CN107502681A - A kind of quick real-time fluorescence RT PCR detection kits of A group rotavirus - Google Patents
A kind of quick real-time fluorescence RT PCR detection kits of A group rotavirus Download PDFInfo
- Publication number
- CN107502681A CN107502681A CN201710945356.6A CN201710945356A CN107502681A CN 107502681 A CN107502681 A CN 107502681A CN 201710945356 A CN201710945356 A CN 201710945356A CN 107502681 A CN107502681 A CN 107502681A
- Authority
- CN
- China
- Prior art keywords
- pcr
- group
- quick
- rotavirus
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention discloses a kind of quick real-time fluorescence RT PCR detection kits of A group rotavirus, including amplimer：Forward primer：5 ' gttgatgctcaagatggagt 3 ' and reverse primer：5 ' acttcattgtaatcatattgaatacc 3 ', in addition to specificity fluorescent probe：5'‑X‑cagcaacaactgcagcttcaaaagaagtgt‑Y‑3'.Kit of the present invention disclosure satisfy that the ageing requirement in being detected for A group rotavirus, pass through the design to primer, probe, reaction condition in reaction system, and heat-resistant dna rapid polymerization enzyme is used, with reference to one-step method fluorescence RT round pcrs, reach purpose that is quick, real-time, quantitatively detecting A group rotavirus, sensitivity can reach 102PFU/ml。
Description
Technical field
The present invention relates to molecular diagnostic techniques field, and in particular to a kind of quick real-time fluorescence RT-PCR of A group rotavirus
Detection kit.
Background technology
Rotavirus is most common a kind of pathogen in viral enteritis.1973, Australian scholar Bishop
Found first Deng in the ultra-thin section of acute non-bacterial enterogastritis children's duodenal mucosa, it was named as wheel in 1974 years
Shape virus.(White GB,Ashton CI,Roberts C,Parry HE.1974.Letter:"Rotavirus"in
gastroenteritis.Lancet.2(7882):726；Bryden AS,Davies HA,Hadley RE,Flewett
TH..1975.Rotavirus enteritis in the West Midlands during 1974.Lancet.2(7928):
241-3.) this cause of disease can trigger inoculation animal that respiratory tract infection occurs, and can be separated in self-infection animal body.
Rotavirus Reoviridae, it is ball-type, the diplornavirus for having wide cap, short width and featheredge.It is average straight
Footpath 70nm or so, virion center be 36~45nm of diameter dense-core, qiagen rnase.Rotavirus gene contains 11
Section.The molecular weight of 11 sections is in 0.2-2.2 × 106MDa scopes, total molecular weight about 10-14 × 106MDa.In all viruses
The genome of rotavirus is divided into 11 fragments, total length about 18550bp only, therefore can directly be reflected with polyacrylamide gel
It is fixed.Each fragment contains an open reading frame, is separately encoded 6 structural proteins (VP1, VP2, VP3, VP4, VP6, VP7) and 5
Individual non-structural protein (NSP1-NSP5).According to difference on gene structure and group antigen, RV can at least divide A, B, C, D, E, F (G) 6
(7) individual different group.(Chanock SJ,Wenske EA,Fields BN.1983.Human rotaviruses and
genome RNA.J Infect Dis.148(1):49-50；Konno T.1987.Antigen detection with
monoclonal antibodies.Rinsho Byori.35(5):535-8；Desselberger U,McCrae
MA.1994.The rotavirus genome.Curr Top Microbiol Immunol.185:31-66.Prasad BV,
Chiu W.1994.Structure of rotavirus.Curr Top Microbiol Immunol.185:9-29.)。
Rotavirus is distributed all over the world, and A, B, C group rotavirus can cause human and animal to suffer from diarrhoea, D-G groups
Only cause animal diarrhea.Most study is A group rotavirus, and harmfulness is maximum, well-known to infect infant on a large scale, has
The annual case load of developing country is reported more than 1.3 hundred million, and death toll is more than 870,000.This group virus is according in its surface
14 G serotypes and 19 P serotypes, the wherein serum of Major Epidemic can be divided with antigen VP7 (glycoprotein) or VP4 (hemagglutinin)
Type is G1P8, G2P4, G3P8 and G4P8, and more than 80% is accounted in all medical cases.B group rotavirus (abdomen of being also referred to as grown up
Rush down rotavirus) it can then cause the outbreak of epidemic of between twenty and fifty gastroenteritis.Older children and adult are often in symptomless infection, commonly referred to as
Virus carrier.The infection sources is patient and asymptomatic carrier, and the virion discharged in every gram of excrement of patient is up to 1010It is individual.Nothing
Have the higher incidence of disease by flourishing or developing country, diarrhoea caused by A groups RV, be infant's morbidity with it is lethal important
The cause of disease.It is the lethal second cause of disease for being only second to respiratory tract infection of infant in developing country.Excrement-mouth is that RV is propagated
Main path, pollution of waterhead in addition, respiratory tract air borne, it can be made with close contact of the nursery schools and childcare centres in one's power in kinsfolk in institute
Into prevalence, somebody speculates that animal infects the RV important infection sources probably as people.In mucous membrane of small intestine after Virus entry human body
Villus cell internal breeding, virus capsid protein VP4 are major virulent factor, and it causes cell dissolving dead, microvillus atrophy, becomes
It is short, come off；The hyperplasia of gland nest, secretion increase, and cause severe diarrhea, the forfeiture of water and electrolyte.The incubation period of virus only has
One to two days, then fever, watery diarrhea, vomiting dehydration suddenly, can recover completely with autoimmunity.But when infant nutrition is bad
Or be dehydrated, if treating not in time, it may result in baby death.Because virus variation itself is larger, specific aim vaccine is difficult to
Industrialization is realized, the World Health Organization (WHO) recommends to aim at prevention, and pay attention to infant nutrient and sanitary condition reduces to reach
The infection rate of virus.(Hamilton JR.1985.Treatment of acute diarrhea.Pediatr Clin North
Am.32(2):419-27.Diggle L.2007.Rotavirus diarrhoea and future prospects for
prevention.Br J Nurs.16(16):970-4.Posfay-Barbe KM,Zerr DM,Pittet
D.2008.Infection control in paediatrics.Lancet Infect Dis.8(1):19-31)。
The method of traditional detection RV infection depends on Electronic Speculum (EM) or immunologic assay, such as Enzyme-linked Immunosorbent Assay
(ELISA) etc..Now it is described below:
1. electron microscopic observation：Sometimes immuno-electron microscope and ultra-thin section electron microscopy are also used, effect of this method in diagnosis is by height
Degree evaluation, but due to by equipment limit, it is more difficult to promote.
2. Enzyme immunoassay is tested：Double sandwich methods (double sandwich method) are presently the most conventional detection
This method is classified as diagnosis RV standard method by method, WHO, all has Related product list marketing, but this quick inspection both at home and abroad
The sensitivity of survey method has bigger shortcoming.
3.PAGE methods：RV contents in excrement are up to 1010Virion/gram, therefore can from excrement directly extract dsRNA,
Its degraded to RNase has strong resistance, and other enterovirus will not enter for detecting RV in excrement in addition
DsRNA polyacrylamide gel, the dsRNA of extraction separate through 10%PAGE, EB and AgNO3After dyeing, it is distinctive that RV is presented
11 bands, this method are sensitive, specifically accurately and reliably, in diagnosis RV infection, determine epizootic modeling viral species, virus drift and transformation and
Gene rearrangement analysis etc. has important reference value.
In recent years with the development of molecular genetics etc., more special and sensitive detection method is established, as RNA nucleic acid is miscellaneous
Hand over, RT-PCR etc. is used for the method for detecting nucleic acid.Nucleic acid probe hybridization is that viral dsRNA is extracted from sample, in the solution or
On solid support (such as NC films or nylon membrane), DNA the or RNA probe for the P2 marks being complementary to are hybridized, and are passed through
The probe of detection mark has seen whether positive hybridization reaction, and the sensitiveness of hybridization is directly proportional to the length of probe sequences.And
Reverse transcriptase chain reaction (RT-PCR) method is the conserved sequence for gene, synthesizes two primers, will extract mRNA
One-step method carries out amplification in vitro, plus being used cooperatively for specificity fluorescent probe, can confirm RV presence immediately.Due to the method
Operation is simple, and accurate sensitive, suitable for commercial kit.The kit of this method exploitation at present, reverse transcription
2 hours are at least needed to PCR detections are completed, but A group rotavirus the infecteds are based on outpatient, and it is anxious to fall ill, therefore
Urgent need exploitation is a kind of can be with the product of the A group rotavirus nucleic acid in quick detection sample.
The content of the invention
The present invention is in view of the shortcomings of the prior art, provide a kind of kit of quick detection A group rotavirus nucleic acid, especially
It is to be related to the kit of one-step method quick real-time fluorescence RT-PCR technology early stage, the infection of quick diagnosis A group rotavirus.This examination
Agent box can detect the A group rotavirus in fecal sample in 30 minutes.
It is an object of the invention to provide one kind to use A groups in the quick real-time fluorescence RT-PCR technology for detection sample of one-step method to take turns
The kit of shape virus, more particularly to application of the early infection in hospital's Emergency call of A group rotavirus.Its general principle
It is the specific probe of specific primer using a pair of oligonucleotides and an oligonucleotide, is including reverse transcriptase, resistance to
Hot DNA rapid polymerizations enzyme, RNase inhibitor (RNasin), the deoxyribonucleoside triphosphate (dNTPs) and Mg of high quality2+
In RT-PCR reaction solutions etc. component, the circulation for realizing target polynucleotide by commercially available very fast real-time fluorescence quantitative PCR instrument is expanded
Increase, so as to reach purpose that is quick, real-time, quantitatively detecting target polynucleotide.
In order to realize the present invention, following technical scheme is employed：
1) homology ratio is carried out to the nucleotide sequence of known A group rotavirus respectively using appropriate foranalysis of nucleic acids software
Compared with the basis of homology segment is found out, further using appropriate primer-design software (such as Primer Express 2)
Select simultaneously design oligonucleotides primer and probe.A group rotavirus is complementary to because designed primer and probe is respectively provided with
Sequence, and there is no homology with the nucleotide sequence of other pathogens, also do not include the enzyme of any common endonuclease
Enzyme site, so avoiding the false negative and false positive of A group rotavirus detection, improve reliability and the degree of accuracy of detection.
2) using the required Oligonucleolide primers of DNA synthesizers synthesis, with molecular sieve and fast protein liquid chromatography
Method (FPLC) carries out ammonolysis processing after purification.Probe sequence needed for same synthesis, respectively in its 5 ' end mark after ammonolysis processing
The 6-FAM amidite of group (reporter group) occur as fluorescence, and in its 3 ' end mark by the coupling of active linking arm
BHQ1 as fluorescent quenching group.With the probe of HPLC purification by chromatography fluorescence labelings.Then, using poly- under Denaturing
Primer and probe synthesized by acrylamide gel (20%) electrophoresis and AAS physical characterization.
(3) reaction system and fluorescent detection system for being suitable for quick RT-PCR amplifications are established.Nucleic acid amplification reaction system
Including reverse transcriptase, heat-resistant dna rapid polymerization enzyme, 2 '-deoxynucleoside triphosphate, can be with the first of double-strand target polynucleotide
The forward primer of bar chain combination, can with the reverse primer of the Article 2 chain combination of double-strand target polynucleotide, can be more with target
Polynucleotide combines and two ends are respectively in connection with having fluorescence that the oligonucleotide probe of group and fluorescent quenching group occurs, contain
The buffer solution of magnesium ion.Wherein heat-resistant dna rapid polymerization enzyme needs to reach the extension speed of more than twice of common taq enzymes, positive
Primer, reverse primer, the concentration of oligonucleotide probe are required to be adjusted, to reach the mesh for reducing annealing and extension of time
's.
(4) RNA is extracted from sample to be tested, adds in foregoing reaction system, is directly expanded through One step RT-PCR, from
Fluorescent amplification curve judges whether A group rotavirus genes.
The quick real-time fluorescent RT-PCR detection reagent box of A group rotavirus of the present invention, including amplimer and spy
Anisotropic fluorescent probe, the sequence of amplimer and the specificity fluorescent probe are as follows：
Forward primer：5 '-GTTGATGCTCAAGATGGAGT-3 ', SEQ ID NO:1；
Reverse primer：5 '-ACTTCATTGTAATCATATTGAATACC-3 ', SEQ ID NO:2；
Specificity fluorescent probe：5'-X-CAGCAACAACTGCAGCTTCAAAAGAAGTGT-Y-3', SEQ ID NO：3, wherein X
Represent that group occurs for fluorescence, Y represents fluorescent quenching group.It is 6-FAM amidite, HEX or Cy5 that group, which occurs, for the fluorescence,
The fluorescent quenching group is BHQ1.
Yet other embodiments, forward primer：Reverse primer：The mol ratio of specificity fluorescent probe is 2：
2：1.It is preferred that the primer dosage is 10pmol/ reactions, probe dosage is 5pmol/ reactions.
Kit (the letter below of the quick real-time fluorescence RT-PCR detection A group rotavirus of one-step method provided by the present invention
Express one's gratification fast PCR kit), including quick RT-PCR reaction solutions, negative quality-control product and positive quality control product.Specifically, including：
(1) quick RT-PCR reaction solutions, negative quality-control product, positive quality control product and the multiple reagent bottles or pipe sealed are respectively provided with,
(2) separate and concentrate the packing box for packing these reagent bottles or pipe.
Yet other embodiments, wherein quick RT-PCR reaction solutions include RT-PCR buffer solutions, quick RT-
PCR reactions enzyme system, forward primer, reverse primer, oligonucleotide probe, DEPC water.
Yet other embodiments, wherein RT-PCR buffer solutions include 0.1mmol/L dNTPs, pH8.0,
10mmol/L Tris-HCl、150mmol/L KCl、2.0mmol/L MgCl2。
Presently preferred embodiment, wherein quick RT-PCR reaction enzyme systems include reverse transcriptase mMLV, resistance to
Hot DNA rapid polymerizations enzyme and RNase inhibitor (RNasin), preferably reverse transcriptase dosage are that 40U/ reacts, heat-resistant dna quickly gathers
Synthase dosage is 2.5U/ reactions, RNasin dosages are 20U/ reactions.Preferably, heat-resistant dna rapid polymerization enzyme selects
SpeedSTAR HS DNA Polymerase (TAKARA, article No. RR070A).
Presently preferred embodiment, wherein the pure water handled through the fat (DEPC) of coke acid second two is used for virus
Nucleic acid dissolves or the preparation without RNase related reagents.
Negative quality-control product in one-step method kit of the present invention is through the pure of the fat (DEPC) of coke acid second two processing
Water, positive quality control product are that A group rotavirus inactivates positive sample, and concentration is 1 × 104CFU/ml, for the matter in actually detected
Amount control.
Another preferred embodiment of the present invention, wherein being for the reaction temperature of PCR amplifications and time：50 DEG C of reverses
Record 5min, 1 circulation；95 DEG C of 8s, 1 circulation；Last 95 DEG C of 7s, 55~60 DEG C of 14s, 40 circulations (collection fluorescence signal).
Another preferred embodiment of the present invention, wherein being added to after quick RT-PCR reaction solutions and sample nucleic acid mixing
In commercially available micro-fluidic chip plate.
Fast PCR kit provided by the invention, is detected, this method comprises the following steps to rotavirus：
(1) RNA that positive and negative quality-control product and sample to be tested (predominantly excrement) are carried out with RNA extracts reagents is extracted.RNA is extracted
Reagent can also use other ripe RNA extraction methods and kit in addition to the method that the present invention refers to.
(2) RNA of extraction is added in the RT-PCR reaction tubes containing quick RT-PCR reaction solutions, carries out RT-PCR expansions
Increase, detected using commercially available very fast real-time fluorescent quantitative PCR detector.
Fast PCR kit of the present invention is for the ageing requirement in the detection of A group rotavirus, to reaction system
Middle primed probe concentration, annealing and extension of time etc. are targetedly designed, and have used heat-resistant dna rapid polymerization
Enzyme, with reference to one-step method fluorescent RT-PCR technology, for the detection of nucleic acids of A group rotavirus, sensitivity can reach 102PFU/ml。
The quick detection of the A group rotavirus RNA in the infected's excreta was completed in 30 minutes, compensate for existing real-time fluorescence RT-
The defects of PCR kit detection time is long.In China, what the autumn and winter had a common boundary the have often report that A group rotavirus is wreaked havoc, therefore
The research work that China carries out in terms of the early diagnosis and prognosis of A group rotavirus is very necessary, kit pair of the present invention
It is rapid to understand patient's degree, it is of great significance in terms of prediction, evaluation therapeutic effect.
Beneficial effects of the present invention：
The present invention compared with prior art, has following advantages：
(1) detection speed is very fast, and whole process is no more than 30 minutes, greatlys save detection time；
(2) quick RT-PCR reactions enzyme system has been mixed in quick RT-PCR reaction solutions in advance, anti-without preparing after extracting viral RNA
Liquid is answered, can directly carry out RT-PCR detections, it is simple to operate, it is easy to batch samples to detect, is advantageous to industrialization.
(3) during whole PCR reactions and fluorescent collecting, micro-fluidic chip plate is completely enclosed with clip, is not in
The situation that PCR amplification lid pop, avoids pollution；
(4) specificity is stronger, and sensitivity is higher.
Brief description of the drawings
Fig. 1 is the PCR condition settings that kit of the present invention detects A group rotavirus.
Fig. 2 is positive quality control product amplification curve.
Fig. 3 is negative quality-control product amplification curve.
Fig. 4 is the amplification curve of various concentrations sample when fast PCR kit detects A group rotavirus.
Fig. 5 is the amplification curve of three ' negative ' specimens of fast PCR kit.
Fig. 6 is the amplification curve of the primed probe using common fluorescent quantitative PCR in fast PCR reaction system.
Fig. 7 is the amplification curve of the primed probe concentration using common fluorescent quantitative PCR in fast PCR reaction system.
Fig. 8 is amplification curve of the A group rotavirus positive sample using 4 kinds of enzyme systems.
Fig. 9 is that A group rotavirus positive sample uses kit of the present invention and common fluorescent quantitative PCR reaction condition
Amplification curve.
Embodiment
Used term in the present invention, unless otherwise indicated, typically there are those of ordinary skill in the art generally to manage
The implication of solution.
The present invention is described in further detail with reference to specific embodiment and with reference to data.It should be understood that the embodiment is
In order to demonstrate the invention, rather than the scope that limit the invention in any way.
In the examples below, the various processes and method not being described in detail are conventional methods as known in the art.Under
Material used in example, reagent, device, instrument, equipment etc. are stated, unless otherwise specified, is commercially obtained.
With reference to specific embodiment, the present invention is further described.
Embodiment 1：The preparation and optimization of the quick real-time fluorescent RT-PCR detection reagent box of A group rotavirus of the present invention
1st, the design of primer and probe：By to having reported that the nucleotide sequence of A group rotavirus carries out sequence alignment analysis, selection
Without secondary structure and highly conserved section, the basic principle designed according to primed probe is multipair using software and engineer
Primer and probe.
2nd, the selection of clinical sample：Shown according to domestic and international pertinent literature report, select fecal sample.
3rd, the foundation and optimization of reaction system
The screening of primed probe：With the multigroup primed probe designed in above-mentioned 1 detect respectively above-mentioned positive quality control product with it is negative
The RNA of quality-control product, through repetition test, filter out specificity, sensitivity and reproducible optimal primer combination of probe.It is (positive
Primer sequence such as SEQ ID NO:Shown in 1, reverse primer sequences such as SEQ ID NO:Shown in 2, specificity fluorescent probe sequence is such as
SEQ ID NO:Shown in 3.
The optimization of primed probe concentration：In the case that other components are constant in reaction system, to realize that PCR is quickly examined
Survey, it is necessary to higher primed probe concentration, use respectively reacted from 2pmol/ to the primer of 15pmol/ reaction gradients and from
2pmol/, which is reacted to the probe of 15pmol/ reaction density gradients, enters performing PCR reaction, and optimal primer is found through experiment is repeated several times
Concentration is 10pmol/ reactions, concentration and probe concentration is 5pmol/ reactions.
The optimization of magnesium ion concentration：In the case that other components are constant in reaction system, use respectively from 1mmol/L to
The magnesium ion of 2.5mmol/L concentration gradients enters performing PCR reaction, is tested through being repeated several times, finally determines optimal magnesium ion concentration
For 2.0mmol/L.
The optimization of heat-resistant dna rapid polymerization enzyme dosage：In the case that other components are constant in 8 μ L reaction systems, respectively
Reacted into performing PCR using the enzyme dosage from 1U (enzyme unit) to 4U concentration gradients/react, tested through being repeated several times, it is final to determine
Optimal heat-resistant dna rapid polymerization enzyme dosage reacts for 2.5U/.
The optimization of reverse transcriptase dosage：In the case that other components are constant in 8 μ L reaction systems, use respectively from 10U
(enzyme unit) reacts to the enzyme dosage/react of 80U concentration gradients into performing PCR, is tested through being repeated several times, finally determines optimal RT
Enzyme dosage reacts for 40U/.
The optimization of RNasin dosages：In the case that other components are constant in 8 μ L reaction systems, use respectively from 5U (enzymes
Unit) reacted to the enzyme dosage/react of 40U concentration gradients into performing PCR, tested through being repeated several times, it is final determine it is optimal
RNasin dosages are reacted for 20U/.
The optimization of dNTPs concentration：In the case that other components are constant in reaction system, use respectively from 0.05mmol/L
DNTPs to 0.2mmol/L concentration gradients enters performing PCR reaction, is tested through being repeated several times, finally determines optimal dNTPs concentration
For 0.1mmol/L.
The optimization of reaction temperature：According to the activity of enzyme and the length of target polynucleotide, and combine wanting for fast PCR reaction
Ask, mainly annealing temperature and extension of time be optimized, through be repeated several times test, finally determine optimal reaction temperature and
Time is：50 DEG C of reverse transcription 5min, 1 circulation；95 DEG C of 8s, 1 circulation；Last 95 DEG C of 7s, 55~60 DEG C of 14s, 40 circulations
(collection fluorescence signal).
Embodiment 2：Use the detection side of the quick real-time fluorescent RT-PCR detection reagent box of A group rotavirus of the present invention
Method
1st, collection of specimens, transport and preservation
By sample to be checked, water sample rushes down shape thing and takes 500-1000 μ l, loads sterile 1.5ml centrifuge tubes, can directly censorship or in -20 DEG C
Preserve, storage life does not exceed six months.Transported with dry ice sealing, avoid freeze thawing.
2nd, nucleic acid extraction
Take 200ul water samples to rush down shape thing to add in 1.5ml centrifuge tubes, after being fully vortexed, 5000rpm centrifugation 30s, take 50ul supernatants
5ul lysates are added, lysate is by 0.5% (w/v) sodium N-lauroyl sarcosinate, 200mmol/L dithiothreitol (DTT)s, TE
(pH7.4) form, 95 DEG C of incubation 2min, 3min is centrifuged under the conditions of 12,000rpm, collects supernatant, can be directly used for PCR detections
Or it is temporarily stored into -20 DEG C.If preserving more than one month, -70 DEG C can be stored in.
3rd, RT-PCR is detected
1) system is prepared
The quick μ l of RT-PCR reaction solutions 7 are taken to dispense into PCR reaction tubes respectively.System can be temporarily stored into -20 DEG C one week.
2) it is loaded
The extract of 3 μ l measuring samples (or yin and yang attribute quality-control product) is separately added into PCR reaction tubes to mix, takes 8 μ l to move to PCR expansions
Increase in chip (the sincere bio tech ltd's productions of Nanjing Mei Ningkang), cover chip lid, PCR amplification chips are inserted
Augmentation detection is carried out in Mokobio UltraFast LabChip Real-time PCR V280.
Amplification program is set (see accompanying drawing 1)
Fluorescence signal selects FAM passages, preserves file, operation.
4th, interpretation of result
A) after experiment terminates, analyzed according to the software of pertinent instruments, adjust more than noise margin to baseline noise, make feminine gender
Control Ct values occur without any numerical value.
B) threshold value setting principle is just above the highest of normal negative control curve (random noise line) with threshold line
Point is defined.
C) register instrument automatically analyzes the sample Ct values calculated.
5th, result judgement
If the amplification curve of sample is not S-type, result is feminine gender；If the amplification curve of sample is S-type, result is sun
Property.
Embodiment 3：Quality-control product makes in the quick real-time fluorescent RT-PCR detection reagent box of A group rotavirus of the present invention
With
Quality-control product includes positive quality control product and negative quality-control product in rotavirus fast PCR kit, for matter in clinical test
Amount control, operating method are shown in embodiment 2 with sample to be checked.
As a result it is as follows：
Positive quality control product amplification curve is S-type and Ct value≤33, sees accompanying drawing 2, it is illustrated that amplification curve is S type curves, illustrates detection
System has effectively expanded A group rotavirus nucleic acid.
Negative quality-control product amplification curve is not S-type, sees accompanying drawing 3, it is illustrated that amplification curve is more straight broken line, is examined with fluorescence
Surveying threshold line does not have intersection point, and curve is not S-type, illustrates do not have the pollution of A group rotavirus nucleic acid in detection process.；
Requirements above must meet that otherwise, it is invalid that this experiment is regarded as, and need to re-start simultaneously in once experiment.
Embodiment 4：The quick real-time fluorescent RT-PCR detection reagent box of A group rotavirus of the present invention is to A groups colyliform disease
Malicious sample is detected
The A group rotavirus positive sample and 3 A group rotavirus negative samples of 3 various concentrations are taken respectively, according to embodiment
2 method detects this 6 parts of samples respectively, and as shown in Figure 4,3 differences are dense in figure for A group rotavirus positive samples testing result
The A group rotavirus positive samples amplification curve of degree is S-shaped, be can determine that as the positive.3 A group rotavirus negative samples
As shown in Figure 5, the amplification curve of three negative samples does not have S-shaped feature to testing result in figure, can determine that as feminine gender.
Embodiment 5：The primed probe of A group rotavirus common fluorescent quantitative PCRs uses the detection of fast PCR reaction system
As a result
Selection A group rotavirus common fluorescent quantitative PCRs have optimized the primed probe of maturation, and forward and reverse primer is respectively
5’-ggctttaaaagcgagaatttccg-3’(SEQ ID NO：And 5 '-agaattgtggtatattcaataccatacat- 4)
3’(SEQ ID NO：5), the oligonucleotide probe for target polynucleotide amplification and monitoring system is 5'-X-
Aaaggagctaaccgctagccagacgg-Y-3', X are 6-FAM amidite, Y BHQ1, (SEQ ID NO：6) it is added to
In fast PCR reaction system, A group rotavirus positive samples are taken, are detected according to the method for embodiment 2, as a result such as accompanying drawing 6
Shown, the amplification curve of A group rotavirus positive sample does not have S-shaped feature in figure, judges this A group rotavirus positive samples
Feminine gender is detected as, sees that the primed probe of explanation common fluorescent quantitative PCR design cannot be directly used to fast PCR reaction system, needs
Targetedly to redesign screening.
Embodiment 6：The primed probe concentration of A group rotavirus common fluorescent quantitative PCRs uses fast PCR reaction system
Testing result
Primer concentration 10pmol/ reactions, concentration and probe concentration 5pmol/ reactions are adjusted to the primer concentration of common fluorescent quantitative PCR
5pmol/ reactions, concentration and probe concentration 2.5pmol/ react, and other components concentration is constant in fast PCR reaction system, take A groups colyliform sick
Malicious positive sample, detected according to the method for embodiment 2, as a result as shown in Figure 7, A group rotavirus positive sample in figure
Amplification curve do not have S-shaped feature, judge that this A group rotavirus positive samples are detected as feminine gender.Illustrate that common fluorescent quantifies
PCR primed probe concentration is unsuitable for fast PCR reaction system.
Embodiment 7：Different hot resistant DNA polymerase testing result contrasts
Select the hot resistant DNA polymerase of four kinds of different brands, including InvitrogenTM PlatinumTMTaq archaeal dna polymerases
(Thermo fisher, article No. 10966018), SpeedSTAR HS DNA Polymerase (TAKARA, article No. RR070A),
FastFire qPCR PreMix (Tiangeng, article No. FP208-01), Taq archaeal dna polymerases (Promega, M1661S).With above-mentioned
Enzyme system is respectively added in fast PCR reaction system, and other components are constant.A group rotavirus positive samples are taken, according to embodiment
2 method is detected, and as a result as shown in Figure 8, in figure is from left to right TAKARA respectively, Tiangeng, Thermo fisher and
Promega, Ct value are respectively 23.00,30.33,36.33,40, the results showed that SpeedSTAR HS DNA Polymerase are most
It is adapted to fast PCR reaction, illustrates that the hot resistant DNA polymerase in fast PCR reaction system has to pass through full screening and optimization.
Embodiment 8：A group rotavirus fast PCRs kit uses the testing result of common fluorescent quantitative PCR reaction condition
A group rotavirus positive samples are taken, it is anti-according to common fluorescent quantitative PCR using the fast PCR kit of A group rotavirus
Answer condition, specific reaction condition is as follows：
Remaining is detected entirely by reference to the method for embodiment 2, is as a result shown, this A group rotavirus positive sample detection knot
Fruit Ct values are respectively 30.50, and as a result as shown in Figure 9, amplification curve is S-shaped, and Ct values are 30.50, faster than A group rotavirus
Fast PCR kit sets according to the amplification condition of embodiment 2 and has postponed more than 7 Ct values, it is seen that common fluorescent quantitative PCR reacts bar
Part is not suitable for kit of the present invention, and the PCR reaction conditions of fast PCR reaction need targetedly to be optimized.
Embodiment 9：A group rotavirus fast PCR kits contrast with commercially available quantitative fluorescent PCR reagent sensitivity
A group rotavirus positive sample is from 105PFU/ml, gradient dilution to 104、103、102PFU/ml, respectively using the present invention
The A group rotavirus fast PCR kit and commercially available rotavirus (A groups) nucleic acid detection kit (fluorescent PCR method) (on
Extra large Zhijiang River biotech inc, article No. DD-0044-02), A group rotavirus fast PCR kits are according to embodiment
2 method, rotavirus (A groups) nucleic acid detection kit (fluorescent PCR method) are detected according to the kit specification, as a result
It is 10 to show the sensitivity of A group rotavirus fast PCR kits2PFU/ml, rotavirus (A groups) nucleic acid detection kit are (glimmering
Light PCR methods) sensitivity be 103PFU/ml, it is seen that A group rotavirus fast PCR kits are glimmering better than commercially available in sensitivity
Fluorescent Quantitative PCR reagent.
Above content is to combine specific preferred embodiment further description made for the present invention, it is impossible to is assert
The specific implementation of the present invention is confined to these explanations.For general technical staff of the technical field of the invention,
On the premise of not departing from present inventive concept, some simple deduction or replace can also be made, should all be considered as belonging to the present invention's
Protection domain.
Sequence table
<110>Nantong Entry and Exit Inspection and Quarantine Bureau, The People's Republic o
<120>A kind of quick real-time fluorescent RT-PCR detection reagent box of A group rotavirus
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gttgatgctc aagatggagt 20
<210> 2
<211> 26
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
acttcattgt aatcatattg aatacc 26
<210> 3
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cagcaacaac tgcagcttca aaagaagtgt 30
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
ggctttaaaa gcgagaattt ccg 23
<210> 5
<211> 29
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
agaattgtgg tatattcaat accatacat 29
<210> 6
<211> 26
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
aaaggagcta accgctagcc agacgg 26
Claims (10)
1. a kind of quick real-time fluorescent RT-PCR detection reagent box of A group rotavirus, it is characterised in that including amplimer and spy
Anisotropic fluorescent probe, the sequence of amplimer and the specificity fluorescent probe are as follows：
Forward primer：5 '-gttgatgctcaagatggagt-3 ', SEQ ID NO:1；
Reverse primer：5 '-acttcattgtaatcatattgaatacc-3 ', SEQ ID NO:2；
Specificity fluorescent probe：5'-X-cagcaacaactgcagcttcaaaagaagtgt-Y-3', SEQ ID NO：3, wherein X
Represent that group occurs for fluorescence, Y represents fluorescent quenching group.
2. kit according to claim 1, it is characterised in that it is 6-FAM amidite, HEX that group, which occurs, for the fluorescence
Or Cy5, the fluorescent quenching group are BHQ1.
3. kit according to claim 1, it is characterised in that forward primer：Reverse primer：Specificity fluorescent probe
Mol ratio is 2：2：1.
4. kit according to claim 1, it is characterised in that the kit includes quick RT-PCR reaction solutions, feminine gender
Quality-control product and positive quality control product.
5. kit according to claim 4, it is characterised in that the quick RT-PCR reaction solutions buffer including RT-PCR
Liquid, quick RT-PCR reactions enzyme system, forward primer, reverse primer, oligonucleotide probe, DEPC water.
6. kit according to claim 5, it is characterised in that the RT-PCR buffer solutions include 0.1mmol/L
DNTPs, pH8.0,10mmol/L Tris-HCl, 150mmol/L KCl, 2.0mmol/L MgCl2。
7. kit according to claim 5, it is characterised in that the quick RT-PCR reactions enzyme system includes reverse transcriptase
MMLV, heat-resistant dna rapid polymerization enzyme and RNase inhibitor.
8. kit according to claim 7, it is characterised in that the reverse transcriptase dosage is 40U/ reactions, heat-resistant dna
Rapid polymerization enzyme dosage is 2.5U/ reactions, RNase inhibitor dosage is 20U/ reactions.
9. kit according to claim 1, it is characterised in that the kit enters the reaction condition that performing PCR expands and is：
50 DEG C of reverse transcription 5min, 1 circulation；95 DEG C of 8s, 1 circulation；Last 95 DEG C of 7s, 55~60 DEG C of 14s, 40 circulations.
10. according to purposes of any one of the claim 1-9 kits in the detection reagent for preparing A group rotavirus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710945356.6A CN107502681A (en) | 2017-10-12 | 2017-10-12 | A kind of quick real-time fluorescence RT PCR detection kits of A group rotavirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710945356.6A CN107502681A (en) | 2017-10-12 | 2017-10-12 | A kind of quick real-time fluorescence RT PCR detection kits of A group rotavirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107502681A true CN107502681A (en) | 2017-12-22 |
Family
ID=60700881
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710945356.6A Pending CN107502681A (en) | 2017-10-12 | 2017-10-12 | A kind of quick real-time fluorescence RT PCR detection kits of A group rotavirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107502681A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109234465A (en) * | 2018-11-23 | 2019-01-18 | 山东新希望六和集团有限公司 | For detecting the primer and probe, PCR kit for fluorescence quantitative and methods and applications of A type porcine rotavirus |
| CN110938710A (en) * | 2019-12-19 | 2020-03-31 | 武汉中帜生物科技股份有限公司 | Colloidal gold chromatography kit for joint detection of rotavirus and enteroadenovirus and application thereof |
| CN112301155A (en) * | 2020-02-06 | 2021-02-02 | 广州普世君安生物科技有限公司 | RDA method and kit for rapidly detecting rotavirus |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101660001A (en) * | 2008-08-27 | 2010-03-03 | 中山大学达安基因股份有限公司 | Reagent kit for detecting rotavirus nucleic acid |
| CN106222300A (en) * | 2016-08-04 | 2016-12-14 | 北京出入境检验检疫局检验检疫技术中心 | The test kit of a kind of accurate quantification detection A rotavirus and detection method |
| CN107058632A (en) * | 2017-05-23 | 2017-08-18 | 安徽安龙基因医学检验所有限公司 | A kind of multiplex PCR detects three kinds of diarrhea virus kits and its detection method |
-
2017
- 2017-10-12 CN CN201710945356.6A patent/CN107502681A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101660001A (en) * | 2008-08-27 | 2010-03-03 | 中山大学达安基因股份有限公司 | Reagent kit for detecting rotavirus nucleic acid |
| CN106222300A (en) * | 2016-08-04 | 2016-12-14 | 北京出入境检验检疫局检验检疫技术中心 | The test kit of a kind of accurate quantification detection A rotavirus and detection method |
| CN107058632A (en) * | 2017-05-23 | 2017-08-18 | 安徽安龙基因医学检验所有限公司 | A kind of multiplex PCR detects three kinds of diarrhea virus kits and its detection method |
Non-Patent Citations (3)
| Title |
|---|
| GUO, YAN-QING ET AL: "Research progress of real-time quantitative PCR method for group A rotavirus detection.", 《CHINESE JOURNAL OF VIROLOGY》 * |
| SOLTAN, MA ET AL: "Comparison of electron microscopy, ELISA, real time RT-PCR and insulated isothermal RT-PCR for the detection of Rotavirus group A (RVA) in feces of different animal species", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| ZENG YUANJUN ET AL: "Construction of a real-time fluorescent quantitative RT-PCR for detection of group A rotavirus.", 《CHINESE JOURNAL OF VIROLOGY》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109234465A (en) * | 2018-11-23 | 2019-01-18 | 山东新希望六和集团有限公司 | For detecting the primer and probe, PCR kit for fluorescence quantitative and methods and applications of A type porcine rotavirus |
| CN110938710A (en) * | 2019-12-19 | 2020-03-31 | 武汉中帜生物科技股份有限公司 | Colloidal gold chromatography kit for joint detection of rotavirus and enteroadenovirus and application thereof |
| CN110938710B (en) * | 2019-12-19 | 2023-09-05 | 武汉中帜生物科技股份有限公司 | Colloidal gold chromatography kit for combined detection of rotavirus and enteroadenovirus and application thereof |
| CN112301155A (en) * | 2020-02-06 | 2021-02-02 | 广州普世君安生物科技有限公司 | RDA method and kit for rapidly detecting rotavirus |
| CN112301155B (en) * | 2020-02-06 | 2023-10-20 | 广州普世君安生物科技有限公司 | RDA method and kit for rapidly detecting rotavirus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jiang et al. | First detection of group C rotavirus in fecal specimens of children with diarrhea in the United States | |
| CN104328218B (en) | Synchronize nucleic acid and the detection method thereof of the liquid phase genetic chip of detection five boar virus | |
| CN107513584B (en) | A kind of five heavy fluorescence quantitative kits detecting enterovirus | |
| Rao et al. | Non-polio enteroviruses and their association with acute diarrhea in children in India | |
| CN105734171A (en) | Zika virus fluorescent PCR detecting kit | |
| CN103614494B (en) | Two-color fluorogenic quantitative PCR (Polymerase Chain Reaction) detection kit for CDV (canine distemper viruses) and CPV (canine parvo viruses) | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN101660001B (en) | Reagent kit for detecting rotavirus nucleic acid | |
| Cordey et al. | Comparative analysis of viral shedding in pediatric and adult subjects with central nervous system-associated enterovirus infections from 2013 to 2015 in Switzerland | |
| WO2016082691A1 (en) | Kit for rt-pcr detection of chikungunya and test method thereof | |
| Li et al. | From orphan virus to pathogen: the path to the clinical lab | |
| CN100451129C (en) | Pig pestivirus fluorescence quantitative RT-PCR diagnosis agent kit | |
| CN109517927A (en) | A kind of A type, influenza B virus rapid typing detection reagent box and its application | |
| CN106399486B (en) | The primer sets and kit for causing diarrhea helminth are detected for multiplex PCR | |
| Piralla et al. | Enterovirus genotype EV-104 in humans, Italy, 2008–2009 | |
| CN107502681A (en) | A kind of quick real-time fluorescence RT PCR detection kits of A group rotavirus | |
| CN101608210B (en) | Quantitative detection kit for helicobacter pylori nucleic acid | |
| CN102212623B (en) | Two-color fluorescence quantitative polymerase chain reaction (PCR) combined detection method of swine fever virus and blue ear disease virus and kit thereof | |
| Tavakoli et al. | Detection and typing of enteroviruses from CSF specimens from patients diagnosed with meningitis/encephalitis | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN102206713B (en) | Triple fluorescence quantitative reverse transcription-polymerase chain reaction (RT-PCR) detection kit and use thereof | |
| CN101812539B (en) | Hog cholera virus TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit and production method thereof | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| Callens et al. | Highly sensitive detection of swine vesicular disease virus based on a single tube RT-PCR system and DIG-ELISA detection | |
| CN107699635A (en) | Porcine epidemic diarrhea virus fluorescence RPA detection methods |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171222 |
|
| RJ01 | Rejection of invention patent application after publication |