CN104087685B - A kind of porcine pseudorabies isothermal PCR field quick detection test kit - Google Patents
A kind of porcine pseudorabies isothermal PCR field quick detection test kit Download PDFInfo
- Publication number
- CN104087685B CN104087685B CN201410329239.3A CN201410329239A CN104087685B CN 104087685 B CN104087685 B CN 104087685B CN 201410329239 A CN201410329239 A CN 201410329239A CN 104087685 B CN104087685 B CN 104087685B
- Authority
- CN
- China
- Prior art keywords
- primer
- porcine pseudorabies
- test kit
- detection test
- isothermal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses a kind of porcine pseudorabies isothermal PCR field quick detection test kit, be made up of a set of primer, 10 times of loop-mediated isothermal amplification liquid, archaeal dna polymerase, positive control, negative control and developer；Described a set of primer is made up of pair of primers and a pair inner primer。The employing present invention can qualitative and quantitative detection porcine pseudorabies。The present invention utilizes the strand displacement characteristic of Bst DNA enzymatic, design 4 primers, identify 6 regions of target sequence, generate a large amount of stem circulus repeated under isothermal conditions, any special installation is not needed when qualitative detection, only need to observe the change of reacting pipe color namely to can determine that, therefore there is specificity, sensitivity is high and the detection time is shorter than regular-PCR, suitable in features such as the on-the-spot quick detections in pig farm。
Description
Technical field
The invention belongs to technical field of bioengineering, relate to a kind of porcine pseudorabies isothermal PCR field quick detection test kit。
Background technology
Porcine pseudorabies PRV is the viral pig infectious disease caused by PRV (Pseudorabies virus), newborn piglet infects Pseudorabies virus can cause mortality, faces and examines newborn piglet and act normally for the 1st day, started morbidity from the 2nd day, it is the peak mortality phase in 3～5 days, the whole nest death ray having。Meanwhile, morbidity piglet show obvious nervous symptoms, lethargy, toot cry, vomit, have loose bowels, once morbidity, death in 1～2 day。Cut open inspection mainly kidney and be covered with needle point sample petechia, sometimes see pulmonary edema, meninges surface hyperemia, hemorrhage。This patient of Infection in Piglets within 15 ages in days, the state of an illness is extremely serious, and death rate of the onset is up to 100%。Piglet sudden onset, body temperature rises and reaches more than 41 DEG C, and spirit is extremely tired, shakes, moves inharmonious, spasm, vomiting, diarrhoea, few rehabilitation。Ablactational baby pig infects Pseudorabies virus, and sickness rate is about 20%～40%, and mortality rate is about 10%～20%, and main manifestations is nervous symptoms, have loose bowels, vomiting etc.。Adult Pig is generally inapparent infection, if there being symptom also very slight, it is easy to recover。Main manifestations is heating, spirit is depressed, some sick pig vomiting, cough, generally recovers completely in 4～8 days。
Farrowing sow can be miscarried, be produced mummy fetus or stillborn fetus, is wherein the first-born sow with stillborn fetus for master or Suprapubic arch sling is all fallen ill, and do not have strict seasonality, but with multiple at the beginning of cold season and last month of spring in winter。According in recent years, symptom of very itching is in the past rare pig, but then often visible at present。
Another characteristics of incidence of pseudorabies is to show as boar infertility。Send out pig farm in recent years existing and break out pseudorabies spring, after occurring that stillborn fetus or ablactational baby pig suffer from pseudorabies, and then the second half year, sow unmatched kind, returned feelings rate up to 90%, and having breeds repeatedly all unmatches for several times repeatly。Additionally, after boar infection Pseudorabies virus, show testis swelling, atrophy, lose kind ability。
Summary of the invention
It is an object of the invention to overcome the defect existed in prior art, thering is provided a kind of porcine pseudorabies isothermal PCR field quick detection test kit, the test kit of the present invention is made up of the primer of an Analysis of Nested Design, 10 × LAMP reactant liquor, archaeal dna polymerase, positive control, negative control and developer。The employing present invention can qualitative detection porcine pseudorabies。The present invention utilizes the strand displacement characteristic of BstDNA enzyme, design 4 primers, identify 6 regions of target sequence, generate a large amount of stem circulus repeated under isothermal conditions, any special installation is not needed when qualitative detection, only need to observe the change of reacting pipe color namely to can determine that, therefore there is specificity, sensitivity is high and the detection time is shorter than regular-PCR, suitable in features such as the on-the-spot quick detections in pig farm。The purpose of the present invention is embodied in the following aspects:
1. Standard PCR detection technique compares this technical speed slowly, and from sampling out, result is minimum needs 48h, and this technology only needs 30-90 minute；
2. Standard PCR needs large-scale, expensive these technology of instrument and equipment such as PCR instrument, electrophoresis system, gel imaging system only to need a calorstat or thermos cup；
3. the result of Standard PCR must be observed under gel imaging instrument, and the test kit of this technology naked eyes after completion of the reaction get final product result of determination；
4. this test kit detects sensitivity, specificity are higher than Standard PCR。
Its concrete technical scheme is:
A kind of porcine pseudorabies isothermal PCR field quick detection test kit,
It is made up of a set of primer, 10 times of loop-mediated isothermal amplification liquid, archaeal dna polymerase, positive control, negative control and developer；Described a set of primer is made up of pair of primers and a pair inner primer, and its sequence is:
Primer 1:TCCGGATCTACCTCGACG
Primer 2: CCTCCTCGCTCAGGCT
Inner primer 1:TCGGCTCGGGCACGTACAGCTACGGCACCGGCAAGA
Inner primer 2:CGTACTGGCGCACTCTGTTCGGTTCTGCTTCCGGGTCTGC
Wherein, described pair of primers and the ratio of the molal quantity of a pair inner primer are 1:6～9；Described archaeal dna polymerase is the BstDNA polymerase with strand displacement effect, and vigor is 8 active unit/microlitres；Described positive control is that loop-mediated isothermal amplification amplification region is arranged in this distinguished sequence, and its concentration is 10 containing the positive plasmid inserting one section of distinguished sequence of porcine pseudorabies7Copy/μ L；Described negative control is sterilizing distilled water；Described developer is 20 times of SYBRGreenI。
Preferably, 10 times of described loop-mediated isothermal amplification liquid are made up of 200mM Tri(Hydroxymethyl) Amino Methane Hydrochloride, 100mM potassium chloride, 100mM ammonium sulfate, 40～100mM magnesium sulfate, 4～10M glycine betaine, the dNTPs of 5～18mM and the TritonX-100 of mass percentage concentration 0.1%。
Preferably, described dNTPs is the equal amount of mixture containing four kinds of dNTP。
Preferably, the manufacture method of described positive plasmid is: adopt one section of porcine pseudorabies TK gene specific sequence of pcr amplification, it is then charged into PMD18-T carrier, convert to DH5 α competence antibacterial, extract plasmid DNA after sequence is determined, adopt ultraviolet spectrophotometer measure the concentration of plasmid DNA and adjust copy number to 10 with sterilizing distilled water7Copy/μ L。
Preferably, described SYBRGreenI is highly sensitive DNA fluorescent dye。
Compared with prior art, the invention have the benefit that
1, the present invention utilizes the strand displacement characteristic of BstDNA enzyme, designs 4 primers, identifies 6 regions of target sequence, generates a large amount of stem circulus repeated under isothermal conditions, does not need any special installation when qualitative detection。
2, the specificity of the present invention, sensitivity are above regular-PCR technology。
3, due to the fact that the repetitive cycling not needing 3 temperature through round pcr, the detection time is shorter than PCR。
4, the result of the present invention judges not need through electrophoresis, simpler than PCR, very easily promotes。For detection by quantitative, although by means of quantitative real time PCR Instrument, but do not need synthesis fluorescent probe, only need to by fluorescent dye SYBRGreenI, cost lowers significantly。
5, the reaction temperature of the present invention is at 60 DEG C～about 65 DEG C, and identifies 6 specific regions of target gene, and primer polymer and non-specific amplification probability are substantially reduced, and dosing accuracy is greatly improved。
Detailed description of the invention
Below in conjunction with specific embodiment, technical scheme is described in more detail。
A kind of porcine pseudorabies isothermal PCR field quick detection test kit, comprises the following steps:
It is made up of a set of primer, 10 times of loop-mediated isothermal amplification liquid, archaeal dna polymerase, positive control, negative control and developer；Described a set of primer is made up of pair of primers and a pair inner primer, and its sequence is:
Primer 1:TCCGGATCTACCTCGACG
Primer 2: CCTCCTCGCTCAGGCT
Inner primer 1:TCGGCTCGGGCACGTACAGCTACGGCACCGGCAAGA
Inner primer 2:CGTACTGGCGCACTCTGTTCGGTTCTGCTTCCGGGTCTGC
Wherein, described pair of primers and the ratio of the molal quantity of a pair inner primer are 1:6～9；Described archaeal dna polymerase is the BstDNA polymerase with strand displacement effect, and vigor is 8 active unit/microlitres；Described positive control is that loop-mediated isothermal amplification amplification region is arranged in this distinguished sequence, and its concentration is 10 containing the positive plasmid inserting one section of distinguished sequence of porcine pseudorabies7Copy/μ L；Described negative control is sterilizing distilled water；Described developer is 20 times of SYBRGreenI。
Described 10 times of loop-mediated isothermal amplification liquid (form typically by " 10XLAMP reactant liquor " represents, the multiple of dilution when what numeral " 10 " represented is use) are made up of 200mM Tri(Hydroxymethyl) Amino Methane Hydrochloride, 100mM potassium chloride, 100mM ammonium sulfate, 40～100mM magnesium sulfate, 4～10M glycine betaine, the dNTPs of 5～18mM and the TritonX-100 of mass percentage concentration 0.1%。Described mM is the unit of molar concentration, refers to the molal quantity of contained solute in every liter of solution。
Described dNTPs is the equal amount of mixture containing four kinds of dNTP。The manufacture method of described positive plasmid is: adopt one section of porcine pseudorabies TK gene specific sequence of pcr amplification, it is then charged into PMD18-T carrier, convert to DH5 α competence antibacterial, extract plasmid DNA after sequence is determined, adopt ultraviolet spectrophotometer measure the concentration of plasmid DNA and adjust copy number to 10 with sterilizing distilled water7Copy/μ L。Described SYBRGreenI is highly sensitive DNA fluorescent dye。SYBRGreenI is very high with the affinity of double-stranded DNA。Enzyme conventional in molecular biology do not had inhibitory action。
Operation principle of the present invention is: loop-mediated isothermal amplification process is first to be gone out the synthesis of the required template of inner primer amplification and initial reactant template by primer amplification；And then synthesis target gene DNA fragmentation is guided by inner primer, owing to the DNA fragmentation of inner primer amplification contains this primer 5, the reverse complementary sequence of end DNA fragmentation, thus by hybridizing formation loop-stem structure between these reverse complementary sequences, an other inner primer is complementary to guiding chain replacement synthesis after chain anneal, other end at the DNA fragmentation of amplification creates new loop-stem structure, form dumbbell structure, in one hour, this circular response can make target DNA be accumulated to 109 copies, after electrophoresis, visible amplification end-product is made up of the DNA fragmentation differed in size, in scalariform band, amplification is observed also by fluorescent dye。The whole reaction of LAMP divides three steps to complete, i.e. the originally synthesis of reactant template, cyclic amplification stage, extension and recirculation。
The above; it is only the present invention preferably detailed description of the invention; protection scope of the present invention is not limited to this; any those familiar with the art is in the technical scope of present disclosure, and the simple change of the technical scheme that can become apparent to or equivalence are replaced and each fallen within protection scope of the present invention。
Claims (4)
1. a porcine pseudorabies isothermal PCR field quick detection test kit, it is characterised in that
It is made up of a set of primer, 10 times of loop-mediated isothermal amplification liquid, archaeal dna polymerase, positive control, negative control and developer；Described a set of primer is made up of pair of primers and a pair inner primer, and its sequence is:
Primer 1:TCCGGATCTACCTCGACG
Primer 2: CCTCCTCGCTCAGGCT
Inner primer 1:TCGGCTCGGGCACGTACAGCTACGGCACCGGCAAGA
Inner primer 2:CGTACTGGCGCACTCTGTTCGGTTCTGCTTCCGGGTCTGC
Wherein, described pair of primers and the ratio of the molal quantity of a pair inner primer are 1: 6～9；Described archaeal dna polymerase is the BstDNA polymerase with strand displacement effect, and vigor is 8 active unit/microlitres；Described positive control is that loop-mediated isothermal amplification amplification region is arranged in this distinguished sequence, and its concentration is 10 containing the positive plasmid inserting one section of distinguished sequence of porcine pseudorabies7Copy/μ L；Described negative control is sterilizing distilled water；Described developer is 20 times of SYBRGreenI, the manufacture method of described positive plasmid is: adopt one section of porcine pseudorabies TK gene specific sequence of pcr amplification, it is then charged into PMD18-T carrier, convert to DH5 α competence antibacterial, extract plasmid DNA after sequence is determined, adopt ultraviolet spectrophotometer measure the concentration of plasmid DNA and adjust copy number to 10 with sterilizing distilled water7Copy/μ L。
2. porcine pseudorabies isothermal PCR field quick detection test kit according to claim 1, it is characterized in that, 10 times of described loop-mediated isothermal amplification liquid are made up of 200mM Tri(Hydroxymethyl) Amino Methane Hydrochloride, 100mM potassium chloride, 100mM ammonium sulfate, 40～100mM magnesium sulfate, 4～10M glycine betaine, the dNTPs of 5～18mM and the TritonX-100 of mass percentage concentration 0.1%。
3. porcine pseudorabies isothermal PCR field quick detection test kit according to claim 2, it is characterised in that described dNTPs is the equal amount of mixture containing four kinds of dNTP。
4. porcine pseudorabies isothermal PCR field quick detection test kit according to claim 1, it is characterised in that described SYBRGreenI is highly sensitive DNA fluorescent dye。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410329239.3A CN104087685B (en) | 2014-07-04 | 2014-07-04 | A kind of porcine pseudorabies isothermal PCR field quick detection test kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410329239.3A CN104087685B (en) | 2014-07-04 | 2014-07-04 | A kind of porcine pseudorabies isothermal PCR field quick detection test kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104087685A CN104087685A (en) | 2014-10-08 |
| CN104087685B true CN104087685B (en) | 2016-06-22 |
Family
ID=51635443
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410329239.3A Active CN104087685B (en) | 2014-07-04 | 2014-07-04 | A kind of porcine pseudorabies isothermal PCR field quick detection test kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104087685B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104328177A (en) * | 2014-10-20 | 2015-02-04 | 陕西溯源农业发展有限公司 | Clostridium perfringens isothermal PCR field rapid analysis kit |
| CN104830698A (en) * | 2015-04-30 | 2015-08-12 | 广西壮族自治区农业科学院甘蔗研究所 | Pokkah boeng disease pathogen separating and identifying method |
| CN105861744A (en) * | 2016-03-24 | 2016-08-17 | 天津出入境检验检疫局动植物与食品检测中心 | Primer combination used for rapid isothermal detection of porcine deltacoronavirus, and method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101775443A (en) * | 2010-01-06 | 2010-07-14 | 天津市畜牧兽医研究所 | LAMP kit for detecting PRV and preparation method thereof |
-
2014
- 2014-07-04 CN CN201410329239.3A patent/CN104087685B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101775443A (en) * | 2010-01-06 | 2010-07-14 | 天津市畜牧兽医研究所 | LAMP kit for detecting PRV and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| Development of Multi-PCR for Differentiation of Vaccine Strain and Field Isolate of Porcine Pseudorabies Virus;LIN Fang et al;《Animal Husbandry and Feed Science》;20091231;第1卷(第2期);第36-38页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104087685A (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Maruthi et al. | Transcriptional response of virus-infected cassava and identification of putative sources of resistance for cassava brown streak disease | |
| Nadin-Davis | Molecular epidemiology | |
| Nishida et al. | Detection, quantitation, and phylogenetic analysis of noroviruses in Japanese oysters | |
| Boniotti et al. | Porcine epidemic diarrhea virus and discovery of a recombinant swine enteric coronavirus, Italy | |
| Deng et al. | Prevalence study and genetic typing of bovine viral diarrhea virus (BVDV) in four bovine species in China | |
| Molinari et al. | Species H rotavirus detected in piglets with diarrhea, Brazil, 2012 | |
| Ogbu et al. | Nearly full‐length genome characterization of canine parvovirus strains circulating in Nigeria | |
| CN102605075B (en) | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences | |
| Li et al. | Prevalence of hepatitis E virus (HEV) infection in various pig farms from Shaanxi Province, China: First detection of HEV RNA in pig semen | |
| Yang et al. | Novel putative bluetongue virus serotype 29 isolated from inapparently infected goat in Xinjiang of China | |
| Shi et al. | Identification of natural infections in sheep/goats with hobi‐like pestiviruses in China | |
| CN102586477B (en) | Reverse transcription-polymerase chain reaction (RT-PCR) detection for porcine reproductive and respiratory syndrome virus and classical swine fever virus and special primers for same | |
| Silveira et al. | HoBi‐like is the most prevalent ruminant pestivirus in Northeastern Brazil | |
| CN104087685B (en) | A kind of porcine pseudorabies isothermal PCR field quick detection test kit | |
| Alkan et al. | Isolation and sequencing of Dashli virus, a novel Sicilian-like virus in sandflies from Iran; genetic and phylogenetic evidence for the creation of one novel species within the Phlebovirus genus in the Phenuiviridae family | |
| CN110669870B (en) | Real-time fluorescent quantitative RT-PCR detection primer, probe and detection kit for Pariemam serogroup virus serotypes | |
| Lee et al. | First detection of novel enterovirus G recombining a torovirus papain‐like protease gene associated with diarrhoea in swine in South Korea | |
| CN102115794A (en) | Internal-reference-containing HCMV fluorescence quantitative PCR detection kit | |
| Bhatta et al. | Detection and characterisation of canine astrovirus, canine parvovirus and canine papillomavirus in puppies using next generation sequencing | |
| Pellegrinelli et al. | Molecular characterization and phylogenetic analysis of enteroviruses and hepatitis a viruses in sewage samples, Northern Italy, 2016 | |
| Ochirkhuu et al. | Molecular detection and characterization of bovine viral diarrhea virus in Mongolian cattle and yaks | |
| Raho et al. | Biecheleria tirezensis sp. nov.(Dinophyceae, Suessiales), a new halotolerant dinoflagellate species isolated from the athalassohaline Tirez natural pond in Spain | |
| CN104032017B (en) | For detecting the primer pair turning G2-aroA gene herbicide-resistant corn G1105E-823C | |
| Golender et al. | Bluetongue Serotype 3 in Israel 2013–2018: Clinical Manifestations of the Disease and Molecular Characterization of Israeli Strains | |
| CN101020926A (en) | Reagent kit and process for detecting cholera vibrio in circular mediated constant temperature amplification method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |