CN101775443B

CN101775443B - LAMP kit for detecting PRV and preparation method thereof

Info

Publication number: CN101775443B
Application number: CN2010100313101A
Authority: CN
Inventors: 张莉; 鄢明华; 李秀丽; 王东; 任卫科; 韩伟; 孙英峰
Original assignee: Tianjin Institute of Animal Husbandry and Veterinary Science
Current assignee: Tianjin Academy of Agricultural Sciences
Priority date: 2010-01-06
Filing date: 2010-01-06
Publication date: 2012-04-25
Anticipated expiration: 2030-01-06
Also published as: CN101775443A

Abstract

The invention relates to a LAMP kit for detecting PRV, an establishment method and an application thereof. The kit comprises a detection system consisting of LAMP reaction solution of four primers. Detection has verified that the kit can quickly and conveniently detect the PRV with high efficiency, high specificity and high sensitivity under 60 to 65DEG C isothermal condition, does not need any complicated instrument, can well meet the requirement on the field detection to the PRV, can distinguish PRV gE gene deletion vaccine and field strains, provides a novel technical platform for the safety detection of food, can well meet the urgent need on the field detection of the PRV, is used for the field detection of import and export quarantine, food health departments, livestock farms and the like, and is easy to be popularized and applied in a large scope.

Description

Be used to LAMP test kit that detects PRV and preparation method thereof

Technical field

The invention belongs to animal health inspection technology field; Particularly a kind of novel method of rapid detection PRV gE gene; Through observing response pipe turbidity and colour-change, or observe the agarose gel electrophoresis image under the uv lamp and judge the amplification situation, come judged result.

Background technology

Pseudoabies (Pseudorabies, it is sick PR) to have another name called the disease of very itching, Ao Yejishi, cause of disease be herpetoviridae pseudorabies virus (Pseudorabies Virus, PRV).Many clinically is characteristic with heating and nervous symptoms.Had 44 countries and regions that this sick report is arranged in the world to 2007, this disease has become one of the most serious eqpidemic disease of the global pig industry of harm.Cause sterile behind the boar infection Pseudorabies virus; Stillborn foetus and mummy tire are miscarried, produced to pregnant sow; Pseudorabies virus congenital infection or early infection cause the nervous symptoms and the high mortality of sucking piglets; For growing and fattening pigs, Pseudorabies virus is the important cause of disease of respiratory system eqpidemic disease syndrome (PRDC), causes the Respiratory symptoms and the growth retardation of growing-finishing pig; For kind of a pig farm, pseudoabies is positive and causes disadvantageous effect for sale of boar and brand effect; And for export enterprise, the pig farm pseudoabies is positive and is faced with the dual loss of economy and trade.

In recent years, China's pig industry towards intensification, the mass-producing direction develops rapidly, the increasing and boar of the density of raising exchanges more and more frequent, this for the generation of this disease, propagate and spread the condition created.Liu Youchang equals 2006-2007 to the detected result from 1502 parts of serum samples on provinces and cities pig farms such as Tianjin, Hebei, Shandong, and the highest infection rate is 100%, and average infection rate is 49%.According to incompletely statistics, the financial loss that causes of the PRDC that causes because of diseases such as PRVs every year of China is up to billions of Renminbi.Porcine pseudorabies anti-system experience in the world's shows that responsive, accurate detection is technological then to be the key link in the anti-system of porcine pseudorabies.Because there are very similarly clinical symptom in porcine pseudorabies and other many syndromic diseases of pig breeding dysfunction that cause; Add that the clinical symptom difference between each pig farm is very big; Bacillary or viral secondary infection or polyinfection are especially arranged; More increased the difficulty of clinical diagnosis work, therefore only be difficult to make diagnosis according to clinical symptom and epidemiology characteristics.The domestic and international laboratory diagnostic method of reporting is a lot of at present, is divided into serology and etiological diagnosis method.

(1) serological method:

Serological method comprises neutralisation, latex agglutination etc., and that wherein famous is gE-ELISA.This method also is the serological diagnostic method that China uses more definite wild virus infection at present; But it is the same with other serological method; This method can't be got rid of maternal antibody equally and disturb; Because for being difficult to judge that with interior piglet gE antibody is from maternal antibody 10 ages in week, still owing to infect.And serological method can not detect the latent infection of Pseudorabies virus.Pseudorabies virus can hide after the primary infection rehabilitation in nerve node, and antibody test at this moment is negative, but when body received the internal and external factor stimulation, virus was activated and causes the generation and the propagation of disease.

(2) etiology method:

1. cell culture method

The most classical in the etiological diagnosis method, method is to take pathological material of disease tissue from morbidity pig body accurately, carries out the virus separation with cell, but this method length consuming time (7-10 days), it is desired ageing to be difficult to satisfy clinical diagnosis, is mainly used in scientific research.

2. gene diagnosis is technological

The various countries scholar has carried out a large amount of research to this viral molecular biological characteristic, laboratory diagnosis gene, the assignment of genes gene mapping of Pseudorabies virus existing 75% at present, and the 26S Proteasome Structure and Function of the gp that some are important is all clear.These are all advancing the development of the gene diagnosis technology of pseudoabies.

People have built up several different methods, and for example nucleic acid probe hybridization is technological, round pcr, fluorescent quantitative PCR technique or the like; Be accompanied by the application of gene-deleted vaccine in the pseudoabies control; Its corresponding discriminating PCR arises at the historic moment, and Chen Lu is first-class in the pseudorabies virus gB that has delivered, the sequence of gE gene, has designed and synthesized two pairs of primers; Set up a kind of general and a kind of discriminating PCR diagnostic method respectively, can be used to differentiate that vaccine strain and street strain infect.Ten thousand superfine be reference with the conservative gE gene order of Pseudorabies virus (PRV), design, optimize and a pair of special PCR primer and a TaqMan fluorescent probe, set up the fluorescent quantitative PCR technique that a kind of fast quantification detects Pseudorabies virus.

For round pcr considerable research has been arranged at present, but it is found that in application process there are a lot of weak points in it: (1) target gene is prone to contaminated.(2) often cause non-specific amplification.(3) the required taq DNA enzyme of reaction often receives the influence of compositions such as tissue, blood and IgG, and reduces activity, thus the suppression of amplification reaction.(4) need relatively more expensive PCR appearance.(5) the amplified reaction time longer, generally need several hrs, be unfavorable for applying or the like in the basic unit laboratory.In view of the deficiency of current diagnosis method, sets up more easy, quick, special, be suitable for the diagnostic method that terrain is used, to the timely monitoring of porcine pseudorabies, differentiate that the natural infection pig only reaches and implement to control and to put out plan all significant.

Along with rapid development of science and technology, Protocols in Molecular Biology and immunological technique that some are advanced are generalizable in laboratory study, for the research of animal doctor's diagnostic techniques provides new means.

LAMP (loop-mediated isothermal amplification, ring mediated isothermal amplification).This method be 2000 by a kind of new nucleic acid amplification technologies of report at first such as Notomi, this method is to utilize four kinds of (FIP, F3, BIP, B3) Auele Specific Primers of a cover, with six specific regions of identification target gene.Utilize a kind of strand displacement archaeal dna polymerase (BstDNApolymerase) constant temperature (about 65 ℃) insulation 30-60 minute; Can accomplish nucleic acid amplification reaction; Its end product is a kind of miscellany, by the DNA of the long stem-loop structure of a plurality of different stems and in same chain through the annealing aim sequence constantly upset duplicate the various Cauliflower spline structure that ring texture constituted that forms and form.

Though the LAMP ratio juris is complicated, researchist or testing staff's actually operating are very easy.In addition, its simple selectivity of method that detects product is high, need not through electrophoresis, can directly have or not fluorescence to judge whether to react by amplification sedimentary turbidity of by product magnesium pyrophosphate or adding EB/SYBR Green I through observation.The cause of disease that is suitable for highly sensitive, the high specificity of this method, the utmost point detects and uses.So this law once emerging, promptly receives many scholars' concern.

At present, this method detects in food safety detection, epidemic virus, clinical diagnosis, and the application and the existing relevant paper report of research in field such as aquaculture.Enomoto and Kaneko etc. adopt LAMP and two kinds of methods of polymerase chain reaction (PCR) pair to carry out DNA cloning with Pseudorabies virus generic 7 type nerpes vinrus hominises respectively, and the susceptibility that records the LAMP reaction is every pipe 250 copies, and is high 10 times than the susceptibility of PCR.Wamodo etc. are directed against the special primer of mycobacterium tuberculosis, mycobacterium avium and Mycobacterium intracellulare and the Mycobacterium consensus primer Muniv of 16S ribosome-RNA(rRNA) conserved sequence according to the gyrB gene order; From sputum specimen, identify mycobacterium tuberculosis, mycobacterium avium and Mycobacterium intracellulare with the LAMP method, can detect the bacterium of 10 copies.He adds SYBR Green I and detects in reaction tube.If contain amplified production, it is green that reaction mixture turns; Otherwise, keep then that SYBR Green I's is orange constant.

(Pseudorabies virus PRV) belongs to simplexvirus a subfamily in the herpetoviridae to Pseudorabies virus, and the herpesvirus suis I type of Varicellavirus is a distrand DNA virus.GE is a kind of gp that all street strains of finding so far all express; It is the main virulence gene of PRV; Can mediate viral intercellular diffusion; And helping PRV to spread to cns, it also is the marker gene of pseudoabies gene-deleted vaccine, through detecting the infection that can distinguish vaccine strain and street strain that has or not of gE gene.According to Lu Qinzhang etc. and the comparison to the different strain gE of PRV gene nucleotide series such as Shao Weijuan, homology shows that the gE gene order is more conservative between 98%～99.5%, bigger value is all being arranged aspect its vaccine application and the molecular diagnosis.But still do not use the precedent that LAMP method (loop-mediatedisothermal amplification, ring mediated isothermal amplification) is carried out the Pseudorabies virus check.

Summary of the invention

The shortcoming that an object of the present invention is to overcome prior art is with not enough; Be provided for detecting the LAMP test kit of PRV and it increased according to the primer of its gE gene design; Through observing response pipe turbidity and colour-change; Or observe the agarose gel electrophoresis image under the uv lamp and judge the amplification situation, judged result.

Another object of the present invention provides a kind of method of rapid detection PRV.

A further object of the present invention provides the method for use of the LAMP test kit that is used to detect PRV.For realizing that above-mentioned purpose the present invention provides following technical scheme:

A kind of LAMP test kit that is used to detect PRV, its characteristic comprises following component:

(1) LAMP reaction solution: contain in per 23 μ L LAMP reaction solutions: 2 * Buffer (contains Mg ²⁺) 2.5 μ L; GE3-F30.5 μ L; GE3-B3 0.5 μ L; GE3-FIP 4 μ L; GE3-BIP 4 μ L; DNTPs 3.5 μ L; 8U/ μ L Bst enzyme 1 μ L; Water 7 μ L.

(2) the LAMP primer of collating sequence:

gE3-F3	TGCTCGGGGCGAAGGT
		gE3-B3	GGGTGGTAGATGCAGGGC
gE3-FIP	CATGTCCGAGACCACGCGCGTTTTTCCACTCGCAGCTCTTCT
		gE3-BIP	GAGAACTTTACCGCCACGCTGGTTTTCGTACACGTAGTACAGCAGG

The preparation method who is used to detect the LAMP test kit of PRV according to the invention is characterized in that comprising the steps:

1, amplification reaction system: the TV of amplified reaction is 25 μ L, and its various compositions and final concentration are respectively: 2 * Buffer (contains Mg ²⁺) 2.5 μ L; GE3-F3 0.5 μ L; GE3-B3 0.5 μ L; GE3-FIP 4 μ L; GE3-BIP 4 μ L; DNTPs 3.5 μ L; 8U/ μ L Bst enzyme 1 μ L; Water 7 μ L; DNA sample 2 μ L.What wherein 2 * Buffer represented is 2 * damping fluid.

2, amplified reaction process: sex change 5min under 95 ℃ of conditions on the DNA circulation appearance, carry out 45-60min at 60-65 ℃, and at 80 ℃ of lasting 2min, 4 ℃, preserve;

3, amplified reaction finishes, and gets system liquid 10-25 μ L and whether increases with the judgement of different detection method.

The method of use that is used to detect the LAMP test kit of PRV according to the invention is characterized in that may further comprise the steps:

(1) the above-mentioned 23 μ L LAMP reaction solutions of preparation;

(2) nucleic acid in the extraction testing sample;

(3) extracting solution of getting 2 μ L said (2) nucleic acid adds in the LAMP reaction solution of step (1) preparation, and making the end reaction volume is 25 μ L, and the instantaneous centrifugal 30S of 10000rpm is with the mixing reaction solution;

(4) put 60 ℃ to 65 ℃ constant temperature 45min to 60min and carry out the LAMP amplification;

(5) take out the amplified reaction pipe, in reaction solution, add 1 μ L SYBR green I,, or observe the agarose gel electrophoresis image under the uv lamp and judge the amplification situation, judged result through observing response pipe turbidity and colour-change.Three kinds of observational techniques are arranged, are fit to carry out under the different situations:

1) through agarose gel electrophoresis, add the EB staining agent, under uv lamp, observe.Reaction can produce the amplified production of the loop-stem structure of various fragment length, therefore in electrophoretogram, is shown as from the disperse and the bar zoning of the beginning of point sample hole.Because EB is a carcinogen, so this method application is not very wide model.The result sees Fig. 3.

2) because reaction forms a large amount of amplified productions, can directly in the amplification pipe, add intercalator SYBR Green, uv lamp is observed down, and the pipe of no amplified reaction is orange, has the pipe of amplified reaction will become green.The result sees Fig. 1.

3) amount that detects white depositions that can also be through assessment amplification by product magnesium pyrophosphate is carried out.In reaction, when nucleic acid is synthetic in a large number, pyrophosphate ion of separating out from dNTP and the Mg the reaction soln ²⁺In conjunction with, produce by product one magnesium pyrophosphate deposition.It has high specificity, can detect by an unaided eye or turbidimeter detection reaction pipe in the deposition turbidity just can whether judge amplification.

The LAMP test kit that being used to of inventor development detected PRV has following characteristics:

(1) the present invention provides technical support and the theoretical foundation that China should the virus detectivity improves to a certain extent.In addition; Specificity and susceptibility based on the LAMP method are high, with low cost, many advantages such as easy handling; For the detection real-time of porcine pseudorabies and entry and exit quarantine provide the new technology source; For this sick incidence and development of timely monitoring, formulate effective anti-system measure, significant to improving China's anti-system level of porcine pseudorabies immunity.

(2) because the PRV less toxic vaccine is the gE gene-deleted vaccine; And the clinical infection strain is an intact virus; Contain the gE gene; Therefore, the LAMP test kit that is used to detect PRV of the present invention can be distinguished two kinds of viruses, is applicable to the detection of clinical case, pathological material of disease, cell culture and DNA sample.

Description of drawings

Fig. 1 adds the macroscopic figure as a result of SYBR Green I for amplified production.Be followed successively by negative water contrast from left to right, the amplified production of Pseudorabies virus cell culture.

Fig. 2 adds the figure as a result that SYBR Green I uv lamp is observed down for amplified production.Be followed successively by negative water contrast from left to right, the amplified production of Pseudorabies virus cell culture.

Fig. 3 is LAMP test electrophorogram.From left to right, be followed successively by M from left to right, DL2000DNA marker; 1, clinical sample 1; 2, sample 2; 3, sample 3; 4, sample 4; 5, sample 5; 6, sample 6; 7, sample 7; 8, sample 8; 9, the Pseudorabies virus cell culture; 10, negative water contrast; M, DL2000DNA marker.

Fig. 4 adds the figure as a result that the EB uv lamp is observed down for amplified production.Wherein 1, the water contrast; 2,1TCID ₅₀3,10 ¹

TCID

₅₀4,10 ²

TCID

₅₀5,10 ³TCID ₅₀6,10 ⁴TCID ₅₀7,10 ⁵

TCID

₅₀8,10 ⁶TCID ₅₀M, DL2000DNA Marker.TCID wherein ₅₀(Tissue culture infective dose); Claim 50% histocyte infective dose again; Promptly refer to can half cell cultures plate hole or in vitro virus cause that (cytopathic effect, virus quantity CPE) they are a kind of units that calculates viral level to cytopathy.

Fig. 5 is PCR test electrophorogram: wherein 1, and the water contrast; 2,1TCID ₅₀3,10 ¹

TCI D

₅₀4,10 ²

TCID

₅₀5,10 ³TCID ₅₀6,10 ⁴TCID ₅₀7,10 ⁵

TCID

₅₀8,10 ⁶TCID ₅₀M, DL2000DNA Marker.

Embodiment

In order to explain implementation method of the present invention more fully, the embodiment of the LAMP test kit that is used to detect PRV is provided.These embodiments only are to explain rather than limit scope of the present invention.Wherein used raw material all has commercially available.Pseudorabies virus gE gene LAMP primer sequence of the present invention is seen table 1.

Table 1

Embodiment 1

1, the extraction of PRV PK-15 cell culture DNA:

The cell of typical cytopathic appears in results, freeze thawing 1 time, and 4000r/min centrifuging and taking supernatant 445 μ L add 12.5 μ L Proteinase Ks (20mg/mL) and 25 μ L10%SDS.50 ℃ of water-bath 2h, phenol, phenol: chloroform, each extracting of chloroform are once drawn water.The absolute ethyl alcohol of 2 times of volumes is behind-20 ℃ of deposition 1h, and the centrifugal 10min of 10000r/min precipitates through 70% washing with alcohol, is dissolved in after the drying among the 20 μ L TE, and-20 ℃ frozen subsequent use.

2, amplified reaction

(1) the big fragment of Bst archaeal dna polymerase and 2 times of Buffer solution that reagent: BioLabs (NEW ENGLAND) produces; Pseudorabies virus gE gene LAMP primer; DNTPs

(2) amplification reaction system: the TV of amplified reaction is 25 μ L, and its various compositions and final concentration are respectively: 2 * Buffer (contains Mg ²⁺) 2.5 μ L; GE3-F3 0.5 μ L; GE3-B3 0.5 μ L; GE3-FIP 4 μ L; GE3-BIP4 μ L; DNTPs 3.5 μ L; 8U/ μ L Bst enzyme 1 μ L; Water 7 μ L; DNA sample 2 μ L.。

(3) amplified reaction process: sex change 5min under 95 ℃ of conditions, carry out 45min at 60 ℃, and at 80 ℃ of lasting 2min, 4 ℃, preserve;

(4) amplified reaction finishes, and directly in amplification is managed, adds intercalator SYBR Green I, visual inspection, and the pipe that does not have the amplification reflection is an orange, and what amplification was arranged is green, and the result sees Fig. 1.Under uv lamp, observe.The pipe of no amplified reaction does not have fluorescence, has the pipe of amplified reaction will become green fluorescence, and the result sees Fig. 2.

Embodiment 2

1, the extraction of PRV PK-15 cell culture DNA:

Boil the bacterium method.Get the cell culture 200 μ L of virus, 100 ℃ of water-bath 10min, ice bath 5min, 1000rpm is centrifugal, and supernatant is used for detecting.

2, amplification:

(2) amplification reaction system: the TV of amplified reaction is 25 μ L, and its various compositions and final concentration are respectively: 2 * Buffer (contains Mg ²⁺) 2.5 μ L; GE3-F30.5 μ L; GE3-B30.5 μ L; GE3-FIP 4 μ L; GE3-BIP4 μ L; DNTPs 3.5 μ L; 8U/ μ L Bst enzyme 1 μ L; Water 7 μ L; DNA sample 2 μ L.

(3) amplified reaction process: sex change 5min under 95 ℃ of conditions, carry out 45min at 63 ℃, and at 80 ℃ of lasting 2min, 4 ℃, preserve;

(4) amplified reaction finishes, and gets system liquid 10 μ L, through agarose gel electrophoresis, adds the EB staining agent, under uv lamp, observes.Reaction can produce the amplified production of the loop-stem structure of various fragment length, therefore in electrophoretogram, is shown as from the disperse and the bar zoning of the beginning of point sample hole.The result sees Fig. 3.

Embodiment 3

1, the DNA in the extraction infected pigs Pseudorabies virus piglet pathological material of disease: tonsilla of gathering and cerebral tissue are shredded in the mortar of sterilization respectively; Fully grind the back and be diluted to 5 times of suspensions with the Hank ' s liquid that contains 100U/mL penicillium mould and 100mg/L Streptomycin sulphate; 4 ℃ of centrifugal 30min of 4000r/min; Get supernatant, press the method for instance 1 and extract the viral DNA in the tissue.

2, amplified reaction:

(2) amplification reaction system: the TV of amplified reaction is 25 μ L, and its various compositions and final concentration are respectively: 2 * Buffer (contains Mg ²⁺) 2.5 μ L; GE3-F3 0.5 μ L; GE3-B3 0.5 μ L; GE3-FIP 4 μ L; GE3-BIP4 μ L; DNTPs 3.5 μ L; 8U/ μ L Bst enzyme 1 μ L; Water 7 μ L; DNA sample 2 μ L.

(3) amplified reaction process: sex change 5min under 95 ℃ of conditions, carry out 60min at 65 ℃, and at 80 ℃ of lasting 2min, 4 ℃, preserve;

Embodiment 4

The contrast experiment:

Adopt the contrast of PRV LAMP test kit of the present invention and PCR measuring method:

(1) the big fragment of Bst archaeal dna polymerase and 2 times of Buffer solution of the inventive method reagent: BioLabs (NEW ENGLAND) production; Pseudorabies virus gE gene LAMP primer; DNTPs; Dna profiling comprises the sample that contains Pseudorabies virus.

(2) amplification reaction system of the present invention: the TV of amplified reaction is 25 μ L, and its various compositions and final concentration are respectively: 2 * Buffer (contains Mg ²⁺); GE3-F3 0.5 μ L; GE3-B3 0.5 μ L; GE3-FIP 4 μ L; GE3-BIP 4 μ L; DNTPs 3.5 μ L; 8U/ μ L Bst enzyme 1 μ L; Water 7 μ L; DNA sample 2 μ L.

(3) amplified reaction program of the present invention: sex change 5min under 95 ℃ of conditions, carry out 60min at 65 ℃, and at 80 ℃ of lasting 2min, 4 ℃, preserve;

(4) amplified reaction finishes, and gets system liquid 10 μ L, through agarose gel electrophoresis, adds the EB staining agent, under uv lamp, observes.The reaction tubes of no amplified reaction does not have obvious band, has the reaction tubes of amplified reaction stepped band to occur.Minimumly can detect 10 ¹TCID ₅₀The result sees Fig. 4: wherein 1, and the water contrast; 2,1TCID ₅₀3,10 ¹

TCID

₅₀4,10 ²

TCID

₅₀5,10 ³TCID ₅₀6,10 ⁴TCID ₅₀7,10 ⁵

TCID

₅₀8,10 ⁶TCID ₅₀M, DL2000DNA Marker.

(5) PCR method: the reaction primer adopts a pair of gE target gene primer.

The PCR reaction is 20 μ L systems, TaKaRa LA Taq (5U/ μ L) 0.2 μ L, 2 * GC Buffer I, 10 μ L; DNTP Mixture (each 2.5mmol/L) 2 μ L; Dna profiling 2 μ L, each 1 μ L of 25pM primer PRV (gE) U3 and PRV (gE) L3, deionized water 4.8 μ L.

Amplification program adopts after earlier preparatory 94 ℃ of 5min of sex change, gets into circulation: 94 ℃ of 60s, and 65 ℃ of 60s, 72 ℃ of 60s, after 30 circulations, 72 ℃ are extended 10min.

The PCR product is got 10 μ L in 2% agarose gel electrophoresis, 40min under the 100V voltage,

Observe through the gel imaging analysis appearance, PCR method is minimum can to detect 10 ²TCID ₅₀The result sees Fig. 5: wherein 1, and the water contrast; 2,1TCID ₅₀3,10 ¹

TCID

₅₀4,10 ²

TCID

₅₀5,10 ³TCID ₅₀6,10 ⁴TCID ₅₀7,10 ⁵

TCID

₅₀8,10 ⁶TCID ₅₀M, DL2000DNA Marker.

Relatively can be found out by two kinds of methods: method sensitivity of the present invention can detect the lower sample of PRV content apparently higher than the susceptibility of PCR method.

After the preferred embodiment that specifies; Being familiar with this technological personage can be well understood to; Do not break away from above-mentioned claim with spirit under can carry out various variations and modification; All foundations technical spirit of the present invention all belongs to the scope of technical scheme of the present invention to any simple modification, equivalent variations and modification that above embodiment did.And the present invention does not also receive the restriction of the embodiment that gives an actual example in the specification sheets.

Sequence table

< 110>Tianjin City Livestock Raising and Veterinary Inst.

< 120>LAMP test kit that is used to detect PRV and preparation method thereof

<160>4

<210>1

<211>16bp

<212>DNA

< 213>artificial sequence

<400>1

tgctcggggc?gaaggt 16

<220>

<211>18bp

<212>DNA

< 213>artificial sequence

<400>2

gggtggtaga?tgcagggc 18

<220>

<211>21bp

<212>DNA

< 213>artificial sequence

<400>3

catgtccgag?accacgcgcg?tttttccact?cgcagctctt?ct 42

220>

<211>21bp

<212>DNA

< 213>artificial sequence

<400>4

gagaacttta?ccgccacgct?ggttttcgta?cacgtagtac?agcagg 46

Claims

1. LAMP test kit that is used to detect PRV is characterized in that comprising following component:

(1) LAMP reaction solution:

Contain in per 23 μ L LAMP reaction solutions: contain Mg ²⁺2 * Buffer2.5 μ L; GE3-F3 0.5 μ L; GE3-B3 0.5 μ L; GE3-FIP 4 μ L; GE3-BIP 4 μ L; DNTPs 3.5 μ L; 8U/ μ L Bst enzyme 1 μ L; Water 7 μ L;

(2) the LAMP primer of collating sequence:

gE3-F3 TGCTCGGGGCGAAGGT

gE3-B3 GGGTGGTAGATGCAGGGC

gE3-FIP?CATGTCCGAGACCACGCGCGTTTTTCCACTCGCAGCTCTTCT

gE3-BIP?GAGAACTTTACCGCCACGCTGGTTTTCGTACACGTAGTACAGCAGG。