nucleic acids under isothermal conditions. These techniques can achieve efficient nucleic acid amplification by only requiring a temperature control device to maintain a constant reaction temperature, thereby getting rid of the dependence on a PCR instrument that precisely controls temperature variations. If the amplification of nucleic acid can be realized under lower temperature condition, even under normal temperature condition, the nucleic acid amplification technology will be further simplified, and the application of the technology in wider range is facilitated.
Disclosure of Invention
The invention aims to solve the technical problem of overcoming the defects and shortcomings of the existing Neisseria gonorrhoeae detection technology, researches to obtain a Neisseria Gonorrhoeae (NG) RDA fluorescence detection kit, realizes the rapid detection of Neisseria gonorrhoeae, and only needs 20-30min from sample processing to result completion in the whole process of NG detection, thereby greatly shortening the conventional detection time and improving the detection efficiency.
The invention aims to provide a target sequence, a primer pair and a probe for detecting Neisseria gonorrhoeae after optimization.
The nucleotide sequence of the probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2.
In this patent we have used two protocols to design RDA fluorescently labeled probes, the first protocol being: selecting 25-35bp conserved sequence as probe sequence in the target region, marking luminous group at 5 'end, marking quenching group at 3' end, and replacing tetrahydrofuran residue (THF) at any position of 5-10 th base. The second scheme is as follows: the probe is 46-52 nucleotides in length, at least 30 of which are located at the 5 'end of the THF site, and at least 15 of which are located at the 3' end. Through serial experimental comparison, the two probe design schemes are both suitable for the RDA fluorescence detection method, and have no obvious difference in detection sensitivity and specificity.
Preferably, the nucleotide sequence is a probe of SEQ ID NO. 1, the 5 'end of the probe is marked with a luminous group, the 3' end of the probe is marked with a quenching group, any position of the 5 th to 10 th bases is replaced by a tetrahydrofuran residue (THF), and the specific information is as follows:
NG-P1（SEQ ID NO .1）：
5’- FAM-ACCCG[THF]CCGTTGCGTTTCGGAATGCCGAAG -BHQ1-3′
preferably, the nucleotide sequence is a probe of SEQ ID NO. 2, the 30 th base T at the 5 'end of the probe is marked with FAM or other luminescent groups, the 32 th base is replaced by Tetrahydrofuran (THF), the 34 th base is marked with BHQ1 or other quenching groups, and the 3' end is subjected to C3-spacer blocking modification, and the specific information is as follows:
NG-P2（SEQ ID NO .2）： 5’-GTCCKCGGCAACGGTATAGACCCGCCCGT[FAM-dT]G[THF]G[BHQ1-dT]TTCGGAATGCCGAAG[C3-spacer] -3’
the nucleotide sequences of the primer pair are shown as SEQ ID NO. 3 and SEQ ID NO. 4, the target sequence is shown as SEQ ID NO. 5, and the specific information is as follows:
NG-F1（SEQ ID NO .3）： 5’- GGCTCGGCATYGTCCGCGGCAACGGTATAG-3’；
NG-R1（SEQ ID NO .4）： 5’-CCAACCATCGTTTGGCCTTGGCTGCCGATG-3’。
the invention also aims to provide a kit for detecting Neisseria gonorrhoeae based on the isothermal amplification technology.
The kit comprises a nucleic acid extraction reagent, a constant temperature amplification reaction module, a positive control, a negative control, the probe and the primer pair.
Preferably, the isothermal amplification reaction module is a lyophilized powder reagent of an isothermal amplification reaction mixed reagent.
Preferably, the isothermal amplification reaction mixed reagent is an RPA or Recombinase-dependent amplification (RDA) isothermal amplification reaction mixed reagent.
Another object of the present invention is to provide a kit for detecting neisseria gonorrhoeae based on Recombinase-dependent amplification (RDA).
The Recombinase-dependent amplification (RDA) is realized by the following technical scheme:
the invention utilizes a bioinformatics method to analyze and simulate batch protein structures and virtually screen the protein structures at high flux, and finally finds out a new recombinase combination with high stability through a large number of biological experiments. Specifically, the invention develops a novel recombinase combination comprising a recombinase KX and an auxiliary protein KY, wherein the nucleotide sequence of the recombinase KX is shown as SEQ ID No.6, the amino acid sequence of the recombinase KX is shown as SEQ ID No.7, the nucleotide sequence of the auxiliary protein KY is shown as SEQ ID No.8, and the amino acid sequence of the auxiliary protein KY is shown as SEQ ID No. 9.
The recombinase KX can replace the recombinase UvsX or RecA in the RPA reaction, and the KY protein can replace the UvsY protein in the RPA reaction.
The recombinase KX has 50% of sequence homology with the T4UvsX protein (201/395). Based on the recombinase combination, the team develops a new detection method and a detection system of a recombinase-dependent amplification technology (RDA) with high stability and strong specificity. The preparation process of the recombinase KX is simple, the yield and the stability are greatly improved, and the mass production cost is low. And based on the amplification technology developed by the recombinase combination, the required primer is short (18-30 bp), the requirement on the length of the target sequence is low, and the applicability is wide. Furthermore, the technology has good detection specificity and high sensitivity on the nucleic acid target sequence, can realize high-sensitivity and high-precision rapid molecular detection under the constant temperature condition of 25-42 ℃, has low detection cost and convenient and rapid operation, and has wide application prospect.
The recombinase KX and the protein KY are derived from Escherichia phase phT4A phage, and Escherichia phase phT4A belongs to the genus Slopekvarus in Myoviridae subfamily.
The recombinase KX and the protein KY can realize a large amount of soluble expression in escherichia coli.
Specifically, as an alternative, the preparation method is as follows:
s1, introducing the target gene expression fragment into an expression vector to obtain a recombinant expression vector;
s2, transferring the recombinant expression vector into an expression bacterium to obtain a recombinant engineering bacterium;
s3, performing induction culture on the recombinant engineering bacteria, and obtaining unpurified recombinase through engineering bacteria enrichment, ultrasonic crushing and centrifugation;
s4, purifying the unpurified recombinase by chromatography to obtain the recombinase KX. The purified recombinant enzyme KX does not have the phenomenon of coagulation or precipitation at low temperature.
Wherein, the target gene expression fragment in the step S1 contains a nucleic acid sequence shown as SEQ ID NO.6, the 5 'end of the target gene expression fragment has a BamHI enzyme cutting site cohesive end, and the 3' end of the target gene expression fragment has a Sall enzyme cutting site cohesive end.
Preferably, the expression vector in step S1 is a pET-28a vector.
Preferably, the expression bacteria in step S2 are escherichia coli.
The preparation process is simple, the yield and the stability are greatly improved, and the mass production cost is low.
Preferably, the reaction system of the recombinase-dependent amplification technique (RDA) comprises the following reagents: recombinase KX, KY protein, gp32 protein, strand displacement DNA polymerase, exonuclease, creatine kinase, creatine phosphate, Tris-buffer, potassium acetate or sodium acetate, PEG20000 or PEG35000, DTT, dNTPs, dATP, the probe, the primer pair and magnesium acetate. Preferably, the reaction system further comprises a detection template, such as DNA or RNA of a sample to be detected.
Preferably, the reaction condition of the reaction system is that the reaction is carried out for 10-60min at 25-42 ℃.
More preferably, the reaction conditions of the reaction system are 39 ℃ for 30 min.
The reaction principle of the recombinase-dependent amplification technology (RDA) reaction system is as follows: (1) in the reaction system, a recombinase-primer complex is formed by combining a recombinase with a specific primer of 18-30bp, and a target site is searched in a double-stranded DNA template; (2) after the recombinase-primer complex recognizes a template specific sequence, positioning occurs and strand exchange is initiated, and the single-strand binding protein is combined with a D-Loop structure formed by the displaced DNA strands; (3) the dATP conformation in the recombinase-primer complex hydrolysis system is changed, the 3 'end of the primer is exposed and recognized by DNA polymerase after the recombinase is dissociated, and the DNA polymerase starts DNA synthesis at the 3' end of the primer according to a template sequence; (4) the DNA polymerase has a strand displacement function, continues to unwind the double-helix DNA structure of the template while the primer is extended, and the DNA synthesis process continues; (5) completing the amplification of the two primers to form a complete amplicon; (6) in the reaction system, dATP is hydrolyzed to supply energy to recombinase and then becomes dADP, phosphocreatine can transfer the phosphate group of the phosphocreatine into a dADP molecule under the catalysis of creatine kinase to form dATP, and therefore the level of dATP in the reaction system is restored. The above process is repeated continuously, and finally the high-efficiency amplification of nucleic acid is realized.
A kit for detecting Neisseria Gonorrhoeae (NG) based on a recombinase dependent amplification technology (RDA) is constructed based on the reaction system, and comprises a nucleic acid extraction reagent, an RDA constant temperature amplification reaction module, a positive control, a negative control, the probe and the primer.
Preferably, the RDA constant temperature amplification reaction module is a freeze-dried powder reagent of a mixed reagent of the RDA constant temperature amplification reaction.
Preferably, the RDA constant temperature amplification reaction module comprises recombinase KX 60-600 ng/mu L, KY protein 16-192 ng/mu L, single-chain binding protein gp 32100-1000 ng/mu L, strand displacement DNA polymerase 3-100 ng/mu L, exonuclease 30-200U, creatine kinase 0.1-0.8 mg/ml, phosphocreatine 25-75 mM, Tris buffer 20-100mM, PEG 2.5-10%, potassium acetate or sodium acetate 0-150 mM, dATP 1-5 mM, dNTPs 150-600nM each, DTT 1-12 mM, probe 150nM-600nM, primer pair 150-600 nM.
Preferably, the Tris-buffer is Tris-tricine.
Preferably, the concentration of Tris-tricine is 100 mM.
The nucleic acid extraction reagent comprises Buffer A and Buffer B. Buffer A is sample lysate, containing Tris-HCL Buffer system, NaOH, SDS, EDTA, guanidinium isothiocyanate, Tween80, and Triton; buffer B contains a Tris Buffer system, potassium chloride and magnesium chloride; the positive control was a target gene plasmid containing Neisseria Gonorrhoeae (NG), and the negative control was an empty vector pUC57 plasmid.
Still another object of the present invention is to provide a method for detecting neisseria gonorrhoeae based on recombinase-dependent amplification technology.
The detection method comprises the following steps: extracting nucleic acid of a sample to be detected, performing real-time fluorescence RDA reaction in the presence of a primer pair, a probe and an RDA freeze-dried powder reagent, Buffer A and Buffer B of Neisseria gonorrhoeae by taking the nucleic acid of the sample to be detected as a template, and analyzing the sample to be detected according to a real-time fluorescence RDA amplification curve; wherein the nucleotide sequence of the probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2, wherein the reaction temperature is 25-42 ℃, and the reaction time is more than 15 minutes.
Preferably, the method further comprises the following steps:
1) sample processing
Shaking and mixing 20 μ L Buffer A and 5 μ L positive control/negative control/sample to be detected (swab sample), standing at room temperature for 10-15 min; neisseria gonorrhoeae DNA can be detected.
2) System formulation and assay
Adding 25 mu L of Buffer B, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA constant-temperature amplification reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is as follows: collecting fluorescence signals every minute at 39 ℃ for 1 minute for 30 cycles, and completing detection in 30 min;
3) determination of results
And (4) judging the result according to the Time (Time Threshold, Tt) when the fluorescence value generated by the reaction system reaches a Threshold value.
(ii) positive control: typical amplification curves appear, and the Tt value is less than 25min, which is a valid result;
negative control: no amplification curve appears, or the Tt value is more than or equal to 25min, which is an effective result;
thirdly, the detected sample:
a. if the Tt value is less than 25min, judging the test result to be positive;
b. if the Tt value is more than or equal to 30min, judging the result to be negative;
c. if Tt value is less than or equal to 25min and less than 30min, the result is judged to be suspicious and needs to be repeatedly detected for confirmation; the result of the secondary detection is that the Tt value is more than or equal to 25min and less than 30min, the negative control Tt value is referred to, and if the negative control Tt value is more than or equal to 30min, the positive result is judged.
The invention has the following beneficial effects:
1. the kit provided by the invention is used for detecting Neisseria gonorrhoeae DNA in human urogenital secretion and urine, has the characteristics of simple, quick and sensitive operation, provides an effective technical means for the on-site quick detection and screening of Neisseria gonorrhoeae, and has important significance in the clinical detection of Neisseria gonorrhoeae.
2. The kit provided by the invention adopts an RDA constant temperature amplification detection method, can realize effective amplification of the target gene under the condition of 37-42 ℃, and does not need temperature change and complex instruments. The reaction time is short, the reaction can be completed within 20-30min, the specificity is 100%, and the detection sensitivity is 1 copies/mu l.
3. In the RDA method, recombinase KX protein and KY protein have high specificity to a target sequence in the amplification process, and amplification is started only when a primer is completely complementary with a template sequence, so that the amplification specificity is greatly improved, and high-efficiency constant-temperature nucleic acid amplification without background is realized.
Drawings
FIG. 1 is a graph showing the results of ATP hydrolysis activity of 4 proteins in recombinase screening of example 1 of the present invention.
FIG. 2 is an agarose gel image of the isothermal amplification reaction of 4 proteins in recombinase screening of example 1 of the invention.
FIG. 3 is a three-dimensional structural diagram of KX protein in example 1 of the present invention.
FIG. 4 is a three-dimensional structure diagram of a KY protein heptamer in example 1 of the present invention.
FIG. 5 is a graph showing the results of the RDA fluorescence assay kit according to example 1 of the present invention.
FIG. 6 is a graph showing the results of the sensitivity test of the RDA fluorescence assay kit of example 2 of the present invention.
FIG. 7 is a diagram showing the results of the specificity test of the RDA fluorescence detection kit of example 3 of the present invention.
FIG. 8 is a graph showing the results of the 37-degree stability test of the RDA fluorescence assay kit in example 4 of the present invention.
FIG. 9 is a graph showing the results of the 37-degree stability test of the RDA fluorescence assay kit in example 4 of the present invention.
FIG. 10 is a graph showing the results of the 37-degree stability test of the RDA fluorescence assay kit in example 4 of the present invention.
FIG. 11 is a graph showing the results of the 37-degree stability test of the RDA fluorescence assay kit of example 4 of the present invention.
Detailed Description
The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. It will be appreciated by those skilled in the art that various other changes, modifications, substitutions, combinations, and omissions may be made in the form and detail of the invention without departing from the spirit and scope of the invention.
Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated. Unless otherwise indicated, reagents and materials used in the following examples are commercially available.
Unless otherwise indicated, the present invention employs immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, recombinant DNA and the like, which are within the ordinary skill of the art. See Sambrook (Sambrook), friech (Fritsch) and mani-tius (manitis), molecular cloning: a LABORATORY Manual (MOLEC M LAR CLONING: A LABORATORY MANUAL), 2 nd edition (1989); a Current Manual of molecular BIOLOGY experiments (Current Protocols IN MOLEC. mu.M.LAR BIOLOGY) (edited by F. M. Ausubel et al, (1987)); METHODS IN ENZYMOLOGY (METHODS IN Enzymology) series (academic Press): PCR2 practical methods (PCR 2: A PRACTICAL APPROACH) (M.J. MacPherson, B.D. Nimes (B.D. Hames) and G.R. Taylor (G.R. Taylor) editions (1995)), Harlow (Harlow) and Lane (Lane) editions (1988) antibodies: a LABORATORY Manual (ANTIBODIES, A LABORATORY MANUAL), and animal cell culture (ANIMAL CELL C μm LTURE) (edited by R.I. Freshenib (R.I. Freshney) (1987)).
Example 1 establishment of detection method of Neisseria Gonorrhoeae (NG) RDA fluorescence detection kit
(1) Acquisition of recombinase KX and KY proteins
The reported recombinase UvsX has poor stability and is difficult to be produced in quantity and stored for a long time, and in order to solve the problem, a new recombinase KX and an auxiliary protein KY thereof are finally found by analyzing and simulating large batch protein structures by using a bioinformatics method by the research and development team.
In this embodiment, a research and development team extracts key functional site information in a recombinase structure, such as a DNA binding site, an ATP hydrolysis site, and the like, maps the information to a three-dimensional spatial structure of a protein, obtains secondary structure information and tertiary structure information, and constructs a data model for recombinase protein structure screening by integrating functional residues of a primary structure sequence, secondary structure characteristics, and a tertiary structure spatial distance. A template matched with recombinase proteins in a primary structure is searched from SwissProt and PDB data, 312 protein sequences are preliminarily screened, then secondary structure and tertiary structure comparison is respectively carried out, similarity scores are calculated, and 15 proteins suspected to have recombinase activity are screened in a simulated mode according to the similarity score ranking.
The 15 proteins are respectively constructed into recombinant protein expression vectors, after expression and purification, the ATP hydrolysis capacity of the recombinant protein expression vectors is detected, wherein 4 proteins have ATP hydrolysis activity and are KX, X-1, X-2 and X-3 proteins respectively. The firefly luciferase ATP bioluminescence detection kit is used in the experiment, and the experiment is carried out according to the operation of the instruction, and the result is shown in figure 1.
4 proteins with ATP hydrolytic activity are prepared into a constant-temperature amplification system for amplification reaction, the result is shown in figure 2, N is negative control, P is positive control added with T4UvsX for amplification, 1-4 proteins added respectively are KX, X-1, X-2 and X-3, wherein only the KX protein has amplification activity. The KX protein is derived from Escherichia phase phT4A phage and its three-dimensional structure diagram is shown in FIG. 3.
In the same way, we screened the recombinase KX from the helper protein KY of Escherichia phase phT4A phage, and the three-dimensional structure diagram is shown in FIG. 4. Wherein the auxiliary protein KY needs to play an active role in the form of heptamer.
Finally obtaining recombinase KX for RDA amplification, wherein the nucleotide sequence of the recombinase KX is shown as SEQ ID NO.6, and the amino acid sequence of the recombinase KX is shown as SEQ ID NO. 7; recombinase KY, the nucleotide sequence of which is shown as SEQ ID NO.8, and the amino acid sequence of which is shown as SEQ ID NO. 9.
(2) Neisseria gonorrhoeae detection primer and probe design and screening
Neisseria gonorrhoeae whole gene sequences were searched by NCBI (www.ncbi.nlm.nih.gov), and homology alignment and sequence analysis were performed using Clone manager software and BLAST, from which sequences conserved within species and interspecies variation in the present pathogen were selected as target regions. After the whole genome sequence alignment and homology analysis of a plurality of Neisseria gonorrhoeae, a conserved region is finally selected as a target gene (reference sequence GenBank accession number: CP020415.2), and RDA detection primer and probe design is carried out on the target segment. And (3) entrusting Shanghai Czeri bioengineering Limited company to synthesize a target gene DNA plasmid, a primer and a probe sequence. The highly conserved sequence of the neisseria gonorrhoeae is selected as follows:
SEQ ID NO .5：
ACGGATAAAACCGCCCGCGTCCAACTTGCCGCGGCTGCCCGGGCTATCGGCATAAACAATACCGTCCGGCATGATTTTCTTTTTGACGGCAGGGAGCAACGTTTCAGGCTCGGCATCGTCCGCGGCAACGGTATAGACCCGCCCGTTGCGTTTCGGAATGCCGAAGACAACCGCTTTTCCTGCCGCGCCGCGACCGCGTCTGCCTTTACGCCGTACGCCGAAACAGCTTCCGCCCGGCCCGGCGGGGCGCTCGAAAACCTCATCGGCAGCCAAGGCCAAACGATGGTTGGTAACCGTGCGGATTTTACGGTAAAACAGTGCCGC
in the embodiment, the primer design principle of the RDA technology is adopted for design, the lengths of the upstream primer and the downstream primer are 18-30bp, 3 upstream primers and 3 downstream primers are designed according to the conserved sequence of Neisseria gonorrhoeae, and the primer sequences are as follows:
the upstream primer NG-F1: 5 '-GGCTCGGCATYGTCCGCGGCAACGGTATAG-3'
The upstream primer NG-F2: 5 '-AGGGRGYAACGTTTCAGGCTCGGCAT-3'
The upstream primer NG-F3: 5 '-GGGCTATCGGYATAAACAATACCGTCC-3'
The downstream primer NG-R1: 5'-CCAACCATCGTTTGGCCTTGGCTGCCGATG-3'
The downstream primer NG-R2: 5 '-TTCGGCGKRCGGCGTAAAGGCRGACGCGG-3'
The downstream primer NG-R3: 5 '-CCGCACGGTTRCCAACCATCGTTTGGCC-3'
And 3 pairs of primers are paired pairwise to form 9 combinations for optimal primer combination screening.
Combination 1: NG-F1 and NG-R1; and (3) combination 2: NG-F1 and NG-R2 combination 3: NG-F1 and NG-R3
And (4) combination: NG-F2 and NG-R1; and (3) combination 5: NG-F2 and NG-R2 combination 6: NG-F2 and NG-R3
And (3) combination 7: NG-F3 and NG-R1; and (4) combination 8: NG-F3 and NG-R2 combination 9: NG-F3 and NG-R3
Through a series of experimental screening and evaluation, combination 1 (NG-F1 and NG-R1) is determined as an optimal primer set, and specifically comprises the following steps:
NG-F1（SEQ ID NO .3）： 5’- GGCTCGGCATYGTCCGCGGCAACGGTATAG-3’；
NG-R1（SEQ ID NO .4）： 5’-CCAACCATCGTTTGGCCTTGGCTGCCGATG-3’。
in the RDA fluorescence detection technology, two schemes are adopted to design RDA fluorescence labeling probes, wherein the first scheme is as follows: selecting a conserved sequence of 25-35bp as a probe sequence in a target region, wherein the conserved sequence is a probe sequence, a luminescent group is marked at the 5 'end, a quenching group is marked at the 3' end, and any position in the 5 th-10 th bases is replaced by a tetrahydrofuran residue (THF), the nucleotide sequence is the probe of SEQ ID NO. 1, the luminescent group is marked at the 5 'end, the quenching group is marked at the 3' end, and any position in the 5 th bases is replaced by the tetrahydrofuran residue (THF), and the specific information is as follows:
NG-P1（SEQ ID NO .1）：
5’- FAM-ACCCG[THF]CCGTTGCGTTTCGGAATGCCGAAG -BHQ1-3′
the second scheme is as follows: the probe is 46-52 nucleotides in length, at least 30 of which are located at the 5 'end of the THF site, and at least 15 of which are located at the 3' end. In the probe with the nucleotide sequence of SEQ ID NO. 2, the 30 th base T at the 5 'end is labeled with FAM or other luminescent groups, the 32 th base is replaced by Tetrahydrofuran (THF), the 34 th base is labeled with BHQ1 or other quenching groups, and the 3' end is subjected to C3-spacer blocking modification, and the specific information is as follows:
NG-P2（SEQ ID NO .2）： 5’-GTCCKCGGCAACGGTATAGACCCGCCCGT[FAM-dT]G[THF]G[BHQ1-dT]TTCGGAATGCCGAAG[C3-spacer] -3’
through series of experimental comparisons, the two probe design schemes are both suitable for the RDA fluorescence detection method, and have NO obvious difference in detection sensitivity and specificity, wherein the target conserved sequence required by the first probe design is shorter, and the requirement on the nucleic acid sequence is low, and in the subsequent embodiment of the patent, the first probe NG-P1 (SEQ ID NO. 1) is used as a detection probe to prepare an RDA constant temperature amplification reaction system.
(3) Establishment of Neisseria Gonorrhoeae (NG) RDA detection method
The kit for detecting Neisseria Gonorrhoeae (NG) based on recombinase dependent amplification technology (RDA) is constructed, and comprises a nucleic acid extraction reagent, an RDA constant-temperature amplification reaction module, a positive control and a negative control, wherein the nucleic acid extraction reagent comprises Buffer A and Buffer B, the Buffer A is a sample lysate and contains a Tris-HCL Buffer system, NaOH, SDS, EDTA, guanidinium isothiocyanate, Tween80 and triton, and the Buffer B contains a Tris Buffer system, potassium chloride and magnesium chloride; the optimal proportion of the reaction system in the RDA isothermal amplification reaction module is shown in Table 1, and the reaction system comprises the fluorescence labeling probe and the primer described in the embodiment; the positive control was a target gene plasmid containing Neisseria Gonorrhoeae (NG), and the negative control was an empty vector pUC57 plasmid.
TABLE 1 RDA constant temperature amplification reaction module reaction system ratio
Serial number Components Concentration of content
1 Tris-tricine（PH 7.9） 100mM
2 Potassium acetate 50mM
3 PEG20000 or PEG35000 5%
4 DTT 2mM
5 dNTPs 200nM each
6 dATP 2mM
7 Creatine kinase (Creatine kinase) 0.2mg/ml
8 Creatine phosphate (Creatine phosphate) 50mM
9 Strand-displacing DNA polymerase 50ng/ul
10 gp32 protein 300 ng/ul
11 Recombinase KX 120 ng/ul
12 Accessory protein KY 60ng/ul
13 Exonuclease 50U
14 Upstream primer 500nM
15 Downstream primer 500nM
16 Fluorescent-labeled probe 300nM
17 Magnesium acetate 14mM
The reaction conditions of the reaction system are as follows: reacting for 10-60min at 25-42 ℃.
The optimal reaction conditions are as follows: the reaction was carried out at 37 ℃ for 30 min.
In the embodiment, 4 collected samples of the genitourinary tract secretion which is positive to neisseria gonorrhoeae DNA are verified by fluorescent quantitative PCR, and the samples are tested by using the RDA fluorescent detection kit disclosed by the invention.
The specific operation is as follows:
step one, sample processing. Shaking and mixing 20 μ L Buffer A and 5 μ L positive control/negative control/secretion sample to be detected, standing at room temperature for 10-15 min;
step two, system preparation and detection. Adding 25 mu L of Buffer B, shaking and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence method reaction module, covering a tube cover, shaking and centrifuging, and immediately detecting; the reaction procedure is as follows: collecting fluorescence signals every minute at 39 ℃ for 1 minute for 30 cycles, and completing detection within 30 min;
and step three, judging a result.
(ii) positive control: typical amplification curves appear, and the Tt value is less than 25min, which is a valid result;
negative control: no amplification curve appears, or the Tt value is more than or equal to 25min, which is an effective result;
thirdly, the detected sample:
a. if the Tt value is less than 25min, judging the test result to be positive;
b. if the Tt value is more than or equal to 30min, judging the result to be negative;
c. if Tt value is less than or equal to 25min and less than 30min, the result is judged to be suspicious and needs to be repeatedly detected for confirmation; the result of the secondary detection is that the Tt value is more than or equal to 25min and less than 30min, the negative control Tt value is referred to, and if the negative control Tt value is more than or equal to 30min, the positive result is judged.
The detection results are shown in table 2 and fig. 5, and the positive control and the negative control are in accordance with the "first positive control: typical amplification curves appear, and the Tt value is less than 25min, which is a valid result; negative control: no amplification curve appears, or the Tt value is more than or equal to 25min, which is the content of effective result, and the Tt value of each sample is less than 25min, and the sample is judged to be positive.
The result shows that the detection method of the RDA fluorescence detection kit established in the embodiment can detect the DNA of the Neisseria gonorrhoeae in the secretion of the human genitourinary tract.
TABLE 2 establishment of the detection method of the kit
Negative control Positive control NG-1 NG-2 NG-3 NG-4
Tt value - 04:07 04:54 07:47 05:19 09:43
EXAMPLE 2 detection of reagent sensitivity test by RDA fluorescence method
The positive control was a plasmid containing the target gene of Neisseria Gonorrhoeae (NG), and the negative control was an empty vector pUC57 plasmid. The specific operation is as follows:
step one, the positive control plasmid is diluted to 10^3c, and then diluted to 10^2c, 10^1c and 10^0c respectively by 10 times of gradient dilution.
And step two, sample processing. Respectively taking 5 mu L of the plasmids with each concentration in the step one in an EP tube, simultaneously taking 5 mu L of the negative control in another EP tube, respectively adding 20 mu L of Buffer A, uniformly mixing by shaking, and standing for 10-15min at room temperature;
and step three, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, vibrating and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence method reaction module, covering a tube cover, vibrating and centrifuging, and immediately detecting; the reaction procedure is as follows: 1 minute at 39 ℃, 30 cycles, where fluorescence signals were collected;
and step four, judging a result. And (3) judging standard:
(ii) positive control: typical amplification curves appear, and the Tt value is less than 25min, which is a valid result;
negative control: no amplification curve appears, or the Tt value is more than or equal to 25min, which is an effective result;
thirdly, the detected sample:
a. if the Tt value is less than 25min, judging the test result to be positive;
b. if the Tt value is more than or equal to 30min, judging the result to be negative;
c. if Tt value is less than or equal to 25min and less than 30min, the result is judged to be suspicious and needs to be repeatedly detected for confirmation; the result of the secondary detection is that the Tt value is more than or equal to 25min and less than 30min, the negative control Tt value is referred to, and if the negative control Tt value is more than or equal to 30min, the positive result is judged.
The results are shown in table 3 and fig. 6. The negative control Tt value is NA, and meets the content of 'no amplification curve appears or Tt value is more than or equal to 25 min' in the determination standard. Tt values of 10^3c, 10^2c, 10^1c and 10^0c are all less than 25min, and according to the result judgment standard, results of 10^3c, 10^2c, 10^1c and 10^0c are positive.
That is, the sensitivity of the RDA fluorescence detection kit reaches a single copy.
TABLE 3 sensitivity test results
Negative control 10^3 10^2 10^1 10^0
Tt value - 06:15 07:37 09:45 14:45
Example 3 detection of reagent specificity by RDA fluorescence assay
Clinically, 6 samples of 3 cases of Neisseria Gonorrhoeae (NG), 1 case of Chlamydia Trachomatis (CT), 1 case of Ureaplasma Urealyticum (UU), 1 case of Human Papilloma Virus 18 (Human Papilloma Virus, HPV 18) which are verified to be positive to the corresponding pathogen by fluorescent quantitative PCR are detected, and the specificity of the kit is tested.
The specific operation is as follows:
step one, sample processing. Respectively taking 5 mu L of the 6 positive samples in an EP tube, simultaneously taking 5 mu L of the positive control and the negative control of the kit in a new EP tube, respectively adding 20 mu L of Buffer A, shaking and uniformly mixing, and standing at room temperature for 10-15 min;
and step three, preparing and detecting the system. Adding 25 mu L of Buffer B into each tube, vibrating and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence method reaction module, covering a tube cover, vibrating and centrifuging, and immediately detecting; the reaction procedure is as follows: 1 minute at 39 ℃, 30 cycles, where fluorescence signals were collected;
and step four, judging a result. And (3) judging standard:
(ii) positive control: typical amplification curves appear, and the Tt value is less than 25min, which is a valid result;
negative control: no amplification curve appears, or the Tt value is more than or equal to 25min, which is an effective result;
thirdly, the detected sample:
a. if the Tt value is less than 25min, judging the test result to be positive;
b. if the Tt value is more than or equal to 30min, judging the result to be negative;
c. if Tt value is less than or equal to 25min and less than 30min, the result is judged to be suspicious and needs to be repeatedly detected for confirmation; the result of the secondary detection is that the Tt value is more than or equal to 25min and less than 30min, the negative control Tt value is referred to, and if the negative control Tt value is more than or equal to 30min, the positive result is judged.
The results are shown in table 4 and fig. 7. The positive control and the negative control accord with' a positive control: typical amplification curves appear, and the Tt value is less than 25min, which is a valid result; negative control: no amplification curve appeared, or the Tt value was not less than 25mn, which is the content of effective result ". Tt values of the NG samples are all smaller than 25min, and the positive results are judged; CT, UU and HPV have no amplification curve and are judged to be negative.
That is, the RDA fluorescence method detects positive only when the target pathogen is neisseria gonorrhoeae, and detects negative for other pathogens.
TABLE 4 results of specificity test
Sample name Tt value Sample name Tt value
Negative control - NG-3 05:55
Positive control 04:05 CT -
NG-1 06:03 UU -
NG-2 05:33 HPV -
Example 4 RDA fluorescence assay kit stability test
The liquid reagent needs to be stored at low temperature and can not be repeatedly frozen and thawed. The RDA fluorescence method reaction module is dried in vacuum to form the powdery reagent in the kit, and the freeze-dried powdery reagent can be stored at normal temperature, so that the cost of cold chain transportation and low-temperature storage is saved, and the operation is simpler. This example demonstrates the stability of the RDA fluorescence detection kit.
The specific operation is as follows:
the eight tubes containing the lyophilized reagents were sealed in aluminum foil bags containing a desiccant and stored in a 37 ℃ incubator. The reagent is taken for testing on 0 day, 30 days, 90 days and 180 days respectively.
Step one, sample processing. Respectively taking 5 mu L of positive control/negative control of the kit, respectively adding 20 mu L of Buffer A into an EP tube, shaking and uniformly mixing, and standing at room temperature for 10-15 min;
step two, system preparation and detection. Adding 25 mu L of Buffer B into each tube, vibrating and uniformly mixing, adding 50 mu L of mixed solution into an RDA fluorescence method reaction module, covering a tube cover, vibrating and centrifuging, and immediately detecting; the reaction procedure is as follows: 1 minute at 39 ℃, 30 cycles, where fluorescence signals were collected;
and step three, judging a result. And (3) judging standard:
(ii) positive control: typical amplification curves appear, and the Tt value is less than 25min, which is a valid result;
negative control: no amplification curve appears, or the Tt value is more than or equal to 25min, which is an effective result;
thirdly, the detected sample:
a. if the Tt value is less than 25min, judging the test result to be positive;
b. if the Tt value is more than or equal to 30min, judging the result to be negative;
c. if Tt value is less than or equal to 25min and less than 30min, the result is judged to be suspicious and needs to be repeatedly detected for confirmation; the result of the secondary detection is that the Tt value is more than or equal to 25min and less than 30min, the negative control Tt value is referred to, and if the negative control Tt value is more than or equal to 30min, the positive result is judged.
The results are shown in table 5 and fig. 8, 9, 10, and 11. The reagent freeze-dried powder of the RDA fluorescence method reaction module stored for 0 day, 30 days, 90 days and 180 days is tested respectively, each Tt value is less than 25min, and according to the result judgment standard, the detection results of the reagent in the reagent kit of the patent are positive in 0 day, 30 days, 90 days and 180 days after the reagent is freeze-dried. The reagent in the kit disclosed by the patent can be stably stored for at least 3 months at 37 ℃ after being lyophilized.
TABLE 537 ℃ storage stability
Day 0 30 days 90 days 180 days
Negative control - - - -
Positive control 05:44 06:01 06:28 06:38
The above examples illustrate that the RDA technology of the present invention can be used to rapidly detect Neisseria gonorrhoeae, is simple and convenient to operate, can realize effective amplification of target genes at 37-42 ℃, and does not require temperature change or complex instruments. The reaction time is short, the reaction can be completed within 20-30min, the specificity is 100%, and the detection sensitivity is 1 copies/mu l. In the RDA method, recombinase KX protein and KY protein have high specificity to a target sequence in the amplification process, and amplification is started only when a primer is completely complementary with a template sequence, so that the amplification specificity is greatly improved, and high-efficiency constant-temperature nucleic acid amplification without background is realized.
The above description is only exemplary of the present invention and should not be construed as limiting the invention in any way whatsoever
And any modifications, equivalents, improvements and the like which come within the spirit of the invention are intended to be included within the scope of the invention.
Sequence listing
<110> Guangzhou Pushili Huakojiu Co., Ltd
<120> RDA method and kit for rapidly detecting neisseria gonorrhoeae
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> FAM-labeled fluorescent Probe (SEQ ID NO. 1)
<400> 1
acccgcccgt tgcgtttcgg aatgccgaag 30
<210> 2
<211> 49
<212> DNA
<213> FAM-labeled fluorescent Probe (SEQ ID NO. 2)
<400> 2
gtcckcggca acggtataga cccgcccgtt gcgtttcgga atgccgaag 49
<210> 3
<211> 30
<212> DNA
<213> primer sequence (SEQ ID NO. 3)
<400> 3
ggctcggcat ygtccgcggc aacggtatag 30
<210> 4
<211> 30
<212> DNA
<213> primer sequence (SEQ ID NO. 4)
<400> 4
ccaaccatcg tttggccttg gctgccgatg 30
<210> 5
<211> 324
<212> DNA
<213> target sequence (SEQ ID NO. 5)
<400> 5
acggataaaa ccgcccgcgt ccaacttgcc gcggctgccc gggctatcgg cataaacaat 60
accgtccggc atgattttct ttttgacggc agggagcaac gtttcaggct cggcatcgtc 120
cgcggcaacg gtatagaccc gcccgttgcg tttcggaatg ccgaagacaa ccgcttttcc 180
tgccgcgccg cgaccgcgtc tgcctttacg ccgtacgccg aaacagcttc cgcccggccc 240
ggcggggcgc tcgaaaacct catcggcagc caaggccaaa cgatggttgg taaccgtgcg 300
gattttacgg taaaacagtg ccgc 324
<210> 6
<211> 1158
<212> DNA
<213> recombinase KX nucleotide sequence (SEQ ID NO. 6)
<400> 6
atgtcaaaca aagcactact aaaaaaactg atcaaaaact cgaatagcca aactgcatct 60
gtactttctg aaagcgacgt attcaacaat attaccatca cgcgaacccg tgtgccgatt 120
ctgaatctgg cgttgtccgg tgcgtttaac ggtggcctaa cttctggtct tacccttttc 180
gctggcccgt ccaaacactt caaatccaac ttaggtttgc ttactgtagc ggcgtatctc 240
aaaacgtatg aagatgctgt gtgcctgttc tacgattcag aaaaaggtgt tactaaatcc 300
tatctgaaat caatgggtgt tgatccggat cgtgttgtgt atactcgtat cacgacggtc 360
gagcagttgc gtaatgacgt tgtaagccag cttaacgcgc ttgaacgcgg tgataaggtg 420
attgtattcg ttgactcagt aggcaacacg gcaagtaaaa aagaacttgc tgacgcgctt 480
tctgataacg ataaacagga tatgacgcga gcaaaagcat taaaaggtat gttccgtatg 540
gttacgcctt atctggctga cctggatatc ccgatggttt gtatctgtca tacctatgac 600
acacaagaaa tgtacagcaa gaaagttatt tctggtggta ctggtttaat gtattccgct 660
gatactgcga tcatcctggg taaacaacag gtgaaagaag gtactgaggt ggtaggttat 720
gatttcatca tgaatatcga aaaatctcga ttcgtgaaag agaaatcaaa attcccgctg 780
catgttacct atgaaggcgg tattagtatg tattctggcc ttttggatct ggcaatggaa 840
atgaactttg tacagaccgt aaccaaaggc tggcgcaacc gcgctttcct gaataccgag 900
actggcgaac tcgaagttga agaaaagaaa tggcgtgagt cagaaacaaa tagcgttgaa 960
ttctggcgtc ctctgtttac tcatcaacca ttcttgaaag ctatcgaaga aaagtataag 1020
atcccagatc gtgaaatcag tgatggttcc gcgctggaag atttatacag cactgatagc 1080
atcccagatc ctgatctgga tgatgacgat atcccagaat catttgatga tatcgaagaa 1140
aacgacgaaa ttttataa 1158
<210> 7
<211> 385
<212> PRT
<213> recombinase KX amino acid sequence (SEQ ID NO. 7)
<400> 7
Met Ser Asn Lys Ala Leu Leu Lys Lys Leu Ile Lys Asn Ser Asn Ser
1 5 10 15
Gln Thr Ala Ser Val Leu Ser Glu Ser Asp Val Phe Asn Asn Ile Thr
20 25 30
Ile Thr Arg Thr Arg Val Pro Ile Leu Asn Leu Ala Leu Ser Gly Ala
35 40 45
Phe Asn Gly Gly Leu Thr Ser Gly Leu Thr Leu Phe Ala Gly Pro Ser
50 55 60
Lys His Phe Lys Ser Asn Leu Gly Leu Leu Thr Val Ala Ala Tyr Leu
65 70 75 80
Lys Thr Tyr Glu Asp Ala Val Cys Leu Phe Tyr Asp Ser Glu Lys Gly
85 90 95
Val Thr Lys Ser Tyr Leu Lys Ser Met Gly Val Asp Pro Asp Arg Val
100 105 110
Val Tyr Thr Arg Ile Thr Thr Val Glu Gln Leu Arg Asn Asp Val Val
115 120 125
Ser Gln Leu Asn Ala Leu Glu Arg Gly Asp Lys Val Ile Val Phe Val
130 135 140
Asp Ser Val Gly Asn Thr Ala Ser Lys Lys Glu Leu Ala Asp Ala Leu
145 150 155 160
Ser Asp Asn Asp Lys Gln Asp Met Thr Arg Ala Lys Ala Leu Lys Gly
165 170 175
Met Phe Arg Met Val Thr Pro Tyr Leu Ala Asp Leu Asp Ile Pro Met
180 185 190
Val Cys Ile Cys His Thr Tyr Asp Thr Gln Glu Met Tyr Ser Lys Lys
195 200 205
Val Ile Ser Gly Gly Thr Gly Leu Met Tyr Ser Ala Asp Thr Ala Ile
210 215 220
Ile Leu Gly Lys Gln Gln Val Lys Glu Gly Thr Glu Val Val Gly Tyr
225 230 235 240
Asp Phe Ile Met Asn Ile Glu Lys Ser Arg Phe Val Lys Glu Lys Ser
245 250 255
Lys Phe Pro Leu His Val Thr Tyr Glu Gly Gly Ile Ser Met Tyr Ser
260 265 270
Gly Leu Leu Asp Leu Ala Met Glu Met Asn Phe Val Gln Thr Val Thr
275 280 285
Lys Gly Trp Arg Asn Arg Ala Phe Leu Asn Thr Glu Thr Gly Glu Leu
290 295 300
Glu Val Glu Glu Lys Lys Trp Arg Glu Ser Glu Thr Asn Ser Val Glu
305 310 315 320
Phe Trp Arg Pro Leu Phe Thr His Gln Pro Phe Leu Lys Ala Ile Glu
325 330 335
Glu Lys Tyr Lys Ile Pro Asp Arg Glu Ile Ser Asp Gly Ser Ala Leu
340 345 350
Glu Asp Leu Tyr Ser Thr Asp Ser Ile Pro Asp Pro Asp Leu Asp Asp
355 360 365
Asp Asp Ile Pro Glu Ser Phe Asp Asp Ile Glu Glu Asn Asp Glu Ile
370 375 380
Leu
385
<210> 8
<211> 420
<212> DNA
<213> KY protein nucleotide sequence (SEQ ID NO. 8)
<400> 8
atgagtttga aattagaaga tctacaaaat gaacttgaaa aggatatgct gatagatccc 60
ctcaagttgc aatcagaatc agcggatatc ccgaagattt gggctaaatg gcttcgatac 120
cattcaaacg ctaagaaaaa attgatccaa cttcatgcga aaaaagaagc tgatgtgaag 180
gatcgtatgt tgtactacac cggaaggcat gacaaagaaa tgtgcgaagt ggtgtatact 240
gggactactg aaattaaaat cgcgatcgct ggggatccga aaattgtaga aaccaacaag 300
ctgatccagt attatgacat ggtggtagat ttcaccagca aagcactgga tatcgtcaaa 360
aacaaaggat actctatcaa aaacatgtta gagatccgta aattagaaag tggtgcataa 420
<210> 9
<211> 139
<212> PRT
<213> KY protein amino acid sequence (SEQ ID NO. 9)
<400> 9
Met Ser Leu Lys Leu Glu Asp Leu Gln Asn Glu Leu Glu Lys Asp Met
1 5 10 15
Leu Ile Asp Pro Leu Lys Leu Gln Ser Glu Ser Ala Asp Ile Pro Lys
20 25 30
Ile Trp Ala Lys Trp Leu Arg Tyr His Ser Asn Ala Lys Lys Lys Leu
35 40 45
Ile Gln Leu His Ala Lys Lys Glu Ala Asp Val Lys Asp Arg Met Leu
50 55 60
Tyr Tyr Thr Gly Arg His Asp Lys Glu Met Cys Glu Val Val Tyr Thr
65 70 75 80
Gly Thr Thr Glu Ile Lys Ile Ala Ile Ala Gly Asp Pro Lys Ile Val
85 90 95
Glu Thr Asn Lys Leu Ile Gln Tyr Tyr Asp Met Val Val Asp Phe Thr
100 105 110
Ser Lys Ala Leu Asp Ile Val Lys Asn Lys Gly Tyr Ser Ile Lys Asn
115 120 125
Met Leu Glu Ile Arg Lys Leu Glu Ser Gly Ala
130 135

Claims (10)

1. A probe for detecting Neisseria gonorrhoeae is characterized in that the nucleotide sequence of the probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2.
2. The probe for detecting Neisseria gonorrhoeae of claim 1, wherein said nucleotide sequence is the probe of SEQ ID NO. 1, wherein the 5 'end is labeled with a luminescent group, the 3' end is labeled with a quencher group, and any of the 5 th to 10 th bases is substituted with a tetrahydrofuran residue (THF).
3. The probe for detecting Neisseria gonorrhoeae of claim 1, wherein said nucleotide sequence is the probe of SEQ ID NO. 2, the 30 th base T from the 5 'end is labeled with a luminescent group, the 32 th base is replaced with a tetrahydrofuran residue (THF), the 34 th base is labeled with a quencher group, and the 3' end is modified by C3-spacer blocking.
4. A group of target sequences, primer pairs and probes for detecting Neisseria gonorrhoeae, wherein the probes are the probes described in any one of claims 1-3, the nucleotide sequences of the primer pairs are shown as SEQ ID NO. 3 and SEQ ID NO. 4, and the target sequences are shown as SEQ ID NO. 5.
5. A kit for detecting Neisseria gonorrhoeae, comprising nucleic acid extraction reagents, a isothermal amplification reaction module, a positive control and a negative control, as well as a probe according to any one of claims 1 to 3 and a primer pair according to claim 4.
6. The kit of claim 5, wherein the isothermal amplification reaction module is a lyophilized powder reagent of a mixed reagent of RDA or RPA isothermal amplification reaction; the freeze-dried powder reagent of the mixed reagent for the RDA constant-temperature amplification reaction comprises recombinase KX with a nucleotide sequence shown in SEQ ID NO. 6.
7. The kit of claim 6, wherein the lyophilized powder reagent of the mixed reagent for RDA isothermal amplification reaction comprises recombinase KX 60-600 ng/μ L, KY protein 16-192 ng/μ L, single-stranded binding protein gp 32100-1000 ng/μ L, strand-displacement DNA polymerase 3-100 ng/μ L, exonuclease 30-200U, creatine kinase 0.1-0.8 mg/ml, creatine phosphate 25-75 mM, Tris buffer 20-100mM, PEG 2.5-10%, potassium acetate or sodium acetate 0-150 mM, dATP 1-5 mM, dNTPs 150-600nM, DTT 1-12 mM, the probe 150nM-600nM, and the primer pair 150-600 nM.
8. The kit of claim 5, wherein the nucleic acid extraction reagent comprises Buffer A, Buffer B; the Buffer A is a sample lysate and contains a Tris-HCL Buffer system, NaOH, SDS, EDTA, guanidinium isothiocyanate, Tween80 and triton; the Buffer B contains a Tris Buffer system, potassium chloride and magnesium chloride; the positive control is a plasmid containing a neisseria gonorrhoeae target gene, and the negative control is an empty vector pUC57 plasmid.
9. A method for detecting neisseria gonorrhoeae for non-disease diagnostic purposes, comprising the steps of:
extracting nucleic acid of a sample to be detected, performing real-time fluorescence RDA reaction in the presence of a primer pair, a probe and an RDA freeze-dried powder reagent, Buffer A and Buffer B of Neisseria gonorrhoeae by taking the nucleic acid of the sample to be detected as a template, and analyzing the sample to be detected according to a real-time fluorescence RDA amplification curve; wherein the nucleotide sequence of the probe is shown as SEQ ID NO. 1 or SEQ ID NO. 2, wherein the reaction temperature is 25-42 ℃, and the reaction time is more than 10 minutes.
10. The detection method according to claim 9, wherein the reaction temperature is 39 ℃ and the reaction time is 30 minutes.
CN202010081197.1A 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting neisseria gonorrhoeae Active CN112301105B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010081197.1A CN112301105B (en) 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting neisseria gonorrhoeae

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010081197.1A CN112301105B (en) 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting neisseria gonorrhoeae

Publications (2)

Publication Number Publication Date
CN112301105A true CN112301105A (en) 2021-02-02
CN112301105B CN112301105B (en) 2024-01-02

Family

ID=74336740

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010081197.1A Active CN112301105B (en) 2020-02-06 2020-02-06 RDA method and kit for rapidly detecting neisseria gonorrhoeae

Country Status (1)

Country Link
CN (1) CN112301105B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102666872A (en) * 2009-09-25 2012-09-12 艾利尔圣迭戈公司 Detection of nucleic acids in crude matrices
WO2017103269A1 (en) * 2015-12-18 2017-06-22 Selfdiagnostics Deutschland Gmbh Method for the detection of a sexually transmitted infectious pathogen
CN109486973A (en) * 2018-12-13 2019-03-19 中国医学科学院病原生物学研究所 A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique
CN110317861A (en) * 2019-07-18 2019-10-11 江苏宏微特斯医药科技有限公司 A kind of kit detecting pathogen
CN209974796U (en) * 2019-12-16 2020-01-21 广州普世利华科技有限公司 Quick detection device

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102666872A (en) * 2009-09-25 2012-09-12 艾利尔圣迭戈公司 Detection of nucleic acids in crude matrices
WO2017103269A1 (en) * 2015-12-18 2017-06-22 Selfdiagnostics Deutschland Gmbh Method for the detection of a sexually transmitted infectious pathogen
CN109486973A (en) * 2018-12-13 2019-03-19 中国医学科学院病原生物学研究所 A kind of method for visualizing quickly detecting NEISSERIA GONORRHOEAE using recombinase polymerase isothermal amplification technique
CN110317861A (en) * 2019-07-18 2019-10-11 江苏宏微特斯医药科技有限公司 A kind of kit detecting pathogen
CN209974796U (en) * 2019-12-16 2020-01-21 广州普世利华科技有限公司 Quick detection device

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DAVID M. WHILEY 等: "Nucleic Acid Amplification Testing for Neisseria gonorrhoeae An Ongoing Challenge", JOURNAL OF MOLECULAR DIAGNOSTICS, vol. 8, no. 1 *
SEBASTIAN KERSTING 等: "Multiplex isothermal solid-phase recombinase polymerase amplification for the specific and fast DNA-based detection of three bacterial pathogens", MICROCHIM ACTA, vol. 181, pages 1718 - 1722 *
孙魁 等: "重组酶聚合酶扩增技术的研究进展", 军事医学, vol. 39, no. 10, pages 803 *

Also Published As

Publication number Publication date
CN112301105B (en) 2024-01-02

Similar Documents

Publication Publication Date Title
CN112301154B (en) RDA method and kit for rapidly detecting respiratory syncytial virus
CN111549182B (en) Probe and kit for detecting SARS-CoV-2
CN111876525A (en) gRNA, primer and kit for detecting SARS-CoV-2
CN111088404B (en) RDA method and kit for rapidly detecting coxsackievirus A16 and enterovirus 71
CN111286559B (en) Primer, probe and kit for detecting African swine fever virus
CN111187855B (en) RDA method and kit for rapidly detecting Feline Herpesvirus (FHV)
CN111118219B (en) RDA method and kit for rapidly detecting influenza A virus
CN111154739B (en) Novel recombinase-dependent amplification method and kit
CN110527730B (en) Echinococcus shikoensis detection kit based on RPA technology and application thereof
CN111910017A (en) Multiplex-time PCR (polymerase chain reaction) kit for detecting respiratory pathogens, method and application
CN112301159B (en) RDA method and kit for rapidly detecting influenza B virus
CN112301152B (en) Multiplex fluorescence RDA method and kit for rapidly detecting porcine pseudorabies virus, porcine circovirus and porcine parvovirus
CN113718045B (en) DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application
CN112301157B (en) RDA method and kit for rapidly detecting cat parvovirus (FPV)
CN112592992A (en) Primer probe set and kit for combined detection of mycoplasma pneumoniae and chlamydia pneumoniae based on fluorescent RMA method
CN112301153B (en) RDA method and kit for rapidly detecting Canine Coronavirus (CCV)
CN112301156B (en) RDA method and kit for rapidly detecting human adenovirus
CN112301105B (en) RDA method and kit for rapidly detecting neisseria gonorrhoeae
CN112301104B (en) RDA method and kit for rapidly detecting chlamydia trachomatis
CN111500774B (en) Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit
CN112301137B (en) RDA method and kit for rapidly detecting ureaplasma urealyticum
CN112301155B (en) RDA method and kit for rapidly detecting rotavirus
CN112301151B (en) RDA method and kit for rapidly detecting Canine Distemper Virus (CDV)
CN112301158B (en) RDA method and kit for rapidly detecting Classical Swine Fever Virus (CSFV)
CN117187417A (en) Primer, probe, kit and application for detecting drug-resistant gene arr2 by RAA fluorescence method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant