CN116254352A - CRISPR-based method and kit for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae - Google Patents

Abstract

The invention discloses a CRISPR-based method and a kit for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae. The primer pair is designed according to target sites shown in SEQ ID NO. 1-5. The crRNA probe is designed according to the target site shown in SEQ ID NO. 6-10. A kit for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae based on a CRISPR mode comprises freeze-drying reagents 1 and 2, buffer solutions 1 and 2, genome DNA extraction reagents 1 and 2 and a purple light flashlight. Treating the bacterial liquid by using a genome DNA extraction reagent; amplifying a target site gene by a primer pair, recombinase polymerase and dNTPs; by means of Cas12 protein and under the guidance of crRNA probe, combining target site double-stranded DNA substrate and activating the characteristic of non-specific cutting single-stranded DNA report sequence, the method for fast and high-specificity visual detection of tigecycline drug-resistant high-virulence Klebsiella pneumoniae is designed.

Description

CRISPR-based method and kit for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae

Technical Field

The invention belongs to the technical field of gene detection, and particularly relates to a method and a kit for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae based on CRISPR.

Background

Klebsiella pneumoniae @Klebsiella pneumoniaeKP) are gram-negative pathogenic bacteria common to community and hospital acquired infections that can cause infections of the respiratory, digestive, urinary and blood systems in immunocompromised or immunocompromised patients. The results of drug resistance monitoring of Chinese bacteria in 2020 show that KP in the main clinical isolated strain is second most conditional pathogenic bacteria next to Escherichia coli, and the isolation rate of KP shows a tendency to rise year by year.

In 1986, taiwan reported for the first time a special community-acquired KP that, without a history of hepatobiliary disease, caused primary invasive liver abscess in the host with distant metastasis. According to this particular clinical feature, this KP is defined as Klebsiella pneumoniae (hypervirus)Klebsiella pneumoniaeHvKP). HvKP often exhibits a high mucinous phenotype, carrying a virulence plasmid of pLVPK (224,152 bp) or pK2044 (219,385 bp), a type of strain that is more resistant than classical Klebsiella pneumoniae (classical)Klebsiella pneumoniaeCKP) a more toxic evolutionary pathotype. Unlike CKP, hvKP is often detected in young healthy individuals and is more prone to severe infections in healthy people, such as suppurative liver abscess, endophthalmitis, meningitis, necrotizing fasciitis, severe pneumonia, etc., that appear as multiple sites simultaneously infected or transferred from primary foci to other sites. For the past 30 years, the incidence of HvKP infection has steadily risen in the asia-pacific region,HvKP has become the most predominant pathogen of suppurative liver abscess in some countries, and the mortality rate is as high as 3% -42%.

Laboratory diagnosis of suspected HvKP infection is currently commonly performed using general laboratory examination and etiology identification methods. Conventional detection methods for HvKP mainly include morphology, serology, immunology and general PCR. However, the detection methods are complicated and have high requirements on equipment, and are not beneficial to popularization and detection of the base layer. In recent years, isothermal amplification techniques such as loop-mediated isothermal amplification (loop-mediated isothermal amplification, LAMP), recombinase polymerase amplification (recombinase polymerase amplification, RPA) and the like have been developed rapidly and are increasingly applied clinically because they do not require expensive equipment, are rapid in reaction, and are high in sensitivity. RPA is a isothermal amplification technique. The reaction temperature is between 37 and 42 ℃, the temperature is not required to be increased or reduced for denaturation, the RPA is not required to depend on expensive instruments, the sensitivity and the specificity are good, and the RPA can realize the portable rapid detection of pathogenic bacteria.

The CRISPR system is an acquired immune defense system for bacteria and archaebacteria to utilize Cas effector proteins and to resist foreign nucleic acid invasion under the guidance of crRNA probes. Which is capable of cleaving and eliminating the threat of viral entry and other foreign nucleic acids. CRISPR-Cas systems utilize their own RNAs to sequence pair with target DNA, thereby recognizing specific sequences.S. pyogenesCas9 (SpCas 9, generally abbreviated as Cas 9) is the most widely used Cas protein because it has a simple PAM sequence and high gene editing efficiency in cells. Cas12a (also known as Cpf 1) is a different CRISPR system than Cas 9.

The Cas12a protein recognizes a T-rich PAM site, forming a 5 nucleotide sticky end at the 5' end of the target sequence, while processing itself into mature crRNA. Cas12a has cleavage activity that cleaves both double-stranded and single-stranded DNA. It, after cleaving sequence-specific target double-stranded DNA, has its enzymatic activity activated, becoming a single-stranded DNA chopper, which will cleave any single-stranded DNA in its vicinity. It has extremely fast cutting speed to single-stranded DNA, up to more than 1000 molecules per second, and can last for more than several hours. Thus, cas12a recognizes a specific double-stranded DNA sequence, and can cleave millions of non-specific single-stranded DNA molecules. By utilizing this property, a luminescent molecule can be linked to an inhibitory molecule (simply referred to as a reporter sequence) that prevents the luminescence of such a luminescent molecule through single-stranded DNA. When Cas12a is activated by sequence-specific double-stranded DNA, it cleaves the single-stranded DNA linking the luminescent molecule and the inhibitory molecule, which removes the luminescent inhibitory molecule, allowing the luminescent molecule to emit light, thereby detecting the optical signal.

Disclosure of Invention

The invention aims to establish a high virulence related gene for detecting tigecycline drug-resistant HvKP based on CRISPR and a tigecycline drug-resistant genetet(A) According to the visual rapid nucleic acid detection method, the RPA specific primer is designed, the RPA amplification technology is utilized to amplify nucleic acid, the product is subjected to enzyme digestion of a single-stranded DNA report sequence by using Cas12a under the guidance of a crRNA probe, and the detection is carried out through a fluorescent signal, so that the rapid detection can be carried out to obtain a result, and the defects of insensitivity, long time, high cost and the like of the current detection method are overcome.

The invention selects HvKPiucA、iroB、peg-344、rmpAA kind of electronic device with high-pressure air-conditioning systemtet(A) To detect a target gene. Based on the 5 gene reference sequences, combining the 5 gene sequences of the HvKP sequenced in the laboratory and target genes searched in NCBI gene library of the national center for biotechnology information, and comparing, selecting the conserved regions of the 5 genes, and designing RPA primer pairs and crRNA probes.

Preferably, the RPA primer pair is based oniucASpecific 1725 bp sequence shown in SEQ ID NO. 1; based oniroBSpecific 1116 bp sequence shown in SEQ ID NO. 2; based onpeg-344The specific 903 bp sequence is shown as SEQ ID NO. 3; based onrmpAA specific 633 bp sequence shown in SEQ ID NO. 4; based ontet(A) The specific 1200 bp sequence is shown as SEQ ID NO. 5.

Preferably, the sequences of the RPA primer pair are used for detectioniucAThe primer pair of (2) is F1/R1, and is shown in SEQ ID NO. 11-12 or a sequence with more than 75% of similarity with the sequence;for detectingiroBThe primer pair of (2) is F2/R2, and is shown in SEQ ID NO. 13-14 or a sequence with more than 75% of similarity with the sequence; for detectingpeg-344The primer pair of (2) is F3/R3, and is shown in SEQ ID NO. 15-16 or a sequence with more than 75% of similarity with the sequence; for detectingrmpAThe primer pair of (2) is F4/R4, and is shown in SEQ ID NO. 17-18 or a sequence with more than 75% of similarity with the sequence; for detectingtet(A) The primer pair of (2) is F5/R5, and is shown in SEQ ID NO. 19-20 or a sequence with more than 75% of similarity with the sequence.

The target specificity of the CRISPR/Cas12a system is determined by the 20 nucleotide sequence at the 3 'end of the crRNA probe, which is found in the conserved region of the 5 genes described above, and the required target sequence must follow the PAM site of the 5' -TTTN and determine the crRNA sequence therefrom.

Preferably, the method is used for detectingiucAThe guide sequence of crRNA probe of GCCGUGACCG CCGCGCUGGG; for detectingiroBThe guide sequence of crRNA probe of GCGUUAACGG CCAUGAAGUG; for detectingpeg-344The guide sequence of crRNA probe of AUAGCUGGGGUUAUUCUUUC; for detectingrmpAThe guide sequence of crRNA probe of UUCAGGGAAA UGGGGAGGGU; for detectingtet(A) The guide sequence of crRNA probe of CCGGAGUGCA CAAAGGCGA; the non-guide sequence of the crRNA probe is UAAUUUCUAC UAAGUGUAGA U or a sequence with a sequence similarity of more than 75%.

Preferably, the sequence of the crRNA probe is shown as SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24 and SEQ ID NO. 25.

Preferably, the crRNA probe is in the form of RNA that can guide Cas12a to cleave both the HvKP target gene and the single stranded DNA reporter sequence.

The scheme adopted by the invention for achieving the purpose is as follows: a kit for detecting tigecycline drug-resistant HvKP based on CRISPR comprises a freeze-drying reagent 1, wherein the freeze-drying reagent comprises a primer pair, a recombinase polymerase, dNTPs, a crRNA probe and a single-stranded DNA report sequence; buffer 1; lyophilizing agent 2, comprising the Cas12 protein; buffer solution 2; genomic DNA extraction reagents 1, 2; purple light flashlight.

Preferably, the single stranded DNA reporter sequence is an enriched sequence containing T and a or containing only T.

Preferably, the single stranded DNA reporter sequence contains at least one of TTT, ATT, TAT, TTA, AAT, ATA, TAA, AAA.

Preferably, the 5' end of the single stranded DNA reporter sequence is modified with any one of Atto 425, BODIPY FL, FAM, oregon Green 488, TET, JOE, R G, yakima Yellow, VIC, HEX, quasar 570, cy3, NED, TAMRA, ROX, aquaPhluor 593, texas Red, atto 590, cy5, quasar 670 and Cy 5.5; and the 3' end of the single stranded DNA reporter sequence is modified with BHQ1, BHQ2, BHQ3, BBQ650, MGB and Dabcyl.

More preferably, the single stranded DNA reporter sequence is: (1) The 5 'end of TTATT is modified by FAM, and the 3' end is modified by Dabcyl, namely FAM-TTATT-Dabcyl; or (2) FAM modification at TTATT,5 'end, and MGB modification at 3' end, namely FAM-TTATT-MGB.

Preferably, the Cas protein is Cas12, cas13 or Cas14; the Cas12 is Cas12a, cas12b, cas12c, cas12d, cas12e, cas12g, cas12h or Cas12i.

More preferably, the Cas12a is more particularly fromLachnospiraceaebacterium、Acidaminococcus sp.、Francisella tularensis subsp.、Prevotella disiens、Porphyromonas macacae、Lachnospiraceae bacterium MA2020、Candidatus Methanoplasma termitum、Moraxella bovoculi237, such as LbCas12a, asCpf1, fnCpf1 proteins. Most preferably, the Cas12a protein is a key domain in LbCas12 a. When Cas13 proteins are used in the present invention, the single-stranded reporter sequence needs to be changed to an RNA sequence, requiring RNA transcription after sample isothermal or PCR reactions. When Cas14 protein is employed, the sample is prepared as single stranded DNA.

Preferably, the detection reaction system of the kit is as follows: 5-20M upstream and downstream primers, 1 concentration of recombinase polymerase, 1 concentration of dNTP,10-100 nM crRNA probe, 1-10M single-stranded DNA reporter sequence, 10-100 nM Cas protein, buffer 1 of 40L, buffer 2 of 400L, genomic DNA extraction reagent 1 of 40L, and genomic DNA extraction reagent 2 of 40L. Another preferred detection reaction system of the kit is: 5-10M upstream and downstream primers, 1 concentration of recombinase polymerase, 1 concentration of dNTP,10-100 nM crRNA probe, 2-10M FAM-TTATT-Dabcyl reporter sequence, 10-100 nM Cas protein, buffer 1 of 40L, buffer 2 of 400L, genomic DNA extraction reagent 1 of 40L, and genomic DNA extraction reagent 2 of 40L.

More preferably, the detection reaction system of the kit is: 10 M upstream and downstream primers, 1 concentration of recombinase polymerase, 1 concentration of dNTP,25 nM of crRNA probe, 2M of FAM-TTATT-Dabcyl report sequence, 60 nM of LbCAs12a, buffer 1 of 40L, buffer 2 of 400L, genomic DNA extraction reagent 1 of 40L, and genomic DNA extraction reagent 2 of 40L.

The method for rapidly detecting the tigecycline drug-resistant HvKP with high sensitivity and high specificity is designed by utilizing the characteristics that the Cas protein cuts a double-stranded DNA substrate of a HvKP target site under the guidance of a crRNA probe, then releases a PAM far-end product, activates a non-specific cutting single-stranded DNA report sequence and judges the result through visual observation of fluorescence under the irradiation of a purple flashlight.

Drawings

FIG. 1 shows the results of an amplification experiment based on the primer pair F1/R1 in example 1 of the present invention;

FIG. 2 shows the result of an amplification experiment based on the primer set F2/R2 in example 1 of the present invention;

FIG. 3 shows the result of an amplification experiment based on the primer set F3/R3 in example 1 of the present invention;

FIG. 4 shows the result of an amplification experiment based on the primer set F4/R4 in example 1 of the present invention;

FIG. 5 shows the result of an amplification experiment based on the primer pair F5/R5 in example 1 of the present invention;

FIG. 6 shows the fluorescence results of genomic DNA detection using the kit of example 3 of the present invention;

FIG. 7 shows the fluorescence results of the bacterial liquid detected by the kit in example 3 of the present invention;

FIG. 8 shows the specific fluorescence results of the detection method in example 4 of the present invention.

Detailed Description

For a better understanding of the present invention, the following examples are further illustrative of the present invention, but the contents of the present invention are not limited to the following examples only.

Example 1

(1) Cas12a protein expression and purification

Cloning the DNA fragment encoding LbCAs12a onto pET30C vector containing 6 histidine tags at C-terminal to construct expression plasmid, transforming BL21 (DE 3), and performing overnight activation and expansion culture of strain in 37C,2YT medium (10 g tryptone, 10 g yeast extract, 5 g NaCl) until OD ₆₀₀ When the expression time reaches 0.6, IPTG (isopropyl thiogalactoside) 21C of 0.5 mM is added to induce the expression for 16 hours, and then bacteria are harvested.

The expressed bacteria were resuspended in lysis buffer (50 mM Tris-HCl, pH 7.5, 500 mM NaCl,5% (v/v) glycerol, 1 mM TCEP (Tris (2-carboxyethyl) phosphine), 0.25 mg/mL lysozyme), sonicated, the supernatant obtained after disruption was filtered through a 0.22 m filter, hisTrap HP nickel column purified, 500 mM imidazole eluted, 50 kDa ultrafiltration tube concentrated to 500L, purified by Sephadex chromatography (Superdex Increase 200), the protein of interest was stored in storage buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl,5% (v/v) glycerol, 1 mM TCEP) and frozen in-80C refrigerator for use.

(2) Preparation of Single-stranded DNA reporter sequences

LbCAs12a non-specifically cleaves single-stranded DNA with TA preference, single-stranded DNA reporter sequence (5 '-3'): TTATT, FAM modification at the 5 'end, dabcyl modification at the 3' end, namely FAM-TTATT-Dabcyl.

The single-stranded DNA reporter sequence is responsible for synthesis, purification and validation by bioengineering synthesis-related companies.

(3) Screening and preparation of RPA primers

Determination of candidate target sequences

HvKP-basediucA、iroB、peg-344、rmpAA kind of electronic device with high-pressure air-conditioning systemtet(A) Gene reference sequence, 5 gene sequences in combination with laboratory sequenced HvKP and national biotechnologyThe 5 gene sequences of HvKP searched in NCBI gene library of information center are compared, and the 5 gene target sequences are shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5.

The conserved regions of the 5 genes were selected for subsequent study.

Screening and preparation of candidate RPA primers

Based on the conserved region sequence, the primer length is defined as 21-36 bp, the product length is 80-200 bp, related primer design software or a website is used for searching, and primer pairs with higher scores are selected, wherein the sequences of the primer pairs are shown as SEQ ID NO. 11-12, SEQ ID NO. 13-14, SEQ ID NO. 15-16, SEQ ID NO. 17-18 and SEQ ID NO. 19-20.

The RPA primer is responsible for synthesis, purification and confirmation by bioengineering synthesis related companies.

By RPA amplification assay, optimal RPA primers are determined based on amplified band size and product content.

(4) Screening and preparation of crRNA probes

Determination of candidate crRNA Probe sequences

Because LbCAs12a specifically cleaves double-stranded DNA and recognizes a PAM sequence (TTTN), 20 nucleotides downstream of the PAM sequence are the complementary pairing and recognition regions of the crRNA probe and the double-stranded DNA of the target site. The conserved regions of the 5 genes are searched for PAM sites (5 '-TTTN-3' or 5 '-NAAA-3') to determine the crRNA targeting sequence. And (3) selecting a crRNA probe with higher score, wherein the probe sequences are shown as SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24 and SEQ ID NO. 25.

Preparation of candidate crRNA probes

Adding a T7 promoter sequence before a DNA sequence corresponding to the crRNA probe, then, carrying out slow annealing on the sequence to form a double-stranded DNA sequence, taking the double-stranded DNA sequence as a template for in vitro transcription, adding T7 RNA polymerase, incubating for 16 hours at 37 ℃, digesting the DNA template by DNase I, and then, recovering the DNA template by an RNA purification kit to obtain the crRNA probe.

Screening of optimal crRNA probes

The crRNA probe and the single-stranded DNA report sequence are added by taking target gene double-stranded DNA with the same concentration as a substrate, and the crRNA probe with strong specificity and high sensitivity is screened by comparing the intensity of fluorescent signals.

Example 2: preparation of the kit

And freeze-drying the RPA primer, the recombinase polymerase, the dNTPs, the crRNA probe and the single-stranded DNA report sequence at the bottom of the PCR tube to obtain a freeze-dried reagent 1, and carrying out vacuum sealing preservation by using a tin foil bag. When in use, the buffer solution 1 is added into a PCR tube for redissolution. The composition of buffer 1 is shown in Table 1.

The Cas12 protein is freeze-dried in a penicillin bottle, and buffer solution 2 is added for re-dissolution when the Cas12 protein is used.

The components of the genomic DNA extraction reagents 1 and 2 are shown in Table 2.

And packaging the reagent, the blank centrifuge tube and the purple flashlight in a packaging box to obtain the kit.

TABLE 1 buffer 1 and buffer 2 Components

	Buffer 1 component	Buffer 2 component
				50 mM NaCl	50 mM NaCl
	10 mM Tris-HCl	10 mM Tris-HCl
				10 mM MgCl2	10 mM MgCl2
	100 g/ml Bovine serum albumin	100 g/ml Bovine serum albumin
				280 mM Magnesium acetate	（pH 7.9 @25C）

TABLE 2 genomic DNA extraction reagents 1 and 2 Components

	DNA extraction reagent 1 component	DNA extraction reagent 2 component
				12.5 mM Sodium hydroxide	40 mM Tris-HCl
	0.5 mM EDTA

Example 3: fluorescence detection of HvKP

Taking 100L to-be-detected bacterial liquid into a blank centrifuge tube, adding 40L of genome DNA extraction reagent 1, flicking and uniformly mixing for about 1 minute.

The genomic DNA extraction reagent 2 of 40L was further added for neutralization, and the mixture was gently mixed.

Taking 2L of extracting solution, adding the extracting solution into a re-dissolved PCR tube, and blowing and uniformly mixing.

The Cas12a complex solution was spotted on the tube cap of the PCR tube and the PCR tube cap was slowly capped.

The mixture was placed at a constant temperature of 39C and reacted for 30 minutes.

Centrifuging to make the Cas12a protein enter a reaction system, and reacting at 39C for 20 minutes.

And irradiating the bottom of the PCR centrifuge tube by using a purple flashlight, and observing fluorescent color to judge the result.

Example 4: specificity of the assay

The specificity of the method is analyzed by taking escherichia coli, staphylococcus aureus, streptococcus suis, salmonella typhi and KP as samples and using a kit for detection.

Claims (12)

1. A kit for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae based on a CRISPR mode is characterized in that: comprises a primer pair, recombinase polymerase, dNTPs, crRNA probes, a single-stranded DNA report sequence, a buffer solution, cas12 protein, a genome DNA extraction reagent and a purple light flashlight.

2. The kit for detecting tigecycline-resistant high virulence klebsiella pneumoniae based on a CRISPR method of claim 1, wherein the kit comprises: the detection reaction system of the kit comprises 5-20M upper and downstream primers, 1 concentration of recombinase polymerase, 1 concentration of dNTP,10-100 nM crRNA probe, 1-10M FAM-TTATT-Dabcyl report sequence, 1 concentration of buffer solution 1, 10-100 nM Cas12a,1 concentration of buffer solution 2,1 concentration of genomic DNA extraction reagent 1 and 1 concentration of genomic DNA extraction reagent 2.

3. A primer pair for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae based on a CRISPR mode is characterized in that: the primer pair is based oniucASpecific 1725 bp sequence shown in SEQ ID NO. 1; based oniroBSpecific 1116 bp sequence shown in SEQ ID NO. 2; based onpeg-344The specific 903 bp sequence is shown as SEQ ID NO. 3; based onrmpAA specific 633 bp sequence shown in SEQ ID NO. 4; based ontet(A) The specific 1200 bp sequence is shown as SEQ ID NO. 5.

4. The primer pair for detecting tigecycline-resistant high virulence klebsiella pneumoniae based on a CRISPR method according to claim 3, wherein the primer pair is characterized in that: for detectingiucAThe primer pair of (2) is F1/R1, and is shown in SEQ ID NO. 11-12 or a sequence with more than 75% of similarity with the sequence; for detectingiroBThe primer pair of (2) is F2/R2, and is shown in SEQ ID NO. 13-14 or a sequence with more than 75% of similarity with the sequence; for detectingpeg-344The primer pair of (2) is F3/R3, and is shown in SEQ ID NO. 15-16 or a sequence with more than 75% of similarity with the sequence; for detectingrmpAThe primer pair of (2) is F4/R4, and is shown in SEQ ID NO. 17-18 or a sequence with more than 75% of similarity with the sequence; for detectingtet(A) The primer pair of (2) is F5/R5, and is shown in SEQ ID NO. 19-20 or a sequence with more than 75% of similarity with the sequence.

5. A CRRNA probe for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae based on a CRISPR mode is characterized in that: the crRNA probe is designed according to the target sites shown as SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9 and SEQ ID NO. 10.

6. The crRNA probe for detecting tigecycline-resistant high virulence klebsiella pneumoniae according to claim 5, wherein the crRNA probe comprises: the method is used for detectingiucAThe crRNA probe of (2) has the guide sequence ofGCCGUGACCGCCGCGCUGGG; for detectingiroBThe guide sequence of crRNA probe of GCGUUAACGGCCAUGAAGUG; for detectingpeg-344The guide sequence of crRNA probe of AUAGCUGGGGUUAUUCUUUC; for detectingrmpAThe guide sequence of crRNA probe of UUCAGGGAAA UGGGGAGGGU; for detectingtet(A) The guide sequence of crRNA probe of CCGGAGUGCACAAAGGCGA; the non-guide sequence of the crRNA probe is UAAUUUCUAC UAAGUGUAGA U or a sequence with a sequence similarity of more than 75%.

7. The crRNA probe for detecting tigecycline-resistant high virulence klebsiella pneumoniae according to claim 5, wherein the crRNA probe comprises: the sequences of the crRNA probes are shown as SEQ ID NO. 21, SEQ ID NO. 22, SEQ ID NO. 23, SEQ ID NO. 24 and SEQ ID NO. 25.

8. The crRNA probe for detecting tigecycline-resistant high virulence klebsiella pneumoniae according to any one of claims 5 to 7, wherein the crRNA probe comprises: the crRNA probe is in RNA form that can guide Cas protein to cleave target genes and single-stranded DNA reporter sequences of tigecycline-resistant high virulence klebsiella pneumoniae.

9. A single-stranded DNA report sequence for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae based on a CRISPR mode is characterized in that: the single-stranded DNA reporter sequence is an enrichment sequence containing T and A or only T.

10. The single stranded DNA reporter sequence for detecting tigecycline resistant high virulence klebsiella pneumoniae of claim 9 based on a CRISPR format, wherein the single stranded DNA reporter sequence comprises: the single stranded DNA reporter sequence contains at least one of TTT, ATT, TAT, TTA, AAT, ATA, TAA, AAA.

11. The single stranded DNA reporter sequence for detecting tigecycline resistant high virulence klebsiella pneumoniae of claim 9 based on a CRISPR format, wherein the single stranded DNA reporter sequence comprises: the 5' end of the single-stranded DNA report sequence is modified by any one of Atto 425, BODIPY FL, FAM, oregon Green 488, TET, JOE, R G, yakima Yellow, VIC, HEX, quasar 570, cy3, NED, TAMRA, ROX, aquaPhluor 593, texas Red, atto 590, cy5, quasar 670 and Cy5.5; and the 3' end of the single stranded DNA reporter sequence is modified with BHQ1, BHQ2, BHQ3, BBQ650, MGB and Dabcyl.

12. A Cas protein for detecting tigecycline drug-resistant high-virulence klebsiella pneumoniae based on a CRISPR mode is characterized in that: the Cas protein is Cas12, cas13 or Cas14; the Cas12 is Cas12a, cas12b, cas12c, cas12d, cas12e, cas12g, cas12h or Cas12i.

Images