CN101812539B

CN101812539B - Hog cholera virus TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit and production method thereof

Info

Publication number: CN101812539B
Application number: CN 200910242080
Authority: CN
Inventors: 王琴; 范学政; 赵启祖; 刘俊; 徐璐; 王栋; 邹兴启
Original assignee: China Institute of Veterinary Drug Control
Current assignee: China Institute of Veterinary Drug Control
Priority date: 2009-12-03
Filing date: 2009-12-03
Publication date: 2012-07-04
Anticipated expiration: 2029-12-03
Also published as: CN101812539A

Abstract

The invention discloses a hog cholera virus TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit and a production method thereof. A CSFV TaqMan-MGB PCR differential detection method is established by the following steps: designing an MGB probe specific for a wild strain in the presence of an A/G SNP locus aiming at the 137th position of a 5' end non-coding region of the hog cholera virus genome; designing a set of universal primers in a conservative region at two ends; and further optimizing the reverse transcriptase concentration, DNA polymerase concentration, upstream and downstream primer concentration and the probe concentration. The sensitivity test results prove that the coincidence rate of the method and the RT-nPCR is 94.3 percent, and the sensitivity is ten times more sensitive than that of the RT-nPCR; and the specific test results prove that seventeen CSFV control strains are detected to be positive, and the pathogen detection rate of HCLV strains and twelve non CSFV is zero. Therefore, the method has strong CSFV specificity. The CSFV TaqMan-MGB PCR differential detection method can detect the wild strains of the hog cholera virus but cannot detect vaccine strains or other non hog cholera virus strains, and expresses the superiority of differential detection of the CSFV by the TaqMan-MGB PCR in response time, experimental cost and other aspects.

Description

CSFV TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit and working method thereof

Technical field

CSFV TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit and working method thereof involved in the present invention belong to veterinary microbiology field animal virus and learn a skill.

Background technology

Swine fever (Classical Swine Fever; CSF) be by CSFV (Classical Swine Fever virus, the height lethality of the pig that CSFV) causes, contagious disease is characterized in that the sex change of little vessel wall; Cause multiple hemorrhage, necrosis and infarct (Yin Zhen in the internal organs; Liu Jinghua. animal virology. second edition. Beijing: Science Press, 1997,645-664).According to " terrestrial animal health codes " version in 2006 that OIE formulates, CSF is classified as one of the eqpidemic disease that must report, is classified as " two types of animal epidemics " in China, and financial loss is serious.CSF shows atypical characteristic at aspects such as epidemic characteristic, clinical manifestation and pathological changes clinically at present, exists the situation with other sick polyinfection simultaneously.Therefore to its diagnosis very difficulty (Xuan Hua is coated with Changchun for Zhou Xubin, Wang Xinping. differentiate bovine viral diarrhoea mucosal virus and CSFV composite PCR method and application thereof. Chinese animal doctor's journal, 2002,22 (6): 173-179), must rely on laboratory diagnosis and just can make a definite diagnosis.Because CSFV breed titre in cell lower, and do not produce macroscopic pathology, cause from the Research on Diagnosis of etiology angle very difficult; And CSFV has only a serotype, cause to infect crowd and immunity crowd from serology angle difference, at present the various not too sophisticated test kit of CSF have usually that sensitivity is lower, poor specificity, problem such as consuming time.Included in compulsory immunization animal epidemic catalogue by country from swine fever in 2009; Differential diagnosis to vaccine immunity pig and natural infection pig has crucial meaning (Van Oirschot; J.T.Vaccinology of classical swine fever:from lab to field.Veterinary ofMicrobiology.2003; 96:367-384.), do not detect hog cholera lapinised virus vaccine immunity crowd and wild virus infection crowd but still have sophisticated method or test kit to differentiate at present.

Common CSF etiological diagnosis technology mainly contains isolation of virus, immunofluorescence technique, the mutual immunity test of rabbit body, ELISA antigen capture method, RT-PCR technology and laboratory animal method etc. at present.CSFV stripping technique (HaegemanA; Dewulf J, Vrancken R, Tignon M; Ribbens S; Koenen F.Characterisation of the discrepancybetween PCR and virus isolation in relation to classical swine fever virus detection.Journal ofVirological Methods.2006,136:44-50): be the gold standard of swine fever diagnosis, sensitivity; But sense cycle is long, effort, need Experimental Establishment, is not suitable for full crowd's generaI investigation; Hog cholera immune fluorescence technique: can be divided into direct immunofluorescence and indirect immunofluorescence again, use fluorescently-labeled one anti-or two anti-to tissue slice observations of dyeing, to detect whether the CSFV infection is arranged.Immunofluorescence technique is to detect the official method of CSF cause of disease at present, but this method needs empirical testing crew, and this technical experience property is stronger, film-making particularly in the tissue slice process difficulty big, length consuming time.The making that tissue is smeared sheet also maybe be because selected sample be non-focal zone and omission.Thereby this method also receives restriction to a certain degree; The laboratory animal method: carry out inoculation test or carry out the evaluation of cause of disease with the mutual immunity test of rabbit body with responsive piglet, this method can be used to differentiate hog cholera lapinised virus vaccine poison and wild virus infection, but this method needs carry out in laboratory with good conditionsi, and time-consuming; Antigen capture ELISA method (Depner K, Paton DJ, Cruciere C; De Mia GM, M ü ller A, Koenen F; Stark R; Liess B.Evaluation of theenzyme-linked immunosorbent assay for the rapid screening and detection of classical swinefever virus antigens in the blood of pigs.Revue Scientifique et Technique.1995,14 (3): 677-689.): utilize double antibodies sandwich method or competition law to catch CSFV on enzyme plate, utilize two anti-colour developings of horseradish peroxidase-labeled then; Judge according to the height of light absorption value and to have or not CSFV; Present this test kit mainly leans on import, cost an arm and a leg, and susceptibility is lower; RT-PCR technology (Handel K; Kehler H; Hills K; Pasick J.Comparisonof reverse transcriptase-polymerase chain reaction, virus isolation, and immunoperoxidase assaysfor detecting pigs infected with low; Moderate; And high virulent strains of classical swine fevervirus.Journal of Veterinary Diagnostic Investigation.2004,16 (2): 132-138.): along with development of molecular biology, more and more scholars is used reverse transcription PCR (RT-PCR) and reverse transcription sleeve type PCR (RT-Npcr) successfully increases to CSFV.Though it is easy and simple to handle that this method has, fast, advantages such as high specificity, RT-nPCR will pass through reverse transcription, PCR, secondary PCR reaction and agarose gel electrophoresis, is prone to cause aerosol to pollute when detecting in a large number, is unfavorable for the laboratory rapid detection.

Above-mentioned the whole bag of tricks and not too sophisticated test kit thereof exist usually that sensitivity is lower, poor specificity, consuming time, can't distinguish the immunity crowd and infect problems such as crowd.Therefore develop CSFV TaqMan-MGB fluorescence quantitative RT-RCR and differentiate that detection technique has crucial meaning for the discriminating detection of swine fever cause of disease.

The objective of the invention is to utilize the TaqMan-MGB fluorescent quantitative PCR technique, set up CSFV TaqMan-MGB fluorescence quantitative RT-RCR and differentiate detection technique fast, thereby preparation is used for the test kit that CSFV differentiates detection fast.

Summary of the invention

One, main technical principle of the present invention

Real time fluorescent quantitative poly Kettenreaktion (Real-time Quantitative Polymerase Chain Reaction; RQ-PCR) technology is a kind of novel nucleic acids quantitative technique (Heid that grows up the mid-90 in 20th century; C.A.; Et al., Real time quantitative PCR. [J] .Genome Res, 1996.6 (10): 986-94.); This technology is quantitatively monitored the accumulation fluorescence intensity in real time with fluorescence detecting system through initial point and is realized, it can adopt absolute quantitation and relative quantification dual mode realization detection by quantitative.

Real-time fluorescence quantitative PCR (RQ-PCR) technology comprises probe class and two kinds of (Wittwer of dye class; C.T., et al., Continuous fluorescence monitoring of rapid cycle DNA amplification.Biotechniques; 1997.22 (1): 130-1,134-8).The probe class is to utilize the increase of indicating amplified production with the probe of template specific hybridization, is representative with the TaqManTM technology, and fluorophor commonly used is FAM, TET, VIC, HEX; Dye class be use a kind of can with double-stranded DNA ditch bonded optical dye, fluorescent signal is strong and weak relevant with the quantity of double-stranded DNA, can detect the double-stranded DNA quantity of PCR system existence according to fluorescent signal, commonly used is SYBR Green I dyestuff.

Real-time fluorescence PCR technology TaqMan commonly used ^TMTechnology (Heid, C.A., et al.; Real time quantitative PCR.Genome Res, 1996.6 (10): 986-94.), develop by U.S. Perkin Elmer company; It adds the specific fluorescence probe of a bp more than 20 in the pcr amplification system; This probe is an oligonucleotide, and fluorescent emission group (R) and quenching group (Q) on the difference mark of two ends are set up standard form series control reaction pipe and negative control pipe in the PCR reaction; In the annealing of pcr amplification or the variation of extending detection fluorescent signal in the step, draw the kinetic curve figure of real-time fluorescence quantitative PCR (RQ-PCR).When probe is complete, both take place FRET (Fluorescence Resonance Energy Transfer, FRET), R group fluorescent signal emitted is by the cancellation of Q group; When pcr amplification carried out, Taq enzyme performance 5 ' → 3 ' 5 prime excision enzyme activity was degraded probe; The R group separates with the Q group; Q group cancellation effect disappears immediately, and the R group discharges fluorescent signal, is received by the fluorescence monitoring system; Be that every completion is once increased; A fluorescent signal accumulation is just arranged, realized that the accumulation of fluorescent signal and PCR product form (Hiyoshi, M.and Hosoi S. fully synchronously; Assay of DNA denaturation bypolymerase chain reaction-driven fluorescent label incorporation and fluorescence resonanceenergy transfer.Anal Biochem, 1994.221 (2): 306-11; Holland; P.M.; Et al.; Detection of specificpolymerase chain reaction product by utilizing the 5 '-3 ' exonuclease activity of Thermusaquaticus DNA polymerase.Proc Natl Acad Sci U S A, 1991.88 (16): 7276-80.).Its principle of work is seen Fig. 1.

TaqMan MGB probe (TaqMan Minor Groove Binder probe) (Decaro; N.; Et al.; A minorgroove binder probe real-time PCR assay for discrimination between type 2-based vaccines andfield strains of canine parvovirus.J Virol Methods; 2006.136 (1-2): 65-70) be that with general T aqMan hydrolysis probes difference 3 ' end of TaqMan MGB probe is connected a not fluorescent Q group and a special ditch zygote (Minor Groove Binder); This special design has given the MGB probe three big advantages: the one, significantly improve the Tm value, and can reduce probe design length like this, the probe design that AT is rich in the district is more favourable; The 2nd, can reduce the background fluorescence signal, improve SNR, make experimental result more accurate, resolving power is higher; The 3rd, improved the binding specificity of probe and complementary template, even not matching of a base can both accurately be differentiated.This method has been widely used in allelotrope evaluation, single nucleotide polymorphism analysis, rite-directed mutagenesis detection etc.Its principle of work is seen Fig. 2.

