CN102676690B

CN102676690B - Reagent kit, method, primers and probe for quantitative detection of nucleic acid of swine fever virus

Info

Publication number: CN102676690B
Application number: CN 201110336911
Authority: CN
Inventors: 胡萌; 王业富; 周康平; 邱杨; 刘建丽
Original assignee: Wuhan University WHU
Current assignee: Hubei Vanderui Life Science Technology Co.,Ltd.
Priority date: 2011-10-31
Filing date: 2011-10-31
Publication date: 2013-12-18
Anticipated expiration: 2031-10-31
Also published as: CN102676690A

Abstract

The invention discloses a reagent kit, a method, primers and a probe for quantitative detection of nucleic acid of a swine fever virus and belongs to the technical field of biology. The reagent kit comprises PCR (polymerase chain reaction) liquid including DEPC (diethyl pyrocarbonate) treating water, Taq enzyme, M-MLV reverse transcriptase, RNase inhibitor, dNTP Mix, 10X one-step RT-PCR (reverse transcription-polymerase chain reaction) Buffer, MgC12 solution, the forward primer of the swine fever virus, the reverse primer of the swine fever virus and the LNA (locked nucleic acid) probe of the swine fever virus, wherein the forward primer of the swine fever virus refers to: 5'-AACGGYAGTGCTTTCTAYC-3', the reverse primer of the swine fever virus refers to: 5'-GTGGRAAAGGCTTCTCTC-3', and the LNA probe of the swine fever virus refers to: 5'-accActTctGtyCtac-3'. The reagent kit further comprises RNA (ribonucleic acid) extracting solution, negative quality control serum, working standard serum, positive quality control serum and critical positive quality control serum. The real-time fluorescent quantitative PCR technology is used for quantitatively detecting the nucleic acid of the swine fever virus, and accordingly the reagent kit has the advantages of specificity, sensitivity, rapidness and simplicity and convenience to operate.

Description

Pestivirus suis nucleic acid quantitative determination reagent kit, detection method, primer and probe thereof

Technical field

The present invention relates to technical field of biological, particularly a kind of Pestivirus suis nucleic acid quantitative determination reagent kit and detection method thereof.

Background technology

Pestivirus suis (Classical Swine Fever Virus, CSFV), be flaviviridae, and pestivirus, only have a serotype, but can be divided into a plurality of genotype in type.Virus particle has cyst membrane, and diameter is 40～50nm, and genome consists of the sub-thread strand RNA, only containing a great opening reading frame.For the diagnosis of CSFV, at present nucleic acid for target area be mainly 5 ' UTR, E2, NS4B and NS5B.The present invention determines that target gene is E2, and E2 is one of four kinds of structural protein C, Erns, E1 and E2, is one of primary structure glycoprotein on cyst membrane.Research simultaneously also shows that the E2 molecule is containing 4 antigenic structure territory A, B, C and D, and the A district is divided into again A1, A2, tri-subprovinces of A3, and on function, A1, B, C are the neutrality antigenic region, other are several be non-in and antigenic region.At present swine fever mainly in Asia, the countries and regions of Europe, Africa, Central and South America are popular.The swine fever epidemic situation presented again the trend of rising in China in recent years, and wide variation have also occurred its popular and characteristics of incidence, are tending towards complicated in clinical manifestation, so-called " atypia swine fever ", " mild swine fever " and " being with malicious sow syndrome " had occurred.At present swine fever immuning failure and disease atypia phenomenon generally occur in China, shows as heating, spiritual depressed, appetite stimulator, cough, ataxia, conjunctivitis and diarrhoea, perinatal death, stillborn foetus, miscarriage etc. more.Therefore be necessary the molecular epidemiology situation of swine fever is analyzed.E2 (gp55) is the antigenic glycoprotein gene of tool of CSFV, and is the most easy one of part of variation in full genome, can induce the neutralizing antibody of high titre, in protective immune response, plays a significant role.

In prior art, the method for quick of Pestivirus suis is as follows:

1, isolation of virus

For virus disease is diagnosed one of the most frequently used and extremely sensitive method.Isolated virus is further identified through electron microscope, immunological technique or molecular biology again.After roughly being operating as the sample that obtains virus and separate, viral lock out operation, inoculation, observe or additive method.Isolated virus can be used for prolonged preservation, the analyses such as antigenicity, genetic characteristics or drug susceptibility, but also have certain use restriction.The tissue system of at present the most frequently used isolated viral is generally MDCK, and the chicken embryo is the most frequently used live body.Most of strains all can be adapted to this cell, by pathological material of disease or other processing, are inoculated on clone, and 3～4 days visible CPE, show the virus separation.In general, virus is separated and to be thought a kind of classics that detect virus, accurate, responsive etiological diagnosis gold standard, and specificity and susceptibility are all higher, but comparatively time-consuming.

2, Electron Microscopy

Electronic Speculum has become one of conventional means of virus research, can show very intuitively copying and the process such as assembling of the structural changes of morphological structure, the existence of virus in host cell, host cell of virus particle and virus.Electron Microscopy divides conventional Electronic Speculum and immuno-electron microscope.The available electron microscope direct observing is to Pestivirus suis particle or infection site tissue.Conventional electron microscopy amount of samples is little, sample preparation speed is fast, observation and comparison is directly perceived, but it is lower to observe sensitivity, requires the virus quantity of sample large.And the susceptibility of the more conventional electron microscopy of immunoelectron microscopic method is high, but the sample preparation process is more complicated, and operator's technical ability is had relatively high expectations.Some novel methods and technology been have also have been researched and developed on this basis, as immunoelectron microscope or solid-phase immunity electron microscope, these methods are utilize antigen antibody reaction and observed under electron microscope by negative staining, sensitivity has promoted many relatively, but corresponding sample preparation process is more complicated, and operator's technical ability is had relatively high expectations.

3, Serologic test

Serology test is mainly to detect the antigen-antibody immunological marker thing produced in the Alphavirus course of infection, mainly comprises immunoperoxidase monolayer assay (IPMA), immunofluorescent test (IFA), enzyme immunoassay (EIA) and serum neutralization test etc.SD highly sensitive in electron microscope, but its specificity is low, and laboratory diagnosis aspect limitation is larger.In addition, because this technology builds on the basis of virus antigen identification, the antigen diversity of virus can exert an influence to the application of this technology.Simple fast comparatively in operation, but existing method lacks enough susceptibility and specificity, as can not be accurately distinguished Influenza A H1N1 and seasonal influenza, and can not detect the strain of new variation.

Immunopcroxidase monolayer assay (IPMA), be widely used in the epidemic disease viral diagnosis, and susceptibility and specificity are all relatively good, can be used for virus antigen detection, virus evaluation and Serum Antibody Detection.Indirect fluorescent antibody test indirect fluorescent antibody test (indirect fluorescent anti-body test, IFA) is carried out antigen antibody reaction on antigen-antibody for the mark fluorescent element.The microballoon immunization of new report is about to utilize the Identification of the antibodies virus that is incorporated into polystyrene microsphere, and susceptibility and specificity are all quite high, and, because this microballoon system can be sent the fluorescence of different colours, therefore, can detect 100 kinds of different antibody in theory, and reagent dosage is few simultaneously.This method is that to detect in the world epidemic disease virus-positive antibody general and than more sensitive serum detection method.The IFA specificity can reach 99%.IFA can determine the titre of antibody, antibody titers reach 16 or 20 can be judged to the positive.About EIA, its most widely used technology is enzyme linked immunosorbent assay (ELISA), its basic skills is that known antigen or antibody are adsorbed on to solid phase carrier (polystyrene micro-reaction plate) surface, the antigen antibody reaction of enzyme labelling is carried out at solid phase surface, with washing method by the free composition eccysis in liquid phase, add again the substrate colour developing, finally according to the color and luster depth, calculate the content of determined antigen or antibody.Detection method is divided into various ways, as indirect ELISA, seizure ELISA, blocking-up ELISA, sandwich ELISA etc.Detection of antigen ELISA specificity is stronger, operates fast and conveniently, can be applicable to pattern detection in enormous quantities, and the response spectrum of antibody detecting is wider than antigen.And serum neutralization test (serum neutralization test, SNT), divide two kinds of constant and trace, ultimate principle is to utilize complete virus to detect neutralizing antibody, WHO recommendation microneutralization, its susceptibility is much higher than blood clotting and suppresses (HI) test, but that neutralizing antibody occurs in serum is slower, is not suitable for early diagnosis.This method specificity is very strong, can distinguish the viral plant type of different virulence.This method is to estimate the unique objective believable method of Swinery immunity level of protection, is classical way, but complex operation, the time-consuming material that takes, safety and inspection technology are required high, less use now.Also have in addition SPRIA method, MEIA method, agar gel diffusion test (agar gel immunodifE2, ACID), blood clotting to suppress (HI) test, immune colloidal gold technique (Immune colloidal gold technique) etc.

4, molecular biology method

The detection of nucleic acids susceptibility of virus is high, and sense cycle is short, and application is comparatively extensive at present.Using 3 kinds of maximum technology in molecular diagnosis is PCR method, NASBA (nucleic acid sequence-based amplification) and DNA chip.

The PCR method is by two sections specificity oligonucleotide primers, and in vitro through archaeal dna polymerase catalysis, the section between the DNA sequence dna of amplification and two primer complementations, detect in sample whether this sequence is arranged.PCR is more responsive than serological method, but specificity and repeatability are lower, if the methods such as the nucleic acid hybridizations such as nexus dot blot, micropore plate hybridization, filter membrane nucleic acid probe hybridization and enzyme linked immunological are analyzed the PCR product, sensitivity and specificity all can improve greatly.

Development along with modern nucleic acid, be based upon nucleic acid amplification technologies PCR and correlation technique on gene level, due to its hypersensitivity and high specific, be used widely in the clinical detection of H1N1virus, highly pathogenic PRRSV and Pestivirus suis, become the main method of laboratory diagnosis.These take PCR as basic detection method, all need spended time to carry out aftertreatment to pcr amplification product, the target dna molecule of pcr amplification product middle and high concentration can pollute whole lab space with aerocolloidal form, high sensitivity due to PCR, even can detect the template concentrations of 10 copies in reaction system, thereby bring serious false positive may to PCR experiment from now on; Conventional PCR method is the end point determination method, because the PCR reaction has plateau, can't carry out the accurate quantification detection to starting template according to end product.Develop on this basis competitive PCR (competitive PCR), nest-type PRC (nested PCR), heminested PCR (semi-nested PCR), multiplex-nested PCR (multiplex nested PCR), restrictive fragment length polymerphism PCR (RELP-PCR), multiplex PCR etc.

Reverse transcriptase polymerase chain reaction (RT-PCR method) is the very strong technology of a kind of sensitivity, can detect the very RNA of low copy number.RT-PCR is widely used in the diagnosis of inherited disease, and can be for the content of certain RNA of Quantitative Monitoring.The principle of setting up the virus RT-PCR detection method is the special and conservative gene fragment of amplicon virus, has very high specificity and susceptibility.Sensitivity may, because existing its inhibition lower than expection in sample, progressively develop into " gold standard " that virus detects at present.In all ordinary methods, this reaction is the sensitiveest.

The Quantitative reverse transcription PCR method, this method adds fluorophor in the PCR reaction system, utilize the whole PCR process of fluorescent signal accumulation Real-Time Monitoring, finally by typical curve, unknown template is carried out the method for quantitative analysis, two kinds of minute single stage method and two-step approachs, tool high-throughput, can be quantitative, the unit testing cost is lower, stability, accuracy, reproducible, and level of automation high.And single tube sealing detects and does not need subsequent disposal and greatly reduce the possibility of crossed contamination.Its sense cycle is short.Susceptibility is 10～100 times of traditional RT-PCR.And use efficiency and the restriction that specific probe can further high detection, use according to research reports the detectability of the RRT-PCR method of TaqMan probe can reach 0.006 TCID ₅₀/ mL～0.2TCID ₅₀/ mL (50%tissue culture infectious dose, tissue culture infective dose).And application MGB probe can reduce background fluorescence, further improve susceptibility, detectability can reach 0.08EID ₅₀or 0.006TCID ₅₀(approximately 5 RNA copies), linearity range is 5～5 * 10 ⁸copy.The application of probe minimizes false positive.

Rely on amplification (the Nucleic acid sequence-based amplification of nucleotide sequence, NASBA) be a kind of fast, the RNA amplification technique of isothermal, whole reaction depends on AMV reversed transcriptive enzyme, T7RNA polymerase and nuclease H (RNase H) and jointly cooperates and complete, do not need specific apparatus, do not need temperature cycle, to be transcribed into basis, the continuous amplification of strand Nucleotide, its reaction product is single stranded RNA.After the few rib thuja acid probe of the electrochemiluminescence of the capturing probe on amplified production and magnetic bead and ruthenium mark (ECL probe) hybridization, form mixture, through NucliSens reader direct-detection electrochemiluminescence intensity.This method cycle is shorter, and sensitivity is suitable with the chicken embryo culture.NASBA amplification does not need complicated temperature variation, and its amplification efficiency is higher than traditional PCR, and its susceptibility will be higher than normal PCR, but existing sensitivity assessment is the experiment in vitro result, need to carry out the thorough assessment of direct-detection clinical sample.In the technical real-time NASBA technology that further develops out of NASBA, the susceptibility and the specificity that detect are improved greatly, reach～0.1 TCID, be equivalent to RRT-PCR.The positive rate that detects clinical sample reaches 64% higher than cell culture method and direct immunofluorescence.The NASBA technology has the similar advantage of RRT-PCR, and, because do not need denatured DNA, even if there is genomic dna to pollute, also can go out purpose RNA by specific amplification; But also be a kind of high-throughout method, can detect 50 samples simultaneously.Be highly suitable for the examination of extensive sample.The amplified production of NASBA technology is the RNA molecule, and the user can select different detection methods as required, as Electrochemiluminescince and enzyme-linked method etc.And different from the product D NA molecule of PCR, the RNA molecule is difficult for laboratory apparatus and environment, the false positive results of having avoided product crossed contamination laboratory apparatus, operating environment to cause.But the shortcoming equal testing cost that is unit will be higher than RRT-PCR, thus laboratory with good conditionsi, optimal technology or RRT-PCR.

Biochip technology (gene chips) claims again DNA chip (DNA chips) or biochip (biological chips).Its principle is using a large amount of specific oligonucleotide or gene fragment as probe, arrange regularly and to high-density, be fixed on a very little upholder as silicon chip, slide etc., then press basepairing rule hybridization with fluorescent mark sample nucleic acid to be checked, detect hybridization signal intensity by the laser co-focusing fluorescing system after washing, thereby more as calculated the machine analyzing and processing data obtain the bioinformation of sample.Specific probe is fixed on slide glass, in pcr amplification Pestivirus suis somatotype when zone, applies fluorescently-labeled dNRP and make the PCR product with fluorescence, by the hybridization point by certain type place after PCR product and Pestivirus suis chip hybridization, occur that fluorescence determines.CDNA or the synthetic specific oligonucleotide probe of the viral range gene that RT-PCR is obtained solidify in chip, utilize nucleic acid hybridization technique can build the chip platform that detects virus type and hypotype, the cDNA that CY3, CY5 mark are to be checked or the DNA of amplification, with chip hybridization, detect viral nucleic acid or further differentiate amplified production in mixed system.Single hybridization can detect multiple virus in theory, and the potential screening of carrying out thousands of kinds of nucleotide sequences.Can be used for the genovariation of CSFV, the detection of gene type.This technology has that level of automation is high, highly sensitive, the testing goal molecular weight is few, the efficiency advantages of higher, but also has the defects such as cost is high, false positive rate is higher, poor repeatability.At present biochip technology in the detection of influenza also well below other detection method, and testing cost and hardware requirement all higher.From practical application, have got long long way to go.

Also has in addition the isothermal duplication (loop-mediated isothermal amplification, LAMP) of Situ Hybridization technology (in situ hybridization, ISH), nucleic acid probe method, ring mediation etc.

Summary of the invention

Purpose of the present invention provides a kind of Pestivirus suis nucleic acid quantitative determination reagent kit.

To achieve these goals, at first the present invention provides a kind of Pestivirus suis nucleic acid quantification to detect primer and probe, comprises following sequence set:

1) comprise following forward primer, one group of sequence of reverse primer and fluorescent probe:

Forward primer: 5 '-AACGGYAGTGCTTTCTAYC-3 ';

Reverse primer: 5 '-GTGGRAAAGGCTTCTCTC-3 ';

Fluorescent probe: 5 '-ACC acT tcT gtY ctCA-3 ', under be designated as LNA and modify.

2) above-mentioned 1), 5 ' of sequence end and/or 3 ' end have one group of sequence of the nucleotide fragments of prolongation;

3) with above-mentioned 1) or 2) in the homology of sequence be greater than 85%, and there is specific one group of sequence;

4) with above-mentioned 1) or 2) or 3) in one group of sequence of base complementrity of sequence;

5) above-mentioned 1), 2) and 3) in any three or more sequence form there is forward primer, reverse primer and with it to the sequence set of corresponding fluorescent probe;

Wherein, Y=in described sequence (C/T), R=(A/G); Wherein, the 5 ' terminal modified fluorescence dye of fluorescent probe can be selected from: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5; The 3 ' terminal modified fluorescence dye is selected from: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.5 ' end and the 3 ' end of preferred described fluorescent probe are modified with fluorophor FAM, BHQ1 respectively.

Further, the invention provides a kind of Pestivirus suis nucleic acid quantitative determination reagent kit that contains above-mentioned primer and probe.

The mentioned reagent box also can further contain one or more in following reagent:

(1) PCR reaction solution;

(2) RNA extracting solution;

(3) negative quality control product, for not containing the PSG-TS vector plasmid DNA fragment of E 2 gene of Classical Swine Fever;

(4) positive quality control product, for containing 1.0 * 10 ⁶copy/ml Pestivirus suis genomic DNA fragment;

(5) critical positive quality control product, for containing 1.0 * 10 ⁴copy/ml Pestivirus suis genomic DNA fragment;

(6) working standard.

Wherein, described PCR reaction solution, comprise that DEPC processes water, the HotStart Taq archaeal dna polymerase with 5 ' → 3 ' circumscribed activity, M-MLV ThermoScript II, RNase inhibitor, dNTP Mix, 10 * single stage method PCR Buffer, MgCl ₂solution, described primer and probe are dissolved in the PCR reaction solution.

The concrete proportioning of described each component concentration of PCR reaction solution can be: DEPC processes water 23.6 μ l; The warm start Taq enzyme 0.4 μ l of 5U/ μ l; 200U/ μ l M-MLV ThermoScript II 1 μ l; The dNTP Mix 2 μ l of 10mmol/l; 10 * PCR Buffer, 5 μ l; The MgCl of 25mmol/l ₂solution usage 9 μ l; The Pestivirus suis forward primer consumption 1.5 μ l of 10 μ mol/l; The Pestivirus suis reverse primer consumption 1.5 μ l that concentration is 10 μ mol/l; The Pestivirus suis probe consumption 1 μ l that concentration is 10 μ mol/L.

Wherein, described RNA extracting solution is divided into solution 1, solution 2, and solution 3, solution 4 and solution 5, wherein solution 1 is Trizol reagent, and solution 2 is chloroform, and solution 3 is Virahol, and solution 4 is 75% ethanol, solution 5 is processed water for DEPC.Described Trizol reagent main component is phenol, has also added in addition oxine, guanidinium isothiocyanate, beta-mercaptoethanol etc.; Described chloroform is trichloromethane, sterling; Virahol is sterling; Described alcohol concn is 75%; It is 0.1%DEPC water that described DEPC processes water, through autoclaving, simultaneously also deactivation virose DEPC.

Wherein, described working standard comprises:

A, working standard 1, contain 1.0 * 10 ⁷the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml;

B, working standard 2, contain 1.0 * 10 ⁶the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml;

C, working standard 3, contain 1.0 * 10 ⁵the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml;

D, working standard 4, contain 1.0 * 10 ⁴the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml.

The invention process example also provides the detection method of utilizing described test kit to detect Pestivirus suis nucleic acid, comprises the following steps:

(1) sample pretreatment: sample can be serum, Nasopharyngeal swabs, throat swab or its hetero-organization;

Specifically can carry out in the following manner the pre-treatment of sample:

Serum sample: collect 5ml venous blood and put (not containing antithrombotics) in the screw socket plastic centrifuge tube of 10ml belt washer, with 1, the centrifugal 10min of 000g, draw serum under aseptic condition, and divide (100 μ l/ pipe) in the screw socket plastics serum tube that installs to several 1ml belt washers, in 48h, refrigeration (4～8 ℃) is transported to laboratory.

Throat swab and Nasopharyngeal swabs sample: first with physiological saline, the cotton swab adhesional wetting (is not transported to liquid with the sample that contains penicillin, with hypo-allergenic), the Nasopharyngeal swabs collection is cotton swab to be parallel to maxilla insert nostril, stops several seconds, absorb secretory product, swab the bilateral nostril; The throat swab collection is to exert oneself wiping bilateral pharynx rear wall position, should avoid touching tongue by the cotton swab appropriateness.After having adopted throat swab and Nasopharyngeal swabs, rapidly swab is put into to the screw socket plastic centrifuge tube of the 10ml belt washer that contains 3ml sample transportation liquid, at the cotton swab bar that fractures near top end, screwed the pipe lid.In 48h, refrigeration (4～8 ℃) is transported to laboratory.As virus-free preservation liquid, also available physiological saline substitutes.

The pathological material of disease tissue: gather fresh pathological material of disease, as the internal organ of pig, 1～2cm is square gets final product for size, leaves in the container of sterilizing, if for histopathologic examination, will gather focus and close on healthy tissues, and depositing in 10% formalin solution.The sample gathered is sent to laboratory in 24h.

The prolonged preservation serum sample is stored in refrigerator below-20 ℃, and swab and pathological material of disease tissue are stored in-70 ℃ or following refrigerator.

(2) RNA extracts: get processed sample 200 μ l, add 600 μ l solution 1, fully concussion mixes, the standing 10min of room temperature; Add 150 μ l solution 2, fully concussion mixes again, the standing 5min of room temperature, the centrifugal 15min of 13,000rpm, get supernatant and put in the solution 3 of equal-volume precooling, gentleness is put upside down and is mixed, standing 10min, 12, the centrifugal 10min of 000rpm, abandon supernatant, add 1,000 μ l 75% solution 4 washing precipitation 2 times, the centrifugal 5min of 8,000rpm.Remove supernatant, dry 2～5min, add 15～30 μ l solution 5 and dissolve ,-80 ℃ of preservations;

(3) application of sample: to the sample added respectively in the PCR reaction tubes that 45 μ l PCR reaction solutions are housed after processing, negative quality control product, positive quality control product, critical positive quality control product, each 5 μ l of working standard, build the pipe lid, centrifugal 10 seconds of 5,000rpm;

(4) pcr amplification: each reaction tubes is put into to the reactive tank of quantitative fluorescent PCR instrument, mark fluorescent radical species, sample title and type are set, by following condition, carry out pcr amplification;

42 ℃ of 60min, 1 circulation;

94 ℃ of 5min, 1 circulation;

94 ℃ of 30s, 58 ℃ of 45s, 5 circulations;

94 ℃ of 30s, 58 ℃ of 45s, 35 circulations; Collect fluorescent signal, in the end of a period of the 4th step of response procedures, read fluorescent value.

(5) analyze judgement: the Ct value be less than 28 positive; The Ct value be greater than 32 negative; The Ct value be more than or equal to 28 and be less than or equal to 32 for the critical positive.

When needs drawing standard curve, separately get 4 reaction tubess, directly add the working standard 5 μ l of different concns gradient, the centrifugal 10s of 5,000rpm, carry out the quantitative fluorescent PCR reaction together with sample.

The beneficial effect that the technical scheme that the invention process example provides is brought is: test kit of the present invention utilizes specific LNA probe to detect Pestivirus suis, after having detected, without the electrophoresis of uncapping, has avoided product pollution to reach the injury to lab assistant.

The present invention uses the LNA probe, also available MGB probe, AllGlo ^tMprobe replaces.

The present invention has realized the leap of PCR from qualitative to quantitative, and compare with conventional PCR, detect and overcome amplified production end point determination existing " platform effect " impact quantitative on product in real time, it has specificity, sensitivity and the accuracy (as shown in Figure 5, Figure 6) of height, and technological operation is easy, level of automation is high, owing to adopting the stopped pipe operation, do not need the PCR product postprocessing, effectively solve the characteristics such as PCR pollution problem, reliable results.Simultaneously, adopt reverse transcription and fluorescence quantitative PCR method are combined, greatly simplified experimental procedure, be significant in actually operating and popularization.

The accompanying drawing explanation

Fig. 1 is the amplification curve of the embodiment of the present invention 2;

Fig. 2 is the amplification curve of the embodiment of the present invention 3;

Fig. 3 is the typical curve of making of working standard;

Fig. 4 is the amplification curve of the embodiment of the present invention 4;

Fig. 5, Fig. 6 are respectively amplification curve and the typical curves of this EXPERIMENTAL EXAMPLE 5;

Fig. 7 is PSG-TS vector construction figure.

In figure: the X-coordinate of Fig. 1, Fig. 2, Fig. 4, Fig. 5 means: mean cycle number (Cycle number), ordinate zou means: fluorescent value (Delta Rn); Fig. 3, Fig. 6 ordinate zou mean: the Ct value.

Embodiment

For making the purpose, technical solutions and advantages of the present invention clearer, below in conjunction with accompanying drawing, embodiment of the present invention is described further in detail.

The composition of embodiment 1 test kit

This test kit contains: the PCR reaction solution, it comprises HotStart Taq archaeal dna polymerase, M-MLV ThermoScript II, dNTP Mix, 10 * single stage method PCRBuffer, MgCl that DEPC processes water, has 5 ' → 3 ' circumscribed activity ₂solution, Pestivirus suis forward primer, Pestivirus suis reverse primer, Pestivirus suis LNA probe; The RNA extracting solution is divided into solution 1, solution 2, solution 3, solution 4 and solution 5.Solution 1 is Trizol reagent, and solution 2 is chloroform, and solution 3 is Virahol, and solution 4 is 75% ethanol, and solution 5 is processed water for DEPC; Negative quality control product, for not containing the plasmid DNA fragment of E 2 gene of Classical Swine Fever; Positive quality control product is high density Pestivirus suis genomic DNA fragment; Critical positive quality control product is lower concentration Pestivirus suis gene DNA fragment; Working standard, be the PSG-TS recombinant plasmid of the nucleotide fragments of 127 base pairs containing E 2 gene of Classical Swine Fever, and this plasmid is bred in bacillus coli DH 5 alpha;

The manufacture of test kit:

1. reagent

Reagent used in this test kit manufacturing processed is mainly purchased from the large generation bio tech ltd of Sangon Biotech (Shanghai) Co., Ltd. and Jiangsu.

2.PCR reaction solution preparation

(1) primer and probe design and synthetic:

Select pig plague virus specific conservative gene raq gene as the target detect gene, by American National biotechnology information center (NCBI) (sequences h ttp: //www.ncbi.nlm.nih.gov), choose and download 39 sequences of representational E 2 gene of Classical Swine Fever, use MAGA 4.0 softwares to compare, select one section relative conserved sequence in gene regions, sequence is as shown in SEQ ID NO.4 in sequence table: 5 '-AACGGTAGTGCTTTCTACCTAGTCTGCCCAAGAGGATGGACAGGTGTCATAGAGTG CACGGCAGTAAGCCCCACAACCTTGAGAACAGAAGTGGTGAAGACCTTCAAGAGAG AGAAGCCTTTCCCAC-3 ', utilize the special designing software Beacon Designer 7.0 design primers of real-time TaqMan quantitative fluorescent PCR, probe sequence, primer, probe sequence not only will meet indices in software, and to guarantee the Pestivirus suis primer, probe sequence front 100 sequences of BLAST comparison matching result on NCBI are 100%, front 500 sequences are tending towards 100% (can use the degeneracy base) as far as possible.In the present invention, the 5 ' terminal modified fluorescence dye of Pestivirus suis probe can be selected from: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5; The 3 ' terminal modified fluorescence dye can be selected from: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.In the present embodiment, the fluorescence report group is designed to FAM, and the excitation wavelength of FAM is 495nm, and the reception wavelength is 521nm, and cancellation group is designed to BHQ1.

Design result is as shown in the table:

Title	Base	The purifying mode	Sequence (5 '-3 ')
				Pestivirus suis-F	21bp	PAGE	AACGGYAGTGCTTTCTAYC
Pestivirus suis-R	21bp	PAGE	GTGGRAAAGGCTTCTCTC
				Pestivirus suis-P	16bp	PAGE	FAM-ACC ACT TCT GTY CTCA-BHQ 1

Annotate: " Y ", " R " are for annexing base, Y=(C/T), R=(A/G).

In table: F:forward, forward; Pestivirus suis-F means the Pestivirus suis forward primer.

R:reverse, oppositely; Pestivirus suis-R means the Pestivirus suis reverse primer.

P:probe, probe; Pestivirus suis-P means the Pestivirus suis probe, and probe both can be the TaqMan-MGB probe and also can be the LNA probe, in table, is the LNA probe, and subscript is partly modified for LNA.

FAM: fluorescence report group.

BHQ1: fluorescent quenching group.

According to the design result of upper table, entrust Jiangsu large generation bio tech ltd synthetic primer and probe.

(2) PCR reaction solution preparation: DEPC processes water 23.1 μ l; The warm start Taq enzyme 0.4 μ l of 5U/ μ l; 200U/ μ l M-MLV ThermoScript II 1 μ l; Rnase inhibitor 0.5 μ l; The dNTP Mix 2 μ l of 10mmol/l; 10 * single stage method RT-PCR Buffer, 5 μ l; The MgCl of 25mmol/l ₂solution usage 9 μ l; The Pestivirus suis forward primer consumption 1.5 μ l of 10 μ mol/l; The Pestivirus suis reverse primer consumption 1.5 μ l that concentration is 10 μ mol/l; The Pestivirus suis probe consumption 1 μ l that concentration is 10 μ mol/L.

3. negative quality control product preparation: the PSG-TS plasmid DNA fragment that does not contain E 2 gene of Classical Swine Fever

Get not PSG-TS plasmid solution containing E 2 gene of Classical Swine Fever in the pre-treatment of sample area in preparation, quantitatively being diluted to concentration is 1 * 10 ⁷copy/ml (turbidimetry), draw plasmid solution in centrifuge tube, mixes, and directly draws 5 μ l and make template.

4. positive quality control product preparation: high density Pestivirus suis genome cDNA fragment

Get the bhk cell suspension 200 μ l containing Pestivirus suis, extract RNA, reverse transcription is cDNA, uses spectrophotometric instrumentation A ₂₆₀quantitatively, then according to formula, convert and be diluted to 1.0 * 10 ⁶copy/ml, can be used as the positive quality control product template.

5. critical positive quality control product preparation: lower concentration Pestivirus suis genome cDNA solution

Get the bhk cell suspension 200 μ l containing Pestivirus suis, extract RNA, reverse transcription is cDNA, uses spectrophotometric instrumentation A ₂₆₀quantitatively use spectrophotometric instrumentation A ₂₆₀quantitatively, then according to formula, convert and be diluted to 1.0 * 10 ⁴copy/ml, can be used as critical positive quality control product template.

6.RNA extracting solution is divided into solution 1, solution 2, solution 3, solution 4 and solution 5.Solution 1 is Trizol reagent, and solution 2 is chloroform, and solution 3 is Virahol, and solution 4 is 75% ethanol, and solution 5 is processed water for DEPC.；

7. working standard 1, containing having an appointment 1.0 * 10 ⁷the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml;

8. working standard 2, containing having an appointment 1.0 * 10 ⁶the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml;

9. working standard 3, containing having an appointment 1.0 * 10 ⁵the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml;

10. working standard 4, containing having an appointment 1.0 * 10 ⁴the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml;

Working standard, the PSG-TS recombinant plasmid of nucleotide fragments (SEQ ID NO.4) that determines 127 base pairs of gene raq gene for the pathogenesis that contains Pestivirus suis is relevant (entrusts Bio Basic Inc. synthetic, the carrier collection of illustrative plates as shown in Figure 7), this plasmid is bred alkaline lysis method of extracting in bacillus coli DH 5 alpha, through DNA purification kit purifying, spectrophotometer is quantitative, then according to formula, converts and is diluted to 1.0 * 10 ⁹copy/ml ,-20 ℃ of preservations.Storing concentration is 1.0 * 10 ⁹copy/ml, used front with stroke-physiological saline solution or 0.01mol/l PBS10 times doubling dilution.Working concentration is respectively 1.0 * 10 ⁷copy/ml, 1.0 * 10 ⁶copy/ml, 1.0 * 10 ⁵copy/ml and 1.0 * 10 ⁴copy/ml, before reaction, the centrifugal 30s of 12,000rpm, get supernatant liquor and make template.

Test kit of the present invention can be configured according to following table (24 person-portions/box):

Test kit of the present invention stores-10 ℃ ± 5 ℃ lucifuges, avoids multigelation; Validity period 6 months.

Applicable instrument (ABI7500, ABI7300, Bio-Rad iQ5 ^tM, Stratagene Mx3000P, StratageneMx3005P, reach peace 7000) etc.

Embodiment 2

Detect the method for Pestivirus suis nucleic acid on ABI 7300 quantitative real time PCR Instruments with test kit of the present invention

(1) collected specimens: gather serum, Nasopharyngeal swabs, throat swab or pathological material of disease tissue;

(2) RNA extracts: get processed sample 200 μ l, add 600 μ l solution 1, and, fully concussion mixes, the standing 10min of room temperature; Add 150 μ l solution 2, fully concussion mixes again, the standing 5min of room temperature, the centrifugal 15min of 13,000rpm, get supernatant and put in the solution 3 of equal-volume precooling, gentleness is put upside down and is mixed, standing 10min, 12, the centrifugal 10min of 000rpm, abandon supernatant, add 1,000 μ l 75% solution 4 washing precipitation 2 times, the centrifugal 5min of 8,000rpm.Remove supernatant, dry 2～5min, add 15～30 μ l solution 5 and dissolve ,-80 ℃ of preservations;

(3) application of sample: sample, negative quality control product, positive quality control product, critical positive quality control product 5 μ l to adding respectively in the PCR reaction tubes that 45 μ l PCR reaction solutions are housed after processing, build the pipe lid, the centrifugal 10s of 5,000rpm;

DEPC processes water 23.1 μ l; The warm start Taq enzyme 0.4 μ l of 5U/ μ l; 200U/ μ l M-MLV ThermoScript II 1 μ l; RNase inhibitor 0.5 μ l; The dNTP Mix 2 μ l of 10mmol/l; 10 * single stage method RT-PCRBuffer, 5 μ l; The MgCl of 25mmol/l ₂solution usage 9 μ l; The Pestivirus suis forward primer consumption 1.5 μ l of 10 μ mol/l; The Pestivirus suis reverse primer consumption 1.5 μ l that concentration is 10 μ mol/l; The Pestivirus suis probe consumption 1 μ l that concentration is 10 μ mol/l.

Pestivirus suis FQ-PCR reaction system is as following table:

(4) pcr amplification: the reactive tank of each reaction tubes being put into to the quantitative fluorescent PCR instrument, mark fluorescent radical species, sample title and type are set, (the fluorescence report group is FAM to the LNA probe that selection will be used, the fluorescent quenching group is BHQ1), the definition sample well: negative quality control product selects NTC; Sample to be checked, positive quality control product and critical positive quality control product are selected Unknown.

According to the form below carries out pcr amplification;

Fluorescent value is read in end of a period in the 3rd step of response procedures;

(5) analyze judgement:

The Ct value be less than 28 positive; The Ct value be greater than 32 negative; The Ct value be greater than and equal 28 and be less than and equal 32 for the critical positive.As shown in Figure 1, concrete detected result sees the following form the test-results of the embodiment of the present invention 2:

Sequence number	Ct
		1	Undet.
2	5.22859

3	Undet
		4	8.25307
5	12.0279
		6	16.3983
7	20.4346
		8	24.4193
9	30.484
		10	27.7649

Wherein,

sample

2,4,5,6,7,8,10 in positive scope, positive sample; Sample 9, in critical positive scope, is critical positive sample;

Sample

1,3 in negative scope, negative sample.

Embodiment 3

Detect the Pestivirus suis nucleic acid of clinical definite sample according to the method for embodiment 2 with test kit of the present invention.Sample source * * sample that hospital patient is made a definite diagnosis, as shown in Figure 2, detected result sees the following form the test-results of the embodiment of the present invention 3:

Sequence number	Ct
			1	13.4396
2	20.888
		3	23.0571
4	17.557
		5	Undet
6	13.916
		7	Undet

Clinical

definite sample

1,2,3,4,6 positive samples, 5,7 negative samples, detected result meets, and accuracy rate is 100%.

Embodiment 4

While utilizing test kit of the present invention to carry out detection by quantitative, need the drawing standard curve, except 8 sample reaction tubess, separately get 3 reaction tubess and be respectively negative quality control product, positive quality control product, critical positive quality control product, also have 4 reaction tubess, give the corresponding working standard 5 μ l that add different concns gradient in test kit in each reaction tubes, the centrifugal 10s of 5,000rpm, take working standard as template, according to the method preparation reaction system of embodiment 1, then put into the instrument sample cell and carry out pcr amplification.Working standard selects Standard.For Standard, need in the Quantity hurdle, input respectively 1.0 * 10 ⁷copy/ml, 1.0 * 10 ⁶copy/ml, 1.0 * 10 ⁵copy/ml, 1.0 * 10 ⁴copy/ml.

Use instrument ABI 7300 reference results:

If a. not S-type or Ct value>32 of amplification curve, judge that sample Pestivirus suis DNA content is less than the detection lower limit;

If not obvious or 28≤Ct value≤32 of amplification curve S type b., sample Pestivirus suis DNA content is in critical positive scope;

If carry out quantitatively by the following method S-type and Ct value<28 of amplification curve c.:

If the C of sample (" C " means concentration of specimens or content)<5.0000E+01, the Pestivirus suis DNA total content of this sample<50 gene copies;

If the 5.0000E+01≤C of sample≤5.0000E+07, the Pestivirus suis DNA of this sample total content=C gene copy;

If the C>5.0000E+07 of sample, the Pestivirus suis DNA of this sample total content>5.0000E+07 gene copy detects diluted sample again to linearity range;

As shown in Figure 3, ■ is standard substance to the typical curve of drawing according to following table.

Working standard	Ct	C (starting point concentration)
			1.0e+007	11.532	1.0e+007
1.0e+006	15.9538	1.0e+006
			1.0e+005	19.9872	1.0e+005
1.0e+004	23.8196	1.0e+004
			slope	-4.089634	-
intercept	40.316143	-
			R ²	0.998942	-

As shown in Figure 4, the present embodiment working standard detects the amplification curve of the embodiment of the present invention 4 together with 8 samples, according to the Ct value that obtains after amplification, looks into the typical curve of Fig. 3, then through conversion, finally obtain 8 samples starting point concentration as following table.

Detected result sees the following form: data of the present invention are accurate to 0.01.

Sequence number	Ct
		Positive quality control product	15.9538
Critical positive quality control product	23.8196
		Negative quality control product	Undet
1	20.4259
		2	19.6309
3	24.7937
		4	24.0318
5	23.0332
		6	27.8687
7	28.2541
		8	Undet

Experimental example 5

Substantially with embodiment 4, working standard concentration is adjusted to 1.0 * 10 ⁹copy/ml, 1.0 * 10 ⁸copy/ml, 1.0 * 10 ⁷copy/ml, 1.0 * 10 ⁶copy/ml, 1.0 * 10 ⁵copy/ml, 1.0 * 10 ⁴copy/ml, 1.0 * 10 ³copy/ml.

The typical curve of drawing according to following table as shown in Figure 6

Working standard	Ct	C (starting point concentration)
			1.0e+009	4.9559	1.0e+009
1.0e+008	7.4584	1.0e+008
			1.0e+007	11.1139	1.0e+007
1.0e+006	14.0031	1.0e+006
			1.0e+005	17.9509	1.0e+005
1.0e+004	20.2892	1.0e+004
			1.0e+003	24.1042	1.0e+003
slope	-3.212254	-
			intercept	33.541470	-
R ²	0.997407	-

Amplification curve all is smooth " S " type, and typical curve is straight line, and the Ct value is between 4-25, and the Ct value difference of each concentration gradient is about 3 left and right.

The foregoing is only preferred embodiment of the present invention, in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, be equal to replacement, improvement etc., within all should being included in protection scope of the present invention.

Sequence table

<110 > Wuhan University

<120 > Pestivirus suis nucleic acid quantitative determination reagent kit, detection method, primer and probe thereof

<130>

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213 > artificial sequence

<220>

<221> misc_feature

<222> (6)..(6)

<223 > Y is C or T

<220>

<221> misc_feature

<222> (18)..(18)

<223 > Y is C or T

<400> 1

aacggyagtg ctttctayc 19

<210> 2

<211> 18

<212> DNA

<213 > artificial sequence

<220>

<221> misc_feature

<222> (5)..(5)

<223 > R is A or G

<400> 2

gtggraaagg cttctctc 18

<210> 3

<211> 16

<212> DNA

<213 > artificial sequence

<220>

<221> misc_feature

<222> (12)..(12)

<223 > Y is C or T

<400> 3

accacttctg tyctca 16

<210> 4

<211> 127

<212> DNA

<213> Classical Swine Fever Virus

<400> 4

aacggtagtg ctttctacct agtctgccca agaggatgga caggtgtcat agagtgcacg 60

gcagtaagcc ccacaacctt gagaacagaa gtggtgaaga ccttcaagag agagaagcct 120

ttcccac 127

Claims

1. a Pestivirus suis nucleic acid quantification detects primer and probe, comprises following sequence set:

Forward primer: 5 '-AACGGYAGTGCTTTCTAYC-3 ',

Reverse primer: 5 '-GTGGRAAAGGCTTCTCTC-3 ',

Fluorescent probe: 5 '-ACC acT tcT gtY ctCA-3 ', wherein be designated as down LNA and modify;

Wherein, in described sequence, Y is C or T, and R is A or G.

2. according to the primer described in claim 1 and probe, it is characterized in that, wherein 5 ' of fluorescent probe the terminal modified fluorescence dye is selected from: FAM, HEX, TET, JOE, VIC, ROX, Cy3 or Cy5; The 3 ' terminal modified fluorescence dye is selected from: TAMRA, Eclipse, BHQ1, BHQ2, BHQ3 or DABCYL.

3. the Pestivirus suis nucleic acid quantitative determination reagent kit that contains the described primer of claim 1 or 2 and probe.

4. test kit according to claim 3, is characterized in that, this test kit also comprises one or more in following reagent:

(1) PCR reaction solution;

(2) RNA extracting solution;

(6) working standard.

5. test kit according to claim 4, it is characterized in that, wherein, (1) PCR reaction solution, comprise HotStart Taq archaeal dna polymerase, M-MLV ThermoScript II, RNase inhibitor, dNTP Mix, 10 * PCR Buffer, MgCl that DEPC processes water, has 5 ' → 3 ' circumscribed activity ₂solution, described primer and probe are dissolved in the PCR reaction solution.

6. test kit according to claim 4, is characterized in that, described RNA extracting solution is divided into solution 1, solution 2, solution 3, solution 4 and solution 5, wherein solution 1 is Trizol reagent, solution 2 is chloroform, solution 3 is Virahol, and solution 4 is 75% ethanol, and solution 5 is processed water for DEPC.

7. test kit according to claim 4, is characterized in that, described working standard comprises:

A, working standard 1, contain 1.Ox10 ⁷the non-infectious DNA fragment of the E 2 gene of Classical Swine Fever of copy/ml;

B, working standard 2, contain 1.O * 10 ⁶the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml;

C, working standard 3, contain 1.O * 10 ⁵the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml;

D, working standard 4, contain 1.O * 10 ⁴the non-infectious DNA fragmentation of the E 2 gene of Classical Swine Fever of copy/ml.

8. test kit according to claim 5, is characterized in that, the proportioning of described each component concentration of PCR reaction solution is: DEPC processes water 23.1 μ l; The warm start Taq enzyme 0.4 μ l of 5U/ μ l; 200U/ μ lM-MLV ThermoScript II 1 μ l; Rnase inhibitor 0.5 μ l; The dNTP Mix2 μ l of 10mmol/1; 10 * single stage method RT-PCR Buffer5 μ l; The MgCl of 25mmol/1 ₂solution usage 9 μ l; The Pestivirus suis forward primer consumption 1.5 μ l of 10 μ mol/l; The Pestivirus suis reverse primer consumption 1.5 μ l that concentration is 10 μ mol/l; The Pestivirus suis probe consumption 1 μ l that concentration is 10 μ mol/l.