CN110669870B

CN110669870B - Real-time fluorescent quantitative RT-PCR detection primer, probe and detection kit for Pariemam serogroup virus serotypes

Info

Publication number: CN110669870B
Application number: CN201910979854.1A
Authority: CN
Inventors: 杨恒; 廖德芳; 李卓然; 李占鸿; 杨振兴; 肖雷; 李华春
Original assignee: Yunnan Animal Science and Veterinary Institute
Current assignee: Yunnan Animal Science and Veterinary Institute
Priority date: 2019-10-15
Filing date: 2019-10-15
Publication date: 2023-08-04
Anticipated expiration: 2039-10-15
Also published as: CN110669870A

Abstract

The invention relates to a real-time fluorescent quantitative RT-PCR detection primer, a probe and a detection kit for a Pariemam serogroup virus serotype, belonging to the technical field of animal virus molecular biological detection. The kit comprises 3 pairs of primers; the kit also comprises three probes matched with the three primer pairs, a negative control template, a positive control template, a standard template and a PCR amplification reagent. The negative control template is RNase-free water; positive control templates are CHUV, BCV and DAV inactivated viruses respectively; standard templates are CHUV, BCV and DAV gene segment 2 single stranded RNAs. The kit can detect three serotypes PALV popular in China, and has the advantages of specificity, sensitivity, rapidness, high efficiency and the like; and the RNA of each serotype strain of PALV in a clinical sample can be quantitatively detected by matching with a standard curve established by using a standard template, so that the working efficiency is greatly improved.

Description

Real-time fluorescent quantitative RT-PCR detection primer, probe and detection kit for Pariemam serogroup virus serotypes

Technical Field

The invention belongs to the technical field of animal virus molecular biology detection, and particularly relates to three pairs of amplification primers, three TaqMan probes and an assembled detection kit for rapidly detecting serotypes of pangolian serogroup viruses epidemic in China by using a TaqMan real-time fluorescent quantitative RT-PCR technology.

Background

Pariemam serogroup virus (Palyam serogroup virus, PALV) is a member of the Reoviridae (Reoviridae) genus of the genus of circovirus (Orbivirus), and is widely prevalent in tropical and subtropical areas between 49 DEG North latitude and 35 DEG south latitude. PALV is transmitted mainly by the blood sucking bite of female blood sucking insects, cuicoides (cuicoides), on animals, and infects ruminants such as cattle and sheep, resulting in abnormal production of pregnant animals, mainly manifested as abortion, premature birth, stillbirth or brain-free malformation fetus. In 1985 to 1986, panlimus virus epidemic had been exploded in japan, and its clinical symptoms were congenital anomalies in newborn cows accompanied by brain deformity and cerebellum dysplasia syndrome, which caused great economic losses to animal husbandry production.

The PALV genome consists of 10 double stranded RNA segments (Seg 1-Seg 10), encoding a total of 7 structural proteins (VP 1-VP 7) and 4 non-structural proteins (NS 1-NS 3 and NS 3A). PALV has a double-layer capsid structure, and an outer capsid is composed of VP2 and VP5 encoded by Seg-2 and Seg-6, and mainly participates in the biological processes of mediating the adsorption of the surface of host cells, cell membrane permeation and the like. Seg-2 and Seg-5 both have a high degree of genetic variability, with VP2 encoded by Seg-2 being the primary antigen inducing neutralizing antibodies in infected animals, decisive for the PALV serotypes. PALVs have a variety of different serotypes, often denominated by the name of the place where the Virus was first isolated, and there are epidemics of three serotypes PALVs in asia, chuzan Virus (CHUV), D' Aguilar Virus (DAV), and Bunyip Creek Virus (BCV) for historical reasons.

CHUV is first separated from sentinel cattle in Yunnan province in 2012, and in subsequent development of PALV monitoring and virus separation work of autonomous regions of Guangdong province and Guangxi provinces in Yunnan province, multiple CHUV strains are obtained through separation, and BCV and DAV are also obtained through first separation in China, so that the PALV with multiple serotypes is popular in southern areas of China. The seropositive rate of CHUV antibodies in cattle and sheep in the provinces of inner Mongolia, xinjiang, shandong, jiangsu, hubei, guangxi and Yunnan in China is between 6 percent and 48.65 percent, and the seropositive rate of cattle and sheep in Hainan province is as high as 57.35 percent; in addition, the seropositive rate of yak CHUV antibodies in gansu province was 7.89%. Thus, the PALV has a widely distributed trend in China. Because the effects of cross protection among the PALVs of different serotypes are different, and in order to grasp the epidemic and distribution situation of the PALVs in China and formulate a scientific prevention and control strategy, it is very necessary to establish a detection method capable of rapidly identifying the PALV serotypes.

The neutralization test is one of the "gold standards" for serotype identification and can detect PALV of different serotypes, but the neutralization test is carried out by not only requiring reference strains of each serotype and standard positive serum, but also the detection period is as long as 1-2 weeks, which is time-consuming and laborious. In addition, neutralization assays require the use of reference strains, which present biosafety issues such as virus spread. Therefore, the efficient, rapid and safe detection method and detection kit for identifying the PALV serotypes are established, not only can the working efficiency be improved, but also technical support and knowledge reserve can be provided for prevention and control of the PALV in China.

The fluorescent quantitative PCR technology is a novel nucleic acid qualitative and quantitative technology which is introduced by ABI in 1996 in the United states, has been widely applied to pathogen detection of bacteria, viruses and the like since the invention, has the advantages of strong characteristics, high sensitivity, high detection speed, capability of high-throughput detection and the like, and more importantly, can be used for clinical sample detection, but no one-step real-time fluorescent quantitative RT-PCR (one step quantitative real time RT-PCR, qRT-PCR) detection method capable of identifying PALV serotypes is currently available.

Disclosure of Invention

The invention aims to solve the defects of the prior art, and provides three pairs of qRT-PCR primers and three specific TaqMan fluorescent probes for detecting PALV nucleic acids of different serotypes and a detection kit containing the primers and the probes, so as to realize qualitative and quantitative detection of PALV of different serotypes popular in China, thereby overcoming the defects of the prior art.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

real-time fluorescent quantitative RT-PCR detection primers for the serogroup virus serotypes of Pariemam, comprising 3 pairs of primers CHUV_F and CHUV_ R, BCV _F and BCV_ R, DAV _F and DAV_R respectively;

CHUV_F：ggagagggtcatccactcaa；(SEQ ID NO.1)

CHUV_R：tcccatcaaacgttccatatgt；(SEQ ID NO.2)

BCV_F：gtacatgattttccgcaactatc；(SEQ ID NO.3)

BCV_R：tcctctattttgatccgaaacata；(SEQ ID NO.4)

DAV_F：ggaggagtgtcgaagagcac；(SEQ ID NO.5)

DAV_R：gtgctgccactctgtytcat。(SEQ ID NO.6)

the invention also provides a probe matched with the primer, which comprises the following specific steps: probes CHUV_Probe used in combination with the CHUV_F and CHUV_R primers; probes BCV_Probe used in cooperation with BCV_F and BCV_R primers; probes DAV_Probe used in conjunction with DAV_F and DAV_R primers;

CHUV_Probe：FAM-tgccccgcaacacctcttctactct-BHQ1；(SEQ ID NO.7)

BCV_Probe：FAM-ctcttcggcttattccattcytcatctc-BHQ1；(SEQ ID NO.8)

DAV_Probe：FAM-tagytgaatataaacgtgcgggycg-BHQ1。(SEQ ID NO.9)

the invention also provides a detection kit containing the primer and/or the probe.

Further, preferably, the method further comprises: a negative control template, a positive control template, a standard template and a PCR amplification reagent;

the negative control template is RNase-free water;

three positive control templates are CHUV, BCV, DAV inactivated viruses respectively;

the standard templates are three, namely CHUV, BCV, DAV gene segment 2 (Seg-2) single-stranded RNA (ssRNA).

Further, it is preferable that the copy numbers of CHUV, BCV, DAV inactivated viruses in the positive control templates are 2.6X10, respectively ⁷ copy/mL, 3.1X10 ⁷ copy/mL and 1.9X10 ⁷ copy/mL; copy number of Seg-2ssRNA of CHUV, BCV, DAV in Standard template was 2.07×10, respectively ¹⁴ copy/mL, 2.52×10 ¹⁴ copy/mL and 3.03X10 ¹⁴ copy/mL.

Further, it is preferable that the PCR amplification reagents include One Step PrimeScript RT-PCR reagents (3 kinds in total) and a ROX reference dye (ROX Reference Dye II (50X)).

Further, it is preferable that the amplification system of the kit is:

2×One Step RT-PCR BufferⅢ，10.0μL；

TaKaRa Ex Taq HS(5U/μL)，0.4μL；

PrimeScript RT Enzyme MixⅡ，0.4μL；

ROX Reference DyeⅡ(50×)，0.4μL；

10. Mu. Mol/L of upstream primer), 0.4. Mu.L;

downstream primer (10. Mu. Mol/L), 0.4. Mu.L;

probe (10. Mu. Mol/L), 0.8. Mu.L;

template, 1.0 μl;

RNase-free water, 6.2. Mu.L;

total 20.0 μl;

the primer pair consisting of the upstream primer and the downstream primer is any one of three pairs of primers CHUV_F and CHUV_ R, BCV _F and BCV_ R, DAV _F and DAV_R; the probe is a TaqMan probe matched with a primer pair consisting of an upstream primer and a downstream primer.

Further, it is preferable that the amplification procedure of the kit:

reverse transcription is carried out at 42 ℃ for 5min for 1 cycle; pre-denaturation at 95 ℃,10s,1 cycle total; denaturation at 95 ℃,5s, annealing at 60 ℃,34s, 40 cycles total.

The three TaqMan probes for qualitatively and quantitatively detecting the PALV with different serotypes have nucleotide sequences shown in SEQ ID NO.7 to SEQ ID NO.9, wherein the 5' end of the probes is marked by a reporting fluorescent group, the 3' end of the probes is marked by a quenching fluorescent group, and in order to prevent the probes from being extended during PCR amplification, the 3' end of the probes needs to be subjected to phosphorylation treatment. Wherein FAM is a 6-carboxyfluorescein reporter fluorophore and BHQ1 is a black hole quenching fluorophore.

The invention provides three pairs of primers, three TaqMan probes and a detection kit for qualitative and quantitative detection of CHUV, BCV and DAV, and the purpose of accurately and qualitatively and quantitatively detecting the CHUV, BCV and DAV RNA in a sample to be detected can be achieved by extracting total RNA of the sample to be detected and combining with a qRT-PCR technology. The primer, the probe and the detection kit provided by the invention not only can be used for clinical detection of CHUV, BCV and DAV, but also can be used for qualitative and quantitative analysis of CHUV, BCV and DAV RNA in infected animals, and can play an important role in prevention and control of PALV in China.

The kit provided by the invention provides RNase-free water as a negative control template and known copy number inactivated CHUV, BCV and DAV as positive control templates respectively. Namely, when the qRT-PCR amplification system reacts with a negative control template, the template is RNase-free water; when the qRT-PCR amplification system reacts with a positive control template, the templates are CHUV, BCV and DAV inactivated viruses respectively; when the qRT-PCR amplification system is reacted with a sample template to be detected, the template is viral RNA extracted from animal tissues or blood suspected of PALV infection. The primer and the probe provided by the invention are used for carrying out qRT-PCR amplification on a negative control template, a positive control template and a sample template to be detected, after amplification, fluorescence signals of each cycle are collected, the collected fluorescence signals of the sample template to be detected are compared with the fluorescence signals of the positive control template, the amplification curve of the sample template to be detected, which is similar to the positive control template, is positive, and the amplification curve of the sample template to be detected, which is not present, is negative.

The kit of the invention provides known copy numbers CHUV, BCV and DAV Seg-2ssRNA as standard templates, respectively. When the qRT-PCR amplification system reacts with a standard template, the templates are CHUV, BCV and DAV Seg-2ssRNA respectively; when the qRT-PCR amplification system is reacted with a sample template to be detected, the template is viral RNA extracted from animal tissues or blood suspected of PALV infection. The primer and the probe provided by the invention are utilized to carry out qRT-PCR amplification on the standard sample template and the sample template to be detected, and fluorescent signals of each cycle are collected after the amplification. And (3) respectively drawing standard curves by taking the logarithmic values of initial copy numbers Log10 of CHUV, BCV and DAV standard templates as X-axis and Ct values as Y-axis. Comparing the fluorescent signal of the sample template to be detected with a standard curve, and further quantitatively detecting the viral RNA in the sample template to be detected, and determining the copy number of the viral RNA in the sample template to be detected.

The specific principle of the invention is that three pairs of specific primers and three TaqMan probes suitable for qRT-PCR detection are designed aiming at the CHUV, BCV and DAV Seg-2 sequences popular in China, FAM groups are used as reporting fluorophores of the probes, and BHQ1 is used as quenching fluorophores of the probes; respectively constructing positive plasmids containing full-length sequences of CHUV, BCV and DAV Seg-2, linearizing the plasmids by using restriction enzymes, carrying out in vitro transcription of CHUV, BCV and DAV Seg-2ssRNA as templates, optimizing a reaction system and reaction conditions of qRT-PCR by using purified ssRNA as templates, and establishing a standard curve; inactivating CHUV, BCV and DAV with known copy numbers by using beta-propiolactone, and respectively taking the CHUV, BCV and DAV as positive control templates, wherein the inactivation method is as follows: the volume ratio of the beta-propiolactone to the virus culture solution is 1:4000, the beta-propiolactone is inactivated for 24 hours at 4 ℃ after being uniformly mixed, and then the beta-propiolactone is hydrolyzed in water bath for 2 hours at 37 ℃; finally, qRT-PCR primers, probes and detection kits suitable for detecting the PALV of different serotypes are constructed.

Compared with the prior art, the invention has the beneficial effects that:

(1) The invention designs the CHUV, BCV and DAVqRT-PCR amplification primer and probe with strong specificity, and constructs a qRT-PCR detection kit capable of detecting three serotypes PALV (namely CHUV, BCV and DAV) RNA popular in China on the basis of the primers and the probe, and the kit has the advantages of specificity, sensitivity, rapidness, high efficiency, safety and the like.

(2) At present, only a serogroup-specific nested PCR detection method designed for the PALV Seg-3 gene is reported by Imadeldin worldwide, but no nucleic acid detection method for identifying the PALV serotype is reported. The invention develops a serotype specific qRT-PCR detection kit aiming at Chinese PALV strains for the first time. The three serotypes of CHUV, BCV and DAV are popular in China, the serotype identification is carried out by means of the traditional neutralization test, so that the reference strains and standard positive serum are needed, the time is long and generally 1-2 weeks, the detection kit developed by the invention can accurately identify the PALV serotype only in 1 hour, the virus identification time is greatly shortened, and the labor cost is saved. The traditional neutralization test needs to identify the serotypes by using a reference strain, and has biological safety problems such as virus diffusion and the like, but the whole operation process of the detection kit developed by the invention does not involve live viruses, so that the biological safety is improved.

(3) The invention respectively uses CHUV, BCV and DAV Seg-2ssRNA as standard template to construct standard curve (figures 1-3), which is more accurate and reliable than the data obtained by using recombinant plasmid DNA or nucleic acid extracted from virus liquid as standard template, more importantly, the PALV serotype qRT-PCR detection kit developed by the invention can quantitatively detect RNA of each serotype strain of PALV in clinical samples by using the drawn standard curve; meanwhile, the invention takes inactivated CHUV, BCV and DAV as positive control templates respectively, and is more close to the detection condition in reality.

(4) The PALV serotype qRT-PCR detection kit developed by the invention has good detection sensitivity, and is suitable for detecting early clinical samples. The sensitivity test results of the present invention showed that the lower detection limits for CHUV, BCV and DAV were 2.07×10, respectively ¹ Copy/. Mu.L, 2.52X10 ¹ Copy/. Mu.L and 3.03X10 ¹ Copy/. Mu.L (FIGS. 4-6), whereas the lower limit of detection for normal RT-PCR is typically 10 ³ Copy/. Mu.L, showing that the detection sensitivity of the invention to CHUV, BCV and DAV was 48, 40 and 33 times higher than that of the conventional RT-PCR, respectively.

(5) The invention has strong specificity. As shown in FIG. 7, the developed PALV serotype specific primers and probes of the present invention only produced specific logarithmic amplification curves for the present serotype PALV strain, but did not cross-react with other serotype PALV strains and other species of viral strains, including bluetongue virus, african horse sickness virus inactivated vaccine, epidemic hemorrhagic fever virus, and acariasis virus.

(6) The qRT-PCR specific primer, the probe and the detection kit have high reaction speed, and the whole amplification process can be completed in less than 1 hour; in addition, only the viral RNA is required to be extracted, reverse transcription is not required, the operation steps are few and simple, and RNA degradation and pollution can be effectively avoided; meanwhile, after qRT-PCR amplification is finished, whether CHUV, BCV and DAV RNA exist in the sample to be detected can be directly judged without agarose gel electrophoresis.

(7) Compared with the competitive ELISA (competitive ELISA, C-ELISA) method, the qRT-PCR detection kit developed by the invention has the advantages of high sensitivity and capability of carrying out early clinical diagnosis. The C-ELISA method mainly detects antibodies generated by infected animals, and generally requires 2-3 weeks from PALV infection to generation of detectable antibodies, but the qRT-PCR detection kit developed by the invention can carry out qualitative and quantitative detection on viral nucleic acid before antibody generation, so that the qRT-PCR detection kit developed by the invention in an application example can detect more positive blood samples than the C-ELISA method. 120 clinical blood samples are detected simultaneously by using the PALV antibody C-ELISA kit and the qRT-PCR kit developed by the invention, and the result shows that the coincidence rate between the two is 85.71%.

Drawings

FIG. 1A standard curve was established using CHUV Seg-2ssRNA according to the present invention; x-axis is initial copy number Log of standard template ₁₀ Is Ct value;

FIG. 2A standard curve was established using BCV Seg-2ssRNA according to the present invention; x-axis is initial copy number Log of standard template ₁₀ Is Ct value;

FIG. 3A standard curve was established using DAV Seg-2ssRNA according to the present invention; x-axis is initial copy number Log of standard template ₁₀ Is Ct value;

FIG. 4 CHUV serotype qRT-PCR sensitivity assay of PALV developed by the present invention; wherein, 1 to 6: standard template concentrations were 2.07×10, respectively ⁶ Copy/. Mu.L-2.07X 10 ¹ Copy/. Mu.L of CHUV Seg-2ssRNA;7: a negative control template;

FIG. 5 a BCV serotype qRT-PCR sensitivity assay for PALV developed according to the present invention; wherein, 1 to 6: standard template concentration2.52×10 respectively ⁶ Copy/. Mu.L-2.52X10 ¹ Copy/. Mu.L of BCV Seg-2ssRNA;7: a negative control template;

FIG. 6 DAV serotype qRT-PCR sensitivity assay for PALV developed by the present invention; wherein, 1 to 6: standard template concentrations were 3.03X10 respectively ⁶ Copy/. Mu.L-3.03X10 ¹ Copy/. Mu.L of DAV Seg-2ssRNA;7: a negative control template;

FIG. 7 shows a PALV serotype qRT-PCR kit specificity test developed by the present invention; wherein, 1: the template is CHUV;2: the template is BCV;3: the template is DAV; the balance of: templates are BTV-1 to BTV-24, AHSV, EHDV-1, -2, -5, -6, -7, -8 and AKAV respectively.

Detailed Description

The present invention will be described in further detail with reference to examples.

It will be appreciated by those skilled in the art that the following examples are illustrative of the present invention and should not be construed as limiting the scope of the invention. The specific techniques or conditions are not identified in the examples and are performed according to techniques or conditions described in the literature in this field or according to the product specifications. The materials or equipment used are conventional products available from commercial sources, not identified to the manufacturer.

(1) Experimental materials

Panv CHUV serotype, BCV serotype and DAV serotype strains (19 total strains) are described in isolation and sequence characterization of paliisub serogroup viruses in southern areas of china in 2012-2016, yang Heng, torpedo, li Zhanhong, meng Jinxin, yang Zhenxing, lv Minna, lin Xuhui, liao Defang, niu Baosheng, li Huachun, journal of livestock veterinary science 2018, 49, public availability from the national academy of livestock veterinary sciences in Yunnan; CHUV, BCV and DAV Seg-2ssRNA are prepared by the method for preparing the internal standard template according to the invention by the national academy of sciences of animal husbandry and veterinary science of Yunnan province; bluetongue Virus (BTV) serotype 1 (BTV-1) to BTV-24 international standard reference strains (BTV-1_rsarrrr/01 to BTV-24_rsarrrr/24), african horse sickness Virus (African Horse Sickness Virus, AHSV) inactivated vaccine, 5 serotypes of epidemic hemorrhagic fever Virus (Epizootic Haemorrhagic Disease Virus, EHDV) strains (EHDV-1, -2, -5, -6, -7, and-8), and Akabane Virus (AKAV), all given by the world animal health Organization (OIE) reference laboratory, australian mackerel, the friendship of the eastern institute of agriculture; baby hamster kidney cells (BHK-21) are derived from the national academy of sciences of livestock and veterinary science, yunnan province; rabbit anti-CHUV, BCV and DAV standard positive serum is prepared by three injections of immunized New Zealand white rabbits (Kunming university animal testing center) after inactivation of isolated CHUV, BCV and DAV strains by the national academy of livestock and veterinary sciences of Yunnan province, and standard positive serum antibody titers are 1:453, 1:320 and 1:226 respectively, and the blood of the non-immunized New Zealand white rabbits is extracted to prepare standard negative serum.

(2) Reagents and apparatus

Beta-propiolactone (Sigma); one Step PrimeScript ^TM RT-PCR Kit (Perfect Real Time) Kit and PrimeScript ^TM One Step RT-PCR Kit Ver.2 and DNA Marker were purchased from TaKaRa; pLB zero background quick connection kit, plasmid small extraction kit, escherichia coli DH5 alpha competent cells and Universal DNA purification recovery kit are purchased from Tiangen biochemical technology Co., ltd; xba I restriction enzyme, hiScribe ^TM T7 High Yield RNA Synthesis Kit and Monarch RNA Cleanup Kit are purchased from NEB corporation; easyPure Vrial DNA/RNA Kit is available from Transgen Biotech; PALV antibody C-ELISA kit was provided by the national academy of sciences of livestock and veterinary science, yunnan province.

Gradient PCR instrument Veriti 96Well Thermal Cycler (ABI); real-time fluorescent quantitative PCR instrument 7500Fast (ABI); electrophoresis apparatus Power Pac Basic (BIO-RAD); horizontal electrophoresis system DYCP-32B (Beijing Liuyi); gel Doc XR system ⁺ (BIO-RAD); ultraviolet spectrophotometer Nano Vue Plus (GE); dry constant temperature Metal bath OSE-96 (Tiangen Biochemical technologies Co., ltd.); bench top centrifuges 1-14 (Sigma); multifunctional microplate reader Versa Max Microplate Reader SoftMax Pro (Molecular Devices).

(3) Design of primers and probes

Specific primers and TaqMan probes for qRT-PCR detection of CHUV, BCV and DAV were designed for the Chinese popular sequences of CHUV, BCV and DAV Seg-2, using FAM and BHQ1 as reporter and quencher fluorophores, respectively. Primer and probe sequences are shown in Table 1.

TABLE 1 primer and probe sequence information for CHUV, BCV and DAV qRT-PCR detection

(4) Preparation of Standard template

Three pairs of specific primers were designed based on the whole genome sequences of the chinese PALV CHUV serotype, BCV serotype and DAV serotype strains obtained earlier: CHUV-S2-F and CHUV-S2-R (SEQ ID NO.10 and SEQ ID NO. 11); BCV-S2-F and BCV-S2-R (SEQ ID NO.12 and SEQ ID NO. 13); DAV-S2-F and DAV-S2-R (SEQ ID NO.14 and SEQ ID NO. 15) are respectively used for amplifying the PALV Seg-2 fragments of different serotypes (the sizes of amplified products are CHUV 767bp, BCV891bp and DAV 828bp respectively), and the nucleic acid sequences obtained by amplification through PCR reactions are shown in SEQ ID NO.16 to SEQ ID NO. 18. The primer sequences are shown in Table 2.

TABLE 2 primer information for amplification of CHUV, BCV and DAVSeg-2 fragments

Extracting CHUV, BCV and DAV RNA separated in China by using a virus DNA/RNA extraction Kit 'EasyPure Vrial DNA/RNA Kit' (Transgen Biotech), denaturing at 94 ℃ for 3min, respectively amplifying CHUV, BCV and DAV Seg-2 fragments in China by using the primers and a one-step RT-PCR technology, and carrying out PrimeScript ^TM The One Step RT-PCR Kit Ver.2 (TaKaRa) was used to generate CHUV, BCV and DAV Seg-2 DNA fragments.

Amplification system:

PrimeScript 1Step Enzyme Mix，2.0μL；

2×1Step Buffer，25.0μL；

an upstream primer (20. Mu. Mol/L), 1.0. Mu.L;

downstream primer (20. Mu. Mol/L), 1.0. Mu.L;

template RNA, 5.0. Mu.L;

RNase-free water, 16.0. Mu.L;

total 50.0 μl;

reaction conditions: reverse transcription is carried out at 50 ℃ for 30min for 1 cycle; pre-denaturation at 94 ℃,3min,1 cycle; [ denaturation 94 ℃,30s, annealing 55 ℃,30s, extension 72 ℃,1min ],35 cycles; extension at 72℃for 5min,1 cycle.

CHUV, BCV and DAV Seg-2 DNA fragments were ligated with pLB blunt-end cloning vector according to the "pLB zero background quick ligation kit" (Tian Gen Biotechnology Co., ltd.) to transform "E.coli DH 5. Alpha. Competent cells" (Tian Gen Biotechnology Co., ltd.), and positive clones were screened for sequencing identification.

Plasmids into which the target gene was inserted were extracted according to the "plasmid miniprep kit" (Tiangen Biotechnology Co., ltd.) and designated pLB _CHUV_S2, pLB _BCV_S2 and pLB _DAV_S2, the plasmids were linearized according to the "Xba I" restriction enzyme (NEB) specification, and the digested products were gel-recovered and purified according to the "Universal DNA purification recovery kit" (Tiangen Biotechnology Co., ltd.). The purified linearized plasmid DNA was used as a template according to HiScribe ^TM The T7 High Yield RNA Synthesis Kit "(NEB) instructions carry out in vitro transcription of CHUV, BCV and DAV Seg-2 ssRNA. The transcripts were purified using the RNA purification kit "Monarch RNA Cleanup Kit" (NEB), the concentration of nucleic acid after purification was determined, and the copy number was calculated based on the molecular weights of CHUV, BCV and DAV Seg-2ssRNA; RNA copy number calculation formula:

copy number (copy/mL) =rna concentration (g/mL) ×6.02×10 ²³ (copy/mol)/(340 XRNA base number).

(5) Optimizing qRT-PCR reaction system

Through repeated experiments, the reaction system of qRT-PCR is optimized, the total reaction system adopted is determined to be 20 mu L, and the required components, the corresponding concentrations and the corresponding dosages are shown in Table 3.

CHUV, BCV and DAV Seg-2 in vitro transcribed ssRNA concentrations of 2.07×10, respectively ¹⁴ copy/mL, 2.52×10 ¹⁴ copy/mL and 3.03X10 ¹⁴ copy/mL, CHUV, BCV and DAV Seg-2ssRNA were submitted to RNase-free waterDilution was performed in rows, each at a copy number of 1. Mu.L of 2.07X 10 ² Copy/. Mu.L, 2.52X10 ² Copy/. Mu.L and 3.03X10 ² Copy/. Mu.L of CHUV, BCV and DAV Seg-2ssRNA were used as templates, and primer concentrations (0.2, 0.4, 0.6, 0.8, 1. Mu. Mol/L) and probe concentrations (0.2, 0.4, 0.6, 0.8. Mu. Mol/L) were optimized, respectively, and qRT-PCR was performed with a 20. Mu.L reaction system, with optimal amplification primer and probe concentrations of 0.2. Mu. Mol/L and 0.4. Mu. Mol/L, respectively. If the reaction system is regulated, the final concentration of the primer and the probe in the system is ensured to be 0.2 mu mol/L and 0.4 mu mol/L, and a better amplification curve can be obtained.

TABLE 3 qRT-PCR detection of CHUV, BCV and DAV reaction systems

Reaction system component	Dosage (mu L)	Final concentration (mu mol/L)
			2×One Step RT-PCR BufferⅢ	10.0
TaKaRa Ex Taq HS(5U/μL)	0.4
			PrimeScript RT Enzyme MixⅡ	0.4
CHUV_F/BCV_F/DAV_F Primer(10μmol/L)	0.4/0.4/0.4	0.2/0.2/0.2
			CHUV_R/BCV_R/DAV_R Primer(10μmol/L)	0.4/0.4/0.4	0.2/0.2/0.2
CHUV_Probe/BCV_Probe/DAV_Probe(10μmol/L)	0.8/0.8/0.8	0.4/0.4/0.4
			ROX Reference DyeⅡ(50×)	0.4
Template	1.0
			RNase-Free water	6.2/6.2/6.2
Totals to	20.0

(6) Optimizing qRT-PCR reaction conditions

At a copy number of 1. Mu.L, 2.07X 10, respectively ² Copy/. Mu.L, 2.52X10 ² Copy/. Mu.L and 3.03X10 ² Copy/. Mu.L of CHUV, BCV and DAVThe Seg-2ssRNA is used as a template, the annealing temperature (55-60 ℃) is optimized, and the optimal reaction conditions are determined as follows: reverse transcription at 42℃for 5min,1 cycle; pre-denaturation 95 ℃,10s,1 cycle; [ denaturation 95 ℃,5s, annealing 60 ℃,34s ]]40 cycles.

(7) Standard curves were established using CHUV, BCV and DAV Seg-2ssRNA, respectively

On the order of 10 at 1. Mu.L copy number, respectively ⁶ Copy/. Mu.L to 10 ² Copy/. Mu.L of 5 dilutions of CHUV, BCV and DAV Seg-2ssRNA were used as templates for qRT-PCR reactions to establish CHUV, BCV and DAV specific standard curves. Initial copy number Log of template with standard ₁₀ And (3) drawing a regression curve by taking the logarithmic value of (1) as the X axis and the Ct value as the Y axis to obtain standard curves of CHUV, BCV and DAV serotype specificity qRT-PCR. The slopes are-3.70, -3.47 and-3.79 respectively, the intercepts are 41.26, 42.04 and 42.90 respectively, the correlation coefficients are 0.999, 0.997 and 0.999 respectively, and the regression equations are y= -3.70x+41.26, y= -3.47x+42.04 and y= -3.79x+42.90 respectively (figures 1-3).

TABLE 4 Standard Curve and regression equation

Serotypes	Slope of	Intercept of (intercept of)	Regression equation	Correlation coefficient
					CHUV	-3.70	41.26	y＝-3.70x+41.26	0.999
BCV	-3.47	42.04	y＝-3.47x+42.04	0.997
					DAV	-3.79	42.90	y＝-3.79x+42.90	0.999

(8) Sensitivity analysis

The CHUV, BCV and DAV detection primers, probes and detection kits related by the invention are respectively 10 in 1 mu L copy number order according to the optimized reaction system and reaction conditions ⁵ Copy/. Mu.L, 10 ⁴ Copy/. Mu.L, 10 ³ Copy/. Mu.L, 10 ² Copy/. Mu.L and 10 ¹ qRT-PCR sensitivity analysis was performed on copy/. Mu.L of CHUV, BCV and DAV Seg-2ssRNA standard templates and negative control templates, and the detection limits of the CHUV, BCV and DAV detection primers, probes and kits according to the present invention were 2.07X 10, respectively ¹ Copy/. Mu.L, 2.52X10 ¹ Copy/. Mu.L and 3.03X10 ¹ Copy/. Mu.L (FIGS. 4-6).

(9) Specificity analysis

BTV-1_RSArrrr/01-BTV-24_RSArrrr/24, AHSV, EHDV-1, -5, -6, -7, -10, AKAV, CHUV, BCV and DAV RNA were extracted using a viral DNA/RNA extraction Kit "EasyPure Vrial DNA/RNA Kit" (Transgen Biotech) and denatured at 94℃for 3min immediately followed by ice-bath. By using the CHUV, BCV and DAV detection primers, probes and detection kits of the invention, 1 mu L of the modified viral RNA is taken as a template for qRT-PCR specific analysis according to an optimized reaction system and reaction conditions, and the CHUV, BCV and DAV detection primers, probes and detection kits of the invention can specifically detect CHUV, BCV or DAV, do not have cross reaction with other serotypes PALV and do not have cross reaction with BTV, AHSV, EHDV and AKAV (shown in figure 7).

(10) Application instance

A. The qRT-PCR kit developed by the invention is utilized to detect the PALV strain

The CHUV, BCV and DAV detection primers, probes and detection kits related by the invention are utilized to detect 19 strains of PALV simultaneously with a neutralization test according to an optimized reaction system and reaction conditions. In the implementation process, the negative control template, the positive control template and the sample template to be detected are subjected to qRT-PCR amplification process in different reaction holes simultaneously. The neutralization test of panv strains was performed using standard positive and negative serum as follows: firstly, 10 times of gradient dilution is carried out on virus culture solution to be detected, single-layer BHK-21 cells are respectively inoculated, and a Karber method is adopted to carry out TCID of each strain ₅₀ Measuring; then, a micro neutralization test was performed on a 96-well plate by using a "fixed virus-diluted serum" method, CHUV, BCV and DAV standard positive serum and standard negative serum were diluted 1:20 times, respectively, and 50. Mu.L of diluted serum was taken with 100 TCIDs ₅₀ Mixing the same volume of the virus liquid to be detected, incubating for 1h in a 37 ℃ incubator, inoculating single-layer BHK-21 cells, and observing whether CPE appears day by day; finally, the neutralization index of the serum to the virus was calculated.

The serotype specific qRT-PCR kit can effectively identify CHUV, BCV and DAV strains, the Ct value range is 14.85-27.26, the coincidence rate with a neutralization test is 100%, and the specific is shown in Table 5.

TABLE 5 results of detection of PALV strains using qRT-PCR kit and neutralization assay

B. Dynamic detection of PALV infected animals by using qRT-PCR kit developed by the invention

Blood samples of sentinel animals infected by three serotypes CHUV, BCV and DAV are collected, anticoagulants of each animal PALV serum antibody C-ELISA detection result is 50 mu L each of 4 weeks before positive (serological positive transfer) