KR101960016B1 - Composition for detecting pathogens of respiratory disease, and using the same - Google Patents

Abstract

According to a primer set, composition, and kit for detecting pathogens of respiratory disease and a detection method using the same, pathogens of respiratory disease, in particular Mannheimia haemolytica, Histophilus somni, and Mycoplasma bovis, can be detected separately. Thus, the pathogens of respiratory disease can be detected quickly with a small amount of sample.

Description

[0001] The present invention relates to a composition for detecting causative agents of respiratory diseases,

The present invention relates to a primer set, a composition, a kit, and a method using the primer set for detecting causative agents of respiratory diseases in an animal.

Animal respiratory diseases include respiratory diseases caused by ammonia gas, carbon dioxide gas, dust, etc. in the enclosed cornucopia due to the intensive care, The mucous membrane is weakened by the damage of the basic immune system, and the infection is weakened, and it is caused by the compound infection of the bacteria or the virus.

These respiratory diseases can be classified into bacterial and viral diseases depending on the causative agent. Major causative agents for respiratory diseases include Mannheimia haemolytica, Histophilus somni, and Mycoplasma vorbis. (Mycoplasma bovis). Mannheimia hemolytica is the major causative agent of cow and sheep pneumonia (Enzootic pneumonia) and irregular mastitis in sheep. Histophyllus somnifusa diffuses through the bloodstream with other bacterial agents and causes not only respiratory, but also genital, , Circulatory system and musculoskeletal system. Mycoplasma vorbis also acts as a causative agent of mastitis as well as respiratory diseases of cattle.

Although respiratory diseases cause serious economic losses due to their infectious diseases, fast and inexpensive tests are required, but there are limits to the fact that only limited sampling is possible due to the characteristics of animal breeding grounds. Therefore, it is essential to prevent or treat respiratory diseases by early detection of causative agents through rapid detection of causative agents of respiratory diseases to reduce the mortality rate of livestock and increase the productivity of farm households.

One aspect provides a set of primers for detecting causative agents of respiratory diseases.

Another aspect provides compositions and kits comprising a set of primers for detecting causative agents of respiratory diseases.

Another aspect provides a method for detecting causative agents of respiratory diseases.

An aspect of the present invention is A first primer comprising at least 10 consecutive nucleotide sequences selected from a nucleotide sequence; And a second primer comprising at least 10 consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 2.

The composition may further comprise a first probe comprising at least 10 contiguous nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 3.

The first set of primers may be for detecting Mannheimia haemolytica.

The primers and probes may have a nucleic acid sequence that specifically binds to the gene sequence of Mannheimia hemolyticus. Specifically, the first primer, the second primer, and the first probe may have a nucleotide sequence that specifically binds to a part of the SodA gene of Mannheimia hedgehog. Therefore, the primer is for amplifying a part of the gene sequence of Mannheimia hedgehoglia, and the probes may be probes for detecting the amplification product of Mannheimia hedgehog.

The primers and probes may be present in the amplification reaction solution at the same time so that hybridization and extension with each target nucleic acid can be achieved. For example, a polymerase chain reaction (PCR) using a composition containing the above primer set or other nucleic acid may amplify and detect a target nucleic acid without interfering with each other's reaction have.

The term " polymerase chain reaction (PCR) "as used herein refers to a method for amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase, including a thermal cycle for hybridization and denaturation Lt; / RTI > Such a PCR method is well known in the art, and a commercially available PCR kit may be used. PCR methods include single PCR amplifying only one target at a time and multiplex PCR amplifying multiple targets at a time. In multiplex PCR, a plurality of primer pairs are used. Also, primers used for amplification of a target sequence in a multiplex PCR may not be used only for amplification of the target sequence but may be intentionally used redundantly for amplification of any other target sequence in a multiplex PCR.

Another aspect is a kit comprising a third primer comprising 10 or more consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 4 and a fourth primer comprising 10 or more consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 2 < / RTI > primer set.

The composition may further comprise a second probe comprising at least 10 consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 6.

The second primer set may be one for detecting Histophilus somni.

The primers and probes may have a nucleic acid sequence that specifically binds to the gene sequence of Histophilus somalis. Specifically, the third primer, the fourth primer, and the second probe may have a nucleotide sequence that specifically binds to a part of 16S rDNA of Histophyllus somnis. Accordingly, the primer is for amplifying a part of the gene sequence of the histolophyllous somalia, and the probes may be a probe for detecting the amplification product of the histolophyll soma.

The primers and probes may be present in the amplification reaction solution at the same time so that hybridization and extension with each target nucleic acid can be achieved. For example, it may be possible to amplify and detect a target nucleic acid without interfering with each other's reaction in a PCR using a composition containing the primer set or other nucleic acid.

Another aspect is directed to a method for producing a nucleic acid comprising a fifth primer comprising 10 or more consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 7 and a sixth primer comprising 10 or more consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 3 < / RTI > primer set.

The composition may further comprise a third probe comprising at least 10 consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO:

The third primer set may be one for detecting Mycoplasma bovis.

The primers and probes may have a nucleic acid sequence that specifically binds to the gene sequence of Mycoplasma vorbis. Specifically, the first primer, the second primer, and the first probe may have a nucleotide sequence that specifically binds to a part of the uvrC gene of Mannheimia hedgehog. Therefore, the primer is for amplifying a part of the gene sequence of Mycoplasma vorvis, and the probes may be probes for detecting the amplification product of Mycoplasma vorvis.

The primers and probes may be present in the amplification reaction solution at the same time so that hybridization and extension with each target nucleic acid can be achieved. For example, it may be possible to amplify and detect a target nucleic acid without interfering with each other's reaction in a PCR using a composition containing the primer set or other nucleic acid.

The term "nucleotide sequence" is double stranded DNA or cDNA, or single stranded DNA or RNA, and may include nucleotide analogs unless otherwise stated. The nucleotide sequence can be synthesized and produced by an appropriate method (for example, chemical synthesis) according to methods known in the art. In addition, the nucleotide sequence is commercially available. The nucleotide sequence may be modified through a variety of methods known in the art. Examples of such modifications include, but are not limited to, methylation, deamidation, capping, substitution of one or more natural nucleotides with one or more homologues, or modifications between nucleotides such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amide, carbamate, etc.) or a charged linkage (e.g., phosphorothioate, phosphorodithioate, etc.). Therefore, the nucleotide may include a ribonucleoside such as inosine in addition to adenine, cytosine, thymine, guanine, and uracil. The nucleotide may also be one with a detectable label attached thereto. The detectable label may be an optical label, an electrical label, a radioactive label, an enzyme capable of converting the substrate into a detectable substance, a reporter and a conjugated FRET pair dye, or a substance attached thereto, or a combination thereof. The reporter can be any material commonly used in the art, including, for example, HEX, FAM, JOE, or Cy5. The substrate may be any material conventionally used in the art, including, for example, TAMRA, BHQ1, or BHQ2.

The term "nucleotide sequence" may in some cases be used interchangeably with "nucleic acid sequence", "primer", "oligonucleotide" or "polynucleotide".

The term "primer" refers to a primer that can act as a starting point for template-directed DNA synthesis in a suitable buffer at a suitable temperature (for example, four other nucleoside triphosphates and polymerization enzymes) Refers to a single strand of oligonucleotides.

Suitable lengths of the primers are typically 15-35 nucleotides, depending on various factors such as temperature and use of the primer. Short primers may generally require lower temperatures to form a sufficiently stable hybridization complex with the template. The terms "forward primer" and "reverse primer" refer to primers that bind to the 3 'and 5' ends of a constant region of a template amplified by a polymerase chain reaction, respectively.

The primers or probes may be used at a concentration of 10 to 35,10 to 30,10 to 25,10 to 24,10 to 23,10 to 22,10 to 21,10 to 20,10 to 19,10 to 18,10 to 17,10 To 16, 10 to 15, 12 to 25, 12 to 24, 12 to 23, 12 to 22, 12 to 21, 12 to 20, 12 to 19, 12 to 18, 12 to 17, 12 to 16, 12 to 15 14 to 25, 14 to 24, 14 to 23, 14 to 22, 14 to 21, 14 to 20, 14 to 19, 14 to 18, 14 to 17, 14 to 16, 14 to 15, 15 to 25, 15 To 20, 15 to 17, 17 to 25, 17 to 23, or 17 to 20 nt.

The first primer, the third primer and the fifth primer may be used as a forward primer for amplifying the target sequence. The second primer, the fourth primer, and the sixth primer may be used as a reverse primer for amplifying the target sequence. The first primer and the second primer can function as a forward primer and a reverse primer, respectively, as a pair of primers for amplifying a specific target nucleic acid. The third primer and the fourth primer may function as primer pairs for amplifying a specific target nucleic acid as a forward primer and a reverse primer, respectively. The fifth primer and the sixth primer may function as a primer pair for amplifying a specific target nucleic acid as a forward primer and a reverse primer, respectively.

The primers include restriction fragment length polymerase (RFLP), randomly amplified polymorphic DNA (APD), DNA amplification fingerprinting (DAF), arbitrarily primed PCR, sequence tagged site (EST) such as sequence characterized amplified regions, intersimple sequence repeat amplification (ISSR), amplified fragment length polymorphism (AFLP), cleaved amplified polymorphic sequence (CAPS), and single-strand conformation polymorphism (PCR-SSCP) .

In another aspect, there is provided a method of producing a primer set comprising a first primer set including the first primer and a second primer, a second primer set including the third primer and the fourth primer, a third primer set including the fifth primer and the sixth primer ≪ RTI ID = 0.0 > and / or < / RTI > The first primer set to the third primer set may be separated so as not to be mixed with each other. The primer set can detect a causative agent of a respiratory disease in the sample. Preferably, mangemia hemolytica, histolphus somalia, and mycoplasma vorbis can be detected, and more preferably, can be detected simultaneously in multiple. The composition comprising both the first primer set, the second primer set, and the third primer set may be for simultaneously detecting the causative agent of respiratory diseases.

The respiratory disease may be a respiratory disease of an animal other than a human. The animal other than human may include, for example, sheep, rabbit, pig, goat, or cattle. Preferably, cow may be included.

The composition may be one comprising the essential elements necessary for performing the PCR. The composition may, in addition to the primer set, contain an enzyme such as a test tube or other appropriate container, reaction buffer, deoxyribonucleotides (dNTPs), Taq polymerase and reverse transcriptase, DNase, RNase inhibitor, DEPC- , Or sterile water. It may also contain a primer pair specific for the gene used as a quantitative control. The composition may comprise a reagent for detecting a detectable labeling substance and a labeling substance, or may comprise a substance for dyeing the nucleotide.

Wherein the concentration of each of the primers is in the range of about 0.1 to about 0.8 M, about 0.2 to about 0.7 M, about 0.3 to about 0.6 M, about 0.3 to about 0.5 M, about 0.35 to about 0.45 M, about 0.38 to about 0.42, 4 [mu] M. The concentration of each of the probes may be about 0.1 to about 0.3 [mu] M, about 0.15 to about 0.25 [mu] M, about 0.18 to about 0.22 [mu] M, or about 0.2 [

Another aspect provides a kit for detecting Mannheimia hemolyticas comprising said first primer set. Yet another aspect provides a kit for detecting a causative agent of respiratory disease, the kit further comprising two primer sets, a third primer set, or a combination thereof. The causative agents of the respiratory diseases may be Mannheimia hemolyticus, Histophilus somni, and Mycoplasma vorbis.

The kit may be, for example, a microarray capable of detecting the target sequence of Haemia hemolyticus, Histophilus somalis, and Mycoplasma verbis. The microarray can be easily prepared by those skilled in the art according to methods known in the art using the primer set or composition described above. The microarray may be one in which the above-described primer set, a sequence complementary thereto, or a nucleic acid sequence corresponding thereto is attached to a fixed phase such as a substrate or a film. Or a probe, a binding substance or a labeling substance as described above may be attached to a fixed phase such as a substrate or a membrane. The kit may include two or more of the stationary phases. Depending on the substance attached to the stationary phase, the target sequence may be attached to the stationary phase. For example, when the labeling substance is attached to the immobilized phase, the amplified target sequence to which the binding substance is attached may be attached to the immobilized phase, and when the probe is attached to the immobilized phase, The amplified target sequence having a complementary sequence may be attached to the stationary phase.

The kit may be for amplification of the target nucleic acid by PCR and for detecting the amplification product by line blotting. The term "line blotting" refers to hybridization of a target nucleic acid and a probe in a membrane in which a polynucleotide probe such as an oligonucleotide is covalently attached in a parallel line (band shape), and the hybridization product is detected . The detection may be by a detectable label substance attached to the probe. The division of the target nucleic acid can be done by the position of the band of each probe.

Another aspect provides a method for detecting hemihymeolytics in a sample comprising the steps of:

Contacting the first primer set with a nucleic acid sample separated from the host to prepare a hybridization product;

Amplifying the target nucleic acid from the hybridization product; And

And detecting the amplified target nucleic acid sequence.

The method may further include hybridizing the amplified nucleic acid sequence with the first probe.

The hybridization product may further comprise the second primer set, the third primer set, or a combination thereof. At this time, the method may be a method for detecting a causative agent of a respiratory disease in a sample.

The hybridization product may further include the first probe, the second probe, the third probe, or a combination thereof. Also, the hybridization product may comprise a probe comprising at least 10 consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 10 as a control. The control group may include a nonspecific 16S ribosomal RNA gene sequence located at the side of a primer pair specific to Mycoplasma vorubis including SEQ ID NO: 7 and SEQ ID NO: 8.

The sample may be a biological material derived from an individual. The biological material may be a solid tissue, such as a fresh or preserved organ or tissue sample or biopsy; Blood or blood components; Positive (amniotic fluid), a plurality (peritoneal fluid), body fluids or cells such as interstitial fluid (interstitial fluid) (bod y fluid ); Cell, or a combination thereof. The sample may include a compound that is not naturally mixed with biological materials such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, and the like. Biological samples may include, for example, urine, mucus, saliva, tears, blood, plasma, serum, sputum, spinal fluid, pleural effusion, nipple aspirate, lymphatic fluid, airway fluid, intestinal fluid, genitourinary fluid, Intracranial body fluids, ascites, cystic tumor body fluids, saline fluids, rectal swabs, or a combination thereof. The nucleic acid sample may be genomic DNA extracted from body fluids or tissue sections, or purified genomic DNA collected from feces, cotton rods, and the like.

In the hybridizing step, the term "hybridization" may be used interchangeably with the term "annealing ". Hybridization means that one nucleic acid and another nucleic acid cause the formation of duplexes, triplexes, or other high-dimensional structures by base-pairing interactions. Base-pairing interactions can be base-specific base pair formation by Watson / Crick and Hoogsteen-type hydrogen bonds, such as A / T and G / C . In addition, base-stacking and hydrophobic interactions can contribute to duplex stability.

The method comprises amplifying the target nucleic acid sequence.

A target nucleic acid sequence refers to a nucleic acid targeted by DNA amplification. The target nucleic acid sequence may be provided as a template for amplification in a PCR reaction or a reverse-PCR reaction. The target nucleic acid sequence may comprise natural and synthetic molecules. The target nucleic acid may be, for example, genomic DNA or genomic RNA.

The size of the amplified target nucleic acid sequence is 40 bp to 100 bp, so that it takes a minimum amount of time to amplify and detect, and thus rapid detection is possible.

Amplification may be a known method for nucleic acid amplification. The amplification may be, for example, DNA amplification or RNA amplification. The amplification method may be one that requires thermal cycling or is performed at isothermal. The amplification may be performed using polymerase chain reaction (PCR), nucleic acid sequence-based amplification (NASBA), ligase chain reaction (LCR), strand displacement amplification : SDA), rolling circle amplification (RCA), and the like. The amplification method may also include an RNA amplification method. For example, reverse transcription (RT) or reverse transcription-PCR. Amplification may be to increase the number of copies of the target nucleic acid sequence or its complementary sequence. The PCR may be by multiplex PCR or real-time PCR.

The method comprises detecting the amplified target nucleic acid sequence.

Detecting means measuring a signal generated from a detectable marker with a detector. For example, signals selected from the group consisting of magnetic signals, electrical signals, fluorescence, Raman emission signals, scattered light signals, and radioactive signals generated from the detectable label can be measured. The detecting step may be to detect a signal originating from the detectable label labeled with the target sequence. For example, the detecting step can detect the presence of a target nucleic acid by detecting a signal generated by fluorescence resonance energy transfer (FRET). For example, the reporter and the probe are labeled at both ends of the probe, and the color of the reporter is inhibited due to the tertiary structure of the probe. When the probe binds to the amplification product and the distance between the reporter and the probe is far Or the probe nucleic acid sequence is degraded by an enzyme such as a polymerase, and the reporter substance liberated from the target may exhibit fluorescence and detect it.

The detecting step may be to detect the nucleic acid sequence amplified in real time in real time. Thus, the target nucleic acid sequence can be detected within a short time.

According to one aspect of the present invention, there is provided a primer set, a composition, a kit, and a detection method using the primer set for detecting causative agents of respiratory diseases according to the present invention. Infection can be detected separately. Therefore, the causative agent of respiratory diseases can be detected quickly with a small amount of sample.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a graph showing the detection reaction efficiency of a panel containing a primer and a probe for detection of Mannheimahemolyticus, Histophilus somalis, and Mycoplasma bovis, respectively.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  1. For the detection of causative agents primer  And Probe  design

Based on the nucleotide sequence of Mannheimia haemolytica, primer pairs (SEQ ID NO: 1 and SEQ ID NO: 2, respectively) were prepared in the forward and reverse directions, and these primer pairs corresponded to the SodA gene of Mannheimia haololytica A portion was specifically recognized and a 135 bp amplification product was generated. A probe (SEQ ID NO: 3) was designed together with the above primer pair for quantitative analysis.

Based on the nucleotide sequence of Histophilus somni, forward and reverse primer pairs (SEQ ID NO: 4 and SEQ ID NO: 5, respectively) were prepared. These primer pairs specifically amplified a part of 16S rDNA of Histophilus somni And generated amplified products of 128bp in size. A probe (SEQ ID NO: 6) was designed together with the primer pair for quantitative analysis.

Based on the nucleotide sequence of Mycoplasma bovis, primer pairs (SEQ ID NO: 7 and SEQ ID NO: 8, respectively) were prepared in the forward and reverse primers, and these primer pairs were designed to specifically amplify a portion of the uvr C gene of Maikoplasmus bovis And generated amplified products of 112 bp in size. A probe (SEQ ID NO: 9) was designed together with the primer pair for quantitative analysis.

In addition, a control group was designed together with the above primer pair and probe. The control group was located at the side of the primer pair (SEQ ID NO: 7 and SEQ ID NO: 8) specific for mycoplasma vorubin, in order to avoid recognition by the probe specific to Mycoplasma vorvis (SEQ ID NO: 9) and to minimize the cross- Lt; RTI ID = 0.0 > 16S < / RTI > ribosomal RNA gene sequence. The sequence number of the control group was designed as TCTAATTTTT TCATATCGCT AATGCTCTTG TACACACCGC CCAGTTCATT GTAGCAAAGG CCTGA (SEQ ID NO: 11).

The primer pairs and probes thus designed are shown in Table 1 below.

Causative agent Primer or probe Sequences (5 '-> 3') Man Haymia Hemolitica
Man306 (forward direction) AGCAGCGACTACTCGTGTTGGTTCAG (SEQ ID NO: 1) Man449 (reverse direction) AAGACTAAAATCGGATAGCCTGAAACGCCTG (SEQ ID NO: 2) Man probe (JOE / BHQ) AAGAGGGTAAATTAGCCGTTGTTTCAACCG (SEQ ID NO: 3) Histopilus Somoni
Som416 (forward direction) GAAGGCGATTAGTTTAAGAG (SEQ ID NO: 4) Som543 (reverse direction) CCCTTTACGCCCAGTCATT (SEQ ID NO: 5) Som probe (Cy5 / BHQ) ACGATAATCACAGAAGAAGCACCGGCTAAC (SEQ ID NO: 6) Maiko Plasma Vovis
F2024 (forward) TCTAATTTTTTCATCATCGCTAATGC (SEQ ID NO: 7) R2135 (reverse direction) TCAGGCCTTTGCTACAATGAAC (SEQ ID NO: 8) Mbov probe (FAM / MGB) AACTGCATCATATCACACTACT (SEQ ID NO: 9) Control group MbovIC probe (NED / MGB) CTTGTACACACCGCCCAGTTC (SEQ ID NO: 10) Whole sequence TCTAATTTTT TCATATCGCT AATGCTCTTG TACACACCGC CCAGTTCATT GTAGCAAAGG CCTGA (SEQ ID NO: 11)

Example  2. DNA isolation and PCR

Actinobacillus lignieresii, Actinobacillus suis, Actinobacillus pleuropneumoniae, Arcanobacterium pyogenes, and the like, which are isolated from clinical specimens, Bacillus cereus, Clostridium perfringens, Corynebacterium pseudotuberculosis, Enterobacter spp., Enterococcus faecalis, Enterococcus faecalis, Bacillus cereus, But are not limited to, Escherichia coli, Klebsiella pneumoniae, Mannheimia glucosida, Mannheimia granulomatis, Mannheimia ruminicola ), Mannheimia varigena, Morganella morganii, Mycoplasma influenzae Mycoplasma hyorhinis, Mycoplasma hyopneumoniae, Proteus spp., Pseudomonas aeruginosa, Serratia marcescens, Staphylococcus aureus, Staphylococcus aureus, coagulase-negative Staphylococcus spp., Streptococcus agalactiae, Streptococcus dysgalactiae, Streptococcus uberis, ), And group G Streptococcus were used to perform qPCR to evaluate the specificity.

DNA of the above causal organisms was extracted as follows.

Use MagMAX ™ Total Nucleic Acid Isolation Kit ( Applied Biosystems, Austin, TX) and ^{KingFisher ® 96 magnetic particle processor (Thermo} Fisher Scientific Inc., Waltham, MA) was extracted with viral or bacterial nucleic acid. Specifically, 175 [mu] l of lung homogenate, virus suspension or bacterial culture was added to bead tubes containing 235 [mu] l of lysis / binding solution and shred for 15 minutes. After centrifugation at 16,000 xg for 6 minutes, 115 l of the mixture supernatant was transferred to a clean 96-well plate containing 65 l of isopropanol and 20 l of bead mixture. After shaking the plate for 5 minutes, the supernatant was discarded and the remaining beads were washed twice. After discarding the wash solution, 50 [mu] l of elution buffer at 65 [deg.] C was added to each well. The final concentrations of virus suspension or bacterial culture were 75 to 250 占 퐂 / ml or 10 to 33 占 퐂 / ml, respectively. All extraction procedures included nine positive controls. Using the ^{QIAamp ® DNA Blood Mini Kit (Qiagen} Inc., Valencia, CA) for comparison in selected samples was performed to extract. The extracted nucleic acids were stored at -80 ° C until used in the next test.

The primer pairs and probes designed in Table 1 were subjected to PCR for the extracted nucleic acids. PCR amplification was performed on an ABI7500 Fast Real-Time PCR system (Applied Biosystems). The PCR conditions were 0.4 μM for the primers and 0.2 μM for the probes. The PCR reaction conditions were as follows: initial activation at 95 ° C. for 15 minutes, 35 cycles (95 ° C. for 15 seconds and 60 ° C. for 90 seconds) Respectively. PCR was positive when the threshold cycle (Ct) was 35 or less.

The prepared primer pairs and probes did not react with only the other causative agents other than Haymiehmolitica, Histophilus somnidis, and Mycoplasma bovis, respectively. Each primer pair and probe detected only the causative agents for detection as shown in Table 1.

Example 3. Sensitivity test

In order to examine the sensitivity of the primers and probes prepared in Example 1, CFU (colony-forming units) of suspensions were measured for each target bacteria. Colony counts were performed for each agent suspension using standard plate counting techniques. Specifically, a 10-fold dilution of 10 ^-1 to 10 ^-7 was first made in sterile saline. Two agar plates (BD Biosciences, Sparks, MD) were prepared for each bacterium and each plate was divided into four zones. 10 [mu] l of each dilution of each bacterial was inoculated into each section of the plate. A dilution of 50 CFU / 10 μl or less was selected for the assay sensitivity test for each bacteria. All plates were incubated at 37 ° C until colonies were formed and the CFU of each section was recorded.

The analytical sensitivity was assessed as a single flex analysis (qPCR for each target) on a bacterial suspension with a series of CFU per 1 또는 or three times as mqPCR panel. The response fidelity between dilution and total detection efficacy was compared between single and multiplex.

Using the QIAamp ^® DNA Blood Mini Kit (Applied Biosystems) and MagMAX ™ Total Nucleic Acid Isolation Kit (Thermo Fisher Scientific) to ensure that the sensitivity of bacteria PCR analysis remains the same regardless of the extraction process, and a single for each target Test was performed with qPCR. The Ct values between the two extraction steps of the sample were compared.

Analysis specificity was assessed by three repeated iterations of the lack of cross reactivity between individual qPCR assays except for the intended assay target. All qPCRs were performed on an additional 27 bacterial species in order to determine the specificity of recognition.

Based on the Ct value for each concentration, the reaction efficiency was confirmed by a calibration curve as shown in Fig. The slopes of the graph of FIG. 1 showing the analytical efficiency of Mannheimia mololytica, histophilus somnoni, and mycoplasma vorbis are -3.17, -3.18, and -3.77, respectively, and the coefficient of determination (R ² ) Were 0.99, 0.99, and 0.98, respectively.

The analytical sensitivity (detection limit) of qPCR was determined with CFU per ml of bacterial suspension. As shown in Table 2, the detection limits of qPCR for each target organism were 120 CFU / ml, 400 CFU / ml and 170 CFU / ml, respectively, for Mannheimahemolyticus, Histophilus somalis, and Mycoplasma vorbis Respectively. In addition, when the multiple test results and the single test results were compared, the Ct value was only about 1 difference, and the detection limit was almost similar.

Causative agent
Detection limit (Ct) Single check Multiple inspection unit Man Hayimia Hemolaytica 120 (34) 120 (35) CFU / ml Histopilus Somoni 400 (33) 400 (34) Maiko Plasma Vovis 170 (33) 170 (34)

Example 4. Comparison of multiple real-time PCR assays and culture methods

In order to compare the detection results of multi-real-time PCR using primers and probes prepared in Example 1 and conventional culture methods for detection of causative agents of respiratory diseases in animals, the following experiments were conducted.

Bacteria were incubated in an incubator under aerobic or anaerobic conditions until colonies were observed at 35 ° C using medium (Trypticase soy agar with 5% sheep blood and MacConkey agar) to conduct the culture. For bacterial identification, colonies cultured on all plates were further analyzed with Gram stain and API identification system (bioMerieux, Durham, NC).

Multiple real-time PCR was performed according to the method of Example 2.3 described above.

The results of the culture method and the multi-real-time PCR, which are the conventional diagnostic methods, are recorded as positive or negative in Table 3.

When more than half of more positive samples were detected compared to the culture method, when the hemihymaolyticase was detected only by multiple real-time PCR. In the case of histolophyllous somalia, 31 positive samples were detected by multiplex real-time PCR as compared to the culture method. Finally, 26 positive samples were detected by multi-real-time PCR in comparison with the culture method for Mycoplasma v. Vivo. When the causative agent was detected by multiple real-time PCR and when the bacterial culture method was compared, manganese hemolytica, histophilus somalis, and mycoplasma vorbis were 84% (156/186; κ = 0.680), 83% (156/187; kappa = 0.449) and 82% (119/145; kappa = 0.642).

Causative agent Multiple real-time PCR % Match rate
(κ value) positivity voice all Man Haymia Hemolitica positivity 66 0 66 84%
(? = 0.680) voice 30 90 120 Histopilus Somoni positivity 17 0 17 83%
(? = 0.449) voice 31 139 170 Maiko Plasma Vovis positivity 72 0 72 82%
(? = 0.642) voice 26 47 73

<110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> Composition for detecting pathogens of respiratory disease, and          using the same <130> PN117579 <160> 11 <170> KoPatentin 3.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Man306 primer <400> 1 agcagcgact actcgtgttg gttcag 26 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Man449 primer <400> 2 aagactaaaa tcggatagcc tgaaacgcct g 31 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Man probe <400> 3 aagagggtaa attagccgtt gtttcaaccg 30 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Som416 primer <400> 4 gaaggcgatt agtttaagag 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Som543 primer <400> 5 ccctttacgc ccagtcatt 19 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Som probe <400> 6 acgataatca cagaagaagc accggctaac 30 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> F2024 primer <400> 7 tctaattttt tcatcatcgc taatgc 26 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> R2135 primer <400> 8 tcaggccttt gctacaatga ac 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Mbov probe <400> 9 aactgcatca tatcacatac t 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MbovIC probe <400> 10 cttgtacaca ccgcccagtt c 21 <210> 11 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> Internal control sequence <400> 11 tctaattttt tcatatcgct aatgctcttg tacacaccgc ccagttcatt gtagcaaagg 60 cctga 65

Claims (14)

SEQ ID NO: 4 A third primer comprising at least 10 consecutive nucleotide sequences selected from a nucleotide sequence; And
A second primer set comprising a fourth primer comprising a sequence of at least 10 consecutive nucleotides selected from the nucleotide sequence of SEQ ID NO: 5, wherein the second primer set is capable of detecting Histophilus somni &Lt; / RTI &gt;
The method according to claim 1,
Wherein the composition further comprises a second probe comprising at least 10 contiguous nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 6.
delete The composition of claim 1; And
A third primer set comprising a fifth primer comprising 10 or more consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 7 and a sixth primer comprising 10 or more consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: Wherein the third primer set is for detecting Mycoplasma bovis.
The method of claim 4,
Wherein the third set of primers further comprises a third probe comprising at least 10 contiguous nucleotide sequences selected from the nucleotide sequence of SEQ ID NO:
delete A kit for detecting a histoluminescent sombody comprising a second primer set of claim 1.
A second primer set of claim 1; And a third primer set of claim 4, wherein the causative agent of the respiratory disease is histophilus somalis, or mycoplasma bovis.
Contacting the second primer set of claim 1 with a nucleic acid sample separated from the subject to prepare a hybridization product;
Amplifying the target nucleic acid from the hybridization product; And
And detecting the amplified target nucleic acid sequence. &Lt; RTI ID = 0.0 &gt; 8. &lt; / RTI &gt;
A second primer set of claim 1; Contacting the third primer set of claim 4 with a nucleic acid sample separated from the subject to prepare a hybridization product;
Amplifying the target nucleic acid from the hybridization product; And
A method for detecting a causative agent of respiratory disease in a sample, comprising the step of detecting an amplified target nucleic acid sequence, wherein the causative agent of the respiratory disease is histophyllous somalia, or mycoplasma bovis.
The method of claim 10,
Wherein the hybridization product further comprises the third probe of claim 5.
The method of claim 10,
Wherein the hybridization product comprises a probe comprising at least 10 consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 10 as a control.
The method of any one of claims 10 to 12, wherein the amplification is performed using polymerase chain reaction (PCR), nucleic acid sequence-based amplification (NASBA), ligase chain reaction : LCR), strand displacement amplification (SDA), and rolling circle amplification (RCA).
14. The method of claim 13,
Wherein the polymerase chain reaction is by reverse transcription (RT) -PCR, or multiplex PCR, real-time PCR.

Images