The CT value of calculation sample just can be confirmed the starting template amount of sample.The CT value is meant that the fluorescent signal of sample hose reaches the PCR reaction cycle number of a certain fixed threshold, and threshold value is the numerical value decision that is added its standard deviation gained by the mean number of the Δ Rn value of selected each cycle number as baseline.When PCR circulates in the cycle number that arrives CT value place; Just got into the real index amplification phase, this moment, slight error was not amplified as yet, so the circulation ratio of CT value is fabulous; Be amplification in same template different time amplification or the same asynchronism(-nization) pipe, the CT value that obtains is a constant.Logarithm according to CT value and original template concentration is linear, utilizes 10 times of gradient dilutions of standard substance to draw out typical curve, sees Fig. 3.Utilize the amount of template originally that the CT value of each sample can calculation sample.

Two, detailed description of the present invention

1.MGB probe and primer design

CSFV (CSFV), bovine viral diarrhea virus (BVDV) and sheep border disease virus (BDV) complete sequence to GenBank announces are comprehensively compared; Discovery is in A/G SNP site of 137 existence of its 5 ' end non-coding region; Be that the hog cholera lapinised virus vaccine virus strain is A in this site, and other street strain is G with this site of other vaccine strains, utilizes Primer Express2.0 software; Designed the special MGB probe of wild strains of classical swine fever virus to this site; And at two ends conserved regions design one the cover universal primer, called after: upstream primer MGB-F, downstream primer MGB-R, probe MGB-P, sequence is following:

MGB-F：5’-CATGCCCACA?GTAGGACTAG?CAAA-3’

MGB-R：5’-GAACTACTGA?CGACTGTCCT?GTACTCA-3’

MGB-P：5’-FAM-CTAGCCGTAG?TGGCGA-MGB-3’

Wherein: FAM is a Fluoresceincarboxylic acid; MGB is the ditch zygote.

2. the preparation of positive control

Positive control: adopt the external rt of fragment of the about 300bp of swine fever crossdrift standard strain (SM) its non-coding region of cloned specific to obtain, concentration is (0.126～0.368 μ g/10 μ L).The preparation method is following:

(1) purpose fragment amplification

Adopt SNP-F:GACGGCCGAACTGGGCTA; SNP-R:ATTCAACTCCATGTGCCATGAA is made into the RT-PCR reaction solution as primer by conventional RT-PCR reaction system, adds positive SM RNA template; Increase with the pcr amplification appearance, obtain a large amount of purpose fragments, detect and separate amplified production with 1.5% agarose gel electrophoresis; The visible molecular weight size of ultraviolet video picture is the specific band of 307bp (seeing sequence 6); And do not have the non-specific amplification band, prove and increase successfully, downcut the PCR jel product at the bright band position and preserve subsequent use.

(2) purifying purpose fragment

Purpose nucleic acid fragment in the above-mentioned PCR jel product of Gel Extraction Kit test kit purifying that adopts carries out roughly quantitatively with the amplified production of 1.5% agarose gel electrophoresis to purifying again.

(3) connection and conversion reaction

Press pGM-T Easy and connect the test kit explanation, carry out the ligation of PCR purified product and T carrier, structure contains purpose fragment plasmid.Above-mentioned connection product is transformed into the TOP10 competent cell, then the competent cell that transforms is applied to the agar plate that is added with 40 μ L X-Gal (20mg/mL) and 8 μ L IPTG (200 μ g/mL), cultivate 12～16h for 37 ℃.

(4) enlarged culturing and the evaluation of clone's bacterium colony

Cultivate on the rear plate and grow blueness and white colony, picking is full, the limpid single white colony in surface is inoculated in the 5ml LB substratum that contains ammonia benzyl resistance, and each bacterium colony is record number all, 37 ℃, 180r/min shaking table cultivation 12～16h.Using P lasmid Mini Kit I material extracts test kit the culture bacteria liquid of each bacterium colony is carried out the extraction of material, and to the plasmid evaluation of checking order.

(5) in-vitro transcription

Positive material with after identifying is a template, presses the Ribo MAX of Promega company ^TMThe in-vitro transcription of Large Scale RNAProduction System-T7 test kit explanation carrying out standard positive plasmid.

(6) transcribe aftertreatment

1) adding RQ1 RNase-Free DNase is 1 μ/μ g template DNA to final concentration, 37 ℃ of placement 15min.

2) with the saturated phenol of TE (pH 4.5) of 1 times of volume: chloroform: primary isoamyl alcohol=extracting in 25: 24: 1, vortex 1min, the centrifugal 2min of 12000r/min.

3) the upper strata water is changed in the new centrifuge tube, add the chloroform of 1 times of volume: primary isoamyl alcohol=24: 1, vortex 1min, the centrifugal 2min of 12000r/min.

4) the upper strata water is changed in the new centrifuge tube, add 3M sodium-acetate (pH5.2) and the Virahol of 1 times of volume or 95% ethanol of 2.5 times of volumes of 1 times of volume, mixing places 2～5min on ice, the centrifugal 10min of 12000r/min.

5) discard gently or the sucking-off supernatant, clean centrifuge tube with 70% ethanol of 1ml, the RNA under the vacuum environment in the dry centrifuge tube, and, be kept at-70 ℃ with the resuspended RNA of TE damping fluid.

(7) transcribing the back identifies and check

RNA through the in-vitro transcription preparation dilutes by 1: 100 to 1: 300 with 1 * TE damping fluid (10mM Tris-HCl, pH8.5,1mM EDTA), measures OD with ultraviolet spectrophotometer ₂₆₀/ OD ₂₈₀Ratio (OD ₂₆₀/ OD ₂₈₀The RNA purity of explanation gained is higher between=1.9～2.1, and ratio is degraded if be higher than 2.1 possibility RNA if being lower than 1.9 has protein contamination) and OD ₂₆₀Value (1OD ₂₆₀Be equivalent to about 40ug/ml RNA), accreditation promptly can be used as positive criteria article stoste.

Positive criteria article stoste is carried out 10 times of gradient dilutions with DEPC water; Obtain the diluent of a plurality of gradients; The diluent of each gradient carries out the CT value with test kit CSFV TaqMan-MGB PCR detection reagent and demarcates; Get the CT value in the strong positive contrast of the diluent of 15.0-20.0, get the weak positive control of the diluent of CT value about 35.0 as test kit as test kit.

3. the information of Quality Control sample and negative control

Quality Control sample bacterium, strain and cell are seen table 1, and test is seen table 2 with hog cholera lapinised virus vaccine information.

Table 1 Quality Control bacterium, strain and cell background information

Hog cholera lapinised virus vaccine information is used in table 2 test

4. negative control background information

Adopt no specificity cause of disease (SPF) pig tonsil or submandibular lymph nodes, mesenteric lymph nodes; Add phosphate buffered saline buffer (PBS) liquid by 1: 5 times of volume; In mortar or tissue homogenizer, fully grind, the centrifugal 10min of 3000r/min gets supernatant and changes in the centrifuge tube subsequent use then.4) be used for the preparation of negative control and Quality Control sample rna.

(1) get 1.5mL Eppendorf pipe, every pipe adds 500 μ L Trizol, adds test sample respectively, and a duplicate samples is changed a suction nozzle, and fully mixing leaves standstill 5min; Add 200 μ L chloroforms again, vibration mixing 5s (can not be too strong,, also can put upside down mixing) on the vortex mixer with hand in order to avoid produce emulsion layer.In 4 ℃, the centrifugal 15min of 12000r/min.

(2) get 1.5mL Eppendorf pipe, add 500 μ L Virahols (4 ℃ of precoolings), make marks.Get 1) in last honest and upright and thrifty 500 μ L (note not sucking-off middle layer) be transferred in the corresponding pipe, put upside down mixing, 4 ℃ leave standstill 20min.

(3) in 4 ℃, the centrifugal 15min of 12000r/min, carefully remove supernatant, be inverted on the thieving paper, be stained with dry liquids, add 600 μ L, 75% ethanol, put upside down washing.

(4) 4 ℃, the centrifugal 10min of 12000g carefully remove supernatant, are inverted on the thieving paper, are stained with dry liquids as far as possible.

(5) the centrifugal 10s of 4000r/min is thrown to the pipe end with the tube wall raffinate, carefully blots with micro sample adding appliance, and a kind of sample is used a suction nozzle, drying at room temperature 3～10min instead.

(6) add 25 μ L DEPC water mixing gently, dissolving RNA preserves subsequent use on ice.The RNA that extracts must carry out pcr amplification in 2h; Must place-70 ℃ of refrigerators if need prolonged preservation.

5. reagent

Trizol lytic reagent (Trizol Regeant, 200mL/ bottle), Super Script ^TMIII (200U/ μ L) ThermoScript II (Super Script ^TMIII Reverse Transcriptase) available from Invitrogen company;

Taq HS archaeal dna polymerase (5U/ μ L), 10 * PCR damping fluid (PCR Buffer, pH 8.3 Tris-HCl, 100mM; KCl, 500mM; MgCl ₂, 15mM), dNTP mixed solution (dNTP Mixture, every kind of 2.5mM/) is available from precious biotechnology (Dalian) ltd;

MGB probe and primer are synthetic by Jikang Biotechnology Co Ltd, Shanghai.

6.TaqMan-MGB the foundation of fluorescence quantitative RT-RCR reaction system

Carry out the TaqMan-MGB fluorescence quantitative RT-RCR with CSFV SM strain virus as template, process is to SSIII ^TMThe progressively optimization of ThermoScript II, Taq HS archaeal dna polymerase (Taq HS DNA Polymerase), upstream and downstream primer, probe and reaction system.The reaction system of finally selecting for use is seen table 1.

Table 3 CSFV TaqMan-MGB PCR reaction system

Instrument: fluorescent PCR detector (ABI7500 quantitative real time PCR Instrument, u.s.a. applied biosystem (ABI) Company products).

Reaction conditions: 50 ℃, 20min; 94 ℃, 4min; 88 ℃, 8s; 60 ℃, 35s, 40 circulations.When circulating in 60 ℃, each gathers the fluorescent signal of a MGB probe release.

Three, test kit production and assembly and application

1. test kit production and assembly

(1) reference substance and water

Positive and weak positive control: adopt the external rt of fragment of the about 300bp of swine fever crossdrift standard strain (SM) its non-coding region of cloned specific to obtain special RNA; 0.126～0.368 μ g/10 μ L) and (weak positive control 0.013～0.037 μ g/10 μ L) content is respectively (positive control:; 300 μ L/ manage packing; Each 2 pipe ,-20 ℃ frozen subsequent use.The preparation method sees Appendix.

Negative control: tonsilla or the submandibular lymph nodes, the mesenteric lymph nodes that adopt no specificity cause of disease (SPF) pig; Add 0.1% tetra-sodium diethyl ester (DEPC) water by 1: 5 times of volume, in tissue homogenizer, fully grind, then the centrifugal 10min of 3000r/min; Getting supernatant changes in the centrifuge tube; Be distributed into 200 μ L/ pipe, totally 10 manage ,-20 ℃ frozen subsequent use.

Diethylpyrocarbonate (DEPC) water: 20mL/ bottle.

(2) reagent

The Trizol lysate: the 40mL/ bottle, divide to be filled in the brown bottle, deposit subsequent use for 4 ℃.

TaqMan-MGB PCR reaction solution: each reaction comprises 10 * PCR Buffer, 5 μ L, dNTP Mixture (2.5 μ Meach) 1.6 μ L, MGB-F (10 μ M) 3 μ L, MGB-R (10 μ M) 3 μ L, totally 12.6 μ L.50 reactions amount to 630 μ L, are distributed into 2 pipes (365 μ L/ pipe has 50 μ L to have more than needed).

Reaction enzymes: each reaction comprises SSIII ^TMThermoScript II 0.3 μ L, Taq HS archaeal dna polymerase 0.5 μ L, totally 0.8 μ L.50 reactions amount to 45 μ L (having 5 μ L to have more than needed), are distributed into 1 pipe.

Probe solution: be diluted to 5 μ M with 0.1% tetra-sodium diethyl ester (DEPC) water, each reaction needs 1.6 μ L.50 reactions amount to 90 μ L (having 10 μ L to have more than needed), are distributed into 1 pipe, and-20 ℃ frozen subsequent use.

(3) test kit assembling (in 48 parts)

Get each 2 pipe of above-mentioned positive control and weak positive control; Negative control 10 pipes; TaqMan-MGB PCR reaction solution 2 pipes, reaction enzymes 1 pipe, probe solution 1 pipe, 1 bottle of Trizol (40ml), 0.1% 1 bottle in water of tetra-sodium diethyl ester (DEPC) (20ml) just is being put in the test kit; 8 PCR reaction tubess and pipe cover 6 rows.

The correlation test of 2 test kits

(1) specificity test

Adopt the inventor to differentiate the detection kit reaction solution by the CSFV TaqMan-MGB PCR of 20080801,20080802,20,080,803 3 lot numbers of method preparation provided by the invention; Get Quality Control sample 200 μ L respectively and extract RNA; By system and the cycling condition after optimizing; Carry out TaqMan-MGB PCR reaction, detect its specificity.Adopt 6 batches of hog cholera lapinised virus vaccine strains of 5 different manufacturers to do the validity detection simultaneously.

Detected result shows that 17 CSFV Quality Control strain detections are all positive, and the HCLV strain detects negative, and 12 non-CSFV cause of disease detections are all negative, and PK15 cell control test is negative.Confirm that this method has excellent specificity, and can differentiate hog cholera lapinised virus vaccine strain and other CSFV strain.

(2) sensitivity test

200 μ L SM blood poison extracts RNA, ultraviolet spectrophotometer (Nano

ND-1000) measure OD ₂₆₀, OD ₂₆₀/ OD ₂₈₀, being converted into concentration is 64ng/ μ L, 10 ^-1To 10 ^-10Behind the gradient dilution; Carry out FQ-PCR and RT-nPCR reaction (Tu C C simultaneously; Et al..Phylogenetic comparison of classical swine fever virus in China.VirusResearch.2001, (81) 29-37), detect its sensitivity.

Table 4 CSFV RT-nPCR and TaqMan-MGB PCR product sequencing result

Annotate: "+" expression sequencing result is positive; "-" expression sequencing result is negative

Can know 10 by the CT value ^-1～10 ^-8Between the logarithm of CT value and template copy number linear, it is about 3.3 that the CT value between adjacent two template concentrations differs, and differs 10 times with the template concentrations of calculating in theory, CT value differs 3.3 and conforms to, RT-nPCR detection 10 ^-7, TaqMan-MGB PCR exceeds 10 times than the sensitivity of conventional RT-nPCR thus.

(3) replica test

The detection kit reagent are differentiated in totally 3 crowdes of CSFV TaqMan-MGB PCR of employing 20080801,20080802,20080803; To 30 Quality Control samples, adopt MeDiPro Super System-32 nucleic acid extraction appearance, carry out RNA in strict accordance with its operation instructions and extract; Be dissolved in 100 μ L, 0.1% tetra-sodium diethyl ester (DEPC) water; Place 20min for 37 ℃, treat that it fully dissolves, 10 μ L are got in each reaction; Carry out CSFV TaqMan-MGBPCR reaction by optimizing good reaction system and cycling condition, each sample is done 9 repetitions.The detected result improve parameter unification is set at: 3～15cycle baseline (Baseline), 2000 threshold values (Threshold).According to the CT value calculate three batches of reagent of test kit criticize between, variation within batch coefficient (CV).

The result shows: the 20080801 batches of reagent is 1.04%～5.88% to the detection CT value variation coefficient of 30 Quality Control samples; The 20080802 batches of reagent is 1.06%～7.23% to the detection CT value variation coefficient of 30 Quality Control samples; The 20080803 batches of reagent is 0.75%～9.93% to the detection CT value variation coefficient of 30 Quality Control samples, explain three batches of reagent have well batch in repeatability; Simultaneously; 20080801,20080802, the 20080803 batches of reagent is 0.60%～5.71% to the detection CT value variation coefficient of 30 Quality Control samples; All less than 10%, it is repeatable to explain that 20080801,20080802,20080803 these 3 batches of reagent have between good batch.

(4) stability test

Use CSFV TaqMan-MGB PCR to differentiate that 20080801,20080802,20080803 batches of reagent of detection kit detect 30 Quality Control samples respectively; Every month 1 time; Every batch of reagent is done 3 repetitions; Continue 5 months, detect the stability that this CSFV TaqMan-MGB PCR differentiates detection kit.

The result shows; 3 crowdes of CSFV TaqMan-MGB PCR of lot number 20080801,20080802,20080803 differentiate that detection kit changes not quite 5 months CT value of 30 Quality Control samples, explain that this CSFV TaqMan-MGB PCR differentiates that detection kit had good stability in 5 months.

(5) accordance test

This research adopts CSFV RT-nPCR method to differentiate the reference that meets of detection method as CSFV TaqMan-MGB PCR; 122 parts of clinical sample RNA are carried out CSFV TaqMan-MGB PCR and CSFV RT-nPCR detection simultaneously, and CSFV TaqMan-MGB PCR and RT-nPCR coincidence rate are 94.3% as a result.

(6) clinical detection

Adopt CSFVTaqMan-MGB PCR to differentiate that detection kit carry out CSFV and detect to 925 parts of clinical samples of Hebei, Hunan, Beijing, Fujian, Shandong, Jiangxi, 7 provinces and cities in Sichuan, simultaneously with RT-nPCR as meeting.925 parts of clinical samples are detected, and the MGB quantitative fluorescent PCR detects 101 parts, and positive rate is 10.9%; RT-nPCR detects 40 parts, and positive rate is 4.3%.Coincidence rate is 92.8% (858/925).Explain that two kinds of method coincidence rates are higher.

3. the application of test kit

(1) sample pre-treatments and depositing

1) blood sample

Each reaction is got 200 μ L whole bloods and is extracted RNA.

2) tissue internal organs

Getting sample 50～100mg to be checked fully grinds in the mortar of cleaning, sterilization and oven dry; Add 1mL 0.1% tetra-sodium diethyl ester (DEPC) water mixing, 4 ℃, the centrifugal 15min of 3000r/min; Get 200 μ L supernatants and change in the aseptic 1.5mLEppendorf pipe, number subsequent use.

3) cell culture

Each reaction is got 200 μ L cell cultures and is extracted RNA.

The sample of preparation is preserved under 2 ℃～8 ℃ conditions and should be no more than 24h, if need prolonged preservation should put below-70 ℃, but should avoid multigelation (freeze thawing is no more than 3 times).

(2) preparation of sample RNA to be checked

1) get 1.5mL Eppendorf pipe, every pipe adds 500 μ L Trizol, adds test sample respectively, and a duplicate samples is changed a suction nozzle, and fully mixing leaves standstill 5min; Add 200 μ L chloroforms again, vibration mixing 5s (can not be too strong,, also can put upside down mixing) on the vortex mixer with hand in order to avoid produce emulsion layer.In 4 ℃, the centrifugal 15min of 12000r/min.

2) get 1.5mL Eppendorf pipe, add 500 μ L Virahols (4 ℃ of precoolings), make marks.Get 1) in last honest and upright and thrifty 500 μ L (note not sucking-off middle layer) be transferred in the corresponding pipe, put upside down mixing, 4 ℃ leave standstill 20min.

3) in 4 ℃, the centrifugal 15min of 12000r/min, carefully remove supernatant, be inverted on the thieving paper, be stained with dry liquids, add 600 μ L, 75% ethanol, put upside down washing.

4) 4 ℃, the centrifugal 10min of 12000g carefully remove supernatant, are inverted on the thieving paper, are stained with dry liquids as far as possible.

5) the centrifugal 10s of 4000r/min is thrown to the pipe end with the tube wall raffinate, carefully blots with micro sample adding appliance, and a kind of sample is used a suction nozzle, drying at room temperature 3～10min instead.

6) add 25 μ L DEPC water mixing gently, dissolving RNA preserves subsequent use on ice.The RNA that extracts must carry out pcr amplification in 2h; Must place-70 ℃ of refrigerators if need prolonged preservation.

(3) amplifing reagent is prepared

Carry out at the reaction mixture preparation area.

From test kit, take out CSFV TaqMan-MGB PCR reaction solution, reaction enzymes and probe solution, after at room temperature melting, the centrifugal 5s of 2000r/min.If needing the PCR number is n, wherein n is sample number * repeat number to be checked, 1 pipe positive control, the weak positive control of 1 pipe and 1 pipe negative control sum, and table 3 is seen in each test sample reaction system preparation.

Table 5 reaction system preparation table

(4) application of sample

Carry out in the sample process district.

In the fluorescence RT-PCR pipe of each setting, add the 10 μ L RNA solution that prepare in the preparation of above-mentioned sample RNA to be checked respectively, the tight pipe lid of moisturizing to 50 μ L lid.

Add 10L positive control and weak positive control respectively in positive control and the weak positive control pipe, moisturizing to 50 μ L.

(5) TaqMan-MGB PCR detects

Carry out at detection zone.

Above-mentioned PCR pipe is put in the fluorescent PCR detector (ABI7500 quantitative real time PCR Instrument, u.s.a. applied biosystem (ABI) Company products), and the record sample is put order.

Cycling condition is provided with:

Fs, 50 ℃/20min of reverse transcription;

Subordinate phase, 94 ℃/4min of sex change in advance;

Phase III, 88 ℃/8s, 60 ℃/35s, 40 circulations are gathered fluorescent signal for 60 ℃.

After test detect to finish, by on the detector according to the Dynamic Fluorescence signal curve and the CT value synthetic determination result that gather.

(6) result judges

1) interpretation of result condition enactment

Directly read detected result.The threshold setting principle is adjusted according to the noise of instrument situation, is as the criterion with the vertex of threshold line just above normal negative sample amplification curve.

2) quality control standard

Negative control: no CT value and do not have amplification curve.

Positive control: the CT value should be 15.0～20.0, typical amplification curve should and appear about 35.0 in weak positive control CT value.Otherwise it is invalid that experiment this time is regarded as.

3) result describes and judges

1. negative: no CT value and do not have typical amplification curve, representing does not have CSFV in the sample.

2. positive: CT value≤35, and typical amplification curve appears, there is CSFV in the expression sample.

3. suspicious: CT value＞35 and the sample suggestion that typical amplification curve occurs are reformed.It is positive with typical amplification curve person that CT value≤35 appear in the result that reforms, otherwise negative.

Description of drawings:

Fig. 1 TaqMan quantitative fluorescent PCR principle of work is in PCR reaction annealing process; Probe (5 ' mark fluorescent group; 3 ' end mark quenching group) combine prior to upstream and downstream primer and template are complementary, primer under the polysaccharase effect by 5 ' → 3 ' to carry out nascent strand synthetic, the building-up process middle probe is degraded by polysaccharase 5 ' → 3 ' 5 prime excision enzyme activity; 3 ' end quenching group that goes out loses the cancellation effect to 5 ' fluorophor; Discharge the fluorescent signal of specific wavelength, this signal system to be detected monitors in real time, thereby realizes the complete monitoring to pcr amplification.

Fluorescence report group of 5 ' mark of Fig. 2 TaqMan MGB probe principle of work MGB probe; 3 ' end connects a not fluorescent quenching group and a special ditch zygote; This special design makes that the binding specificity of MGB probe and template is higher, probe sequence must with the complete complementary coupling of template sequence annealed with it, the probe degraded of initiated polymerization enzyme mediation; Discharge fluorescence, detection system detects signal; If but have a base not match, and the MGB probe just can not combine with template is complementary, and probe degraded that can not the mediation of initiated polymerization enzyme can not discharge fluorescence, and detection system detects less than fluorescent signal.

10 times of gradient dilutions of Fig. 3 standard substance are drawn out the RNA standard substance that typical curve utilizes the in-vitro transcription that the present invention prepares; Carry out 10 times of serial dilutions of 8 gradients, detect, make typical curve by ABI7500 software by reaction system of the present invention; X-coordinate is the logarithmic value of starting template copy number; Ordinate zou is the CT value, and rate of curve is-3.339, and linearly dependent coefficient is 0.998.

Fig. 4 technological line of the present invention

The CSFV RNA RT-nPCR (A) of 0 times of gradient dilution of Figure 51 and TaqMan-MGB pcr amplification (B) carry out the RNA standard substance of in-vitro transcription of the present invention 10 times of serial dilutions of 8 gradients; Carrying out RT-nPCR detection and fluorescent quantitation simultaneously detects; A is the detected result of RT-nPCR method; B is the detected result of fluorescent quantitation, and band appears in 1～7 swimming lane among Fig. 5-1, explains that this method can detect 10 ^-7Gradient; And Fig. 5-2 is 10 ^-8Lateral also has fluorescent signal, explains that fluorescence quantifying PCR method of the present invention can detect 10 ^-8Gradient confirms that fluorescence quantifying PCR method detection sensitivity of the present invention is than the high one magnitude of RT-nPCR.

Advantage of the present invention

CSFV, BVDV and BDV (Barbara E, William S.D., David J L according to the GenBank announcement;, DISEASE OF SWINE..I.S.U.Press.Vol.8Th.1999:AMES, IOWA U.S.A) and complete sequence comprehensively compares; Discovery is in A/G SNP site of 137 existence of CSFV genome 5 ' end non-coding region; Be the hog cholera lapinised virus vaccine strain in this position, site A, and other this site of swine fever strain is G, utilizes Primer Express2.0 software; Designed the special MGB probe of street strain to this site; And at two ends conserved regions design one cover universal primer, through the further optimization of ThermoScript II concentration, archaeal dna polymerase concentration, upstream and downstream primer concentration and concentration and probe concentration, set up CSFVTaqMan-MGB PCR and differentiated detection method.Sensitivity test result shows that this method and RT-nPCR coincidence rate are 94.3%, and 10 times of remolding sensitivity RT-nPCR sensitivities; The specificity test-results shows that 17 CSFV Quality Control strain detections are all positive, and HCLV strain and 12 non-CSFV cause of disease recall rates are zero, explain that this method has very strong CSFV specificity, and can differentiate HCLV and other swine fever strains.All embody TaqMan-MGB PCR from aspects such as reaction times and experimentation costs and differentiated the meliority that detects CSFV.

Advantage of the present invention; Can reduce: 1) specificity is good: TaqMan-MGB PCR quantitative technique is screened the SNP site row of CSFV nucleic acid through the single mutation specificity of MGB probe; Reach and differentiate the purpose that detects the wild poison of swine fever, accuracy is high, and target sequence is by special primer and the dual control of probe simultaneously; Specificity is good, and false positive is low.And will not detect, thereby reach the interference of getting rid of vaccine immunity in the poison detection out of office to vaccine virus; 2) highly sensitive: reaction process is monitored by fluorescence detecting system in real time, and fluorescence detecting system has very sensitive detectivity to fluorescent signal; 3) linear relationship is good: because the logarithm of the power of fluorescent signal and template amplification product is linear, can directly carry out quantitatively sample original template concentration through the detection of fluorescent signal; 4) simple to operate: level of automation is high, and the TaqMan technology is to the amplification of template and detect next step completion of situation at stopped pipe, need not uncap, and the environmental pollution chance is few; 5) there is not last handling process: need not hybridization, electrophoresis, process such as take pictures.

Sequence table

< 110>China Veterinery Drug Inspection Office

< 120>CSFV TaqMan-MGB fluorescent quantitation RT-CR differentiates detection kit and working method thereof

<130>

<160>6

<210>1

<211>24

<212>DNA

< 213>artificial sequence

<220>

< 223>to the description of artificial sequence: the upstream primer MGB-F of institute of the present invention design and use.

<400>1

CATGCCCACA?GTAGGACTAG?CAAA 24

<210>2

<211>27

<212>DNA

< 213>artificial sequence

<220>

< 223>to the description of artificial sequence: the downstream primer MGB-R of institute of the present invention design and use.

<400>2

GAACTACTGA?CGACTGTCCT?GTACTCA 27

<210>3

<211>16

<212>DNA

< 213>artificial sequence

<220>

< 223>to the description of artificial sequence: the probe MGB-P of institute of the present invention design and use.

<400>3

CTAGCCGTAG?TGGCGA 16

<210>4

<211>18

<212>DNA

< 213>artificial sequence

<220>

< 223>to the description of artificial sequence: the present invention prepares the primer SNP-F that positive control designs and is used for.

<400>4

GACGGCCGAA?CTGGGCTA 18

<210>5

<211>22

<212>DNA

< 213>artificial sequence

<220>

< 223>to the description of artificial sequence: the present invention prepares the primer SNP-R that positive control designs and is used for.

<400>5

ATTCAACTCC?ATGTGCCATG?AA 22

<210>6

<211>307

<212>DNA

< 213>artificial sequence

<220>

< 223>to the description of artificial sequence: positive control standard substance target gene fragment sequence of the present invention.

<400>6

GACGGCCGAA?CTGGGCTAGC?CATGCCCATA?GTAGGACTAG?CAAACGGAGG?GACTAGCCGT 60

AGTGGCGAGC?TCCCTGGGTG?GTCTAAGTCC?TGAGTACAGG?ACAGTCGTCA?GTAGTTCGAC?120

GTGAGCAGAA?GCCCACCTCG?AGATGCTATG?TGGACGAGGG?CATGCCCAAG?ACACACCTTA?180

ACCCTAGCGG?GGGTCGCTAG?GGTGAAATCA?CACCACGTGA?TGGGAGCACG?ACCTGATAGG?240

GCGCTGCAGA?GGCCCACTAT?TAGGCTAGTA?TAAAAATCTC?TGCTGTTCAT?GGCACATGGA?300

GTTGAAT 307

Claims

1. CSFV TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit is characterized in that this test kit is made up of reagent, reference substance, water and PCR reaction tubes:

1) positive control: adopt the external rt of fragment of the about 300bp of swine fever crossdrift standard strain its non-coding region of cloned specific to obtain, concentration is 0.126～0.368 μ g/10 μ L; The primer that uses in the preparation process is:

SNP-F：GACGGCCGAACTGGGCTA；

SNP-R：ATTCAACTCCATGTGCCATGAA；

2) negative control: adopt no specificity cause of disease pig tonsil or submandibular lymph nodes, mesenteric lymph nodes; Add phosphate buffered saline buffer by 1: 5 times of volume; In mortar or tissue homogenizer, fully grind, the centrifugal 10min of 3000r/min gets supernatant and changes in the centrifuge tube subsequent use then;

3) Trizol lysate: the 40mL/ bottle, divide to be filled in the brown bottle, deposit subsequent use for 4 ℃;

4) TaqMan-MGB PCR reaction solution: each reaction comprises 10 * PCR damping fluid, 5 μ L, 2.5 μ M dNTP mixtures, 1.6 μ L, 10 μ M MGB-F, 3 μ L, 10 μ M MGB-R, 3 μ L, totally 12.6 μ L, and 50 reactions amount to 630 μ L, are distributed into 2 pipes;

Primer MGB-F and MGB-R are:

MGB-F：CATGCCCACA?GTAGGACTAG?CAAA；

MGB-R：GAACTACTGA?CGACTGTCCT?GTACTCA；

5) reaction enzymes: each reaction comprises SSIII ^TMThermoScript II 0.3 μ L, Taq HS archaeal dna polymerase 0.5 μ L, totally 0.8 μ L, 50 reactions amount to 45 μ L, are distributed into 1 pipe;

6) probe solution: probe MGB-P:5 '-FAM-CTAGCCGTAG TGGCGA-MGB-3 '; Modify by 5 '-FAM and-MGB-3 '; The synthetic probe is diluted to 5 μ M with 0.1% tetra-sodium diethyl ester water, each reaction needs 1.6 μ L, and 50 reactions amount to 90 μ L; Be distributed into 1 pipe ,-20 ℃ frozen subsequent use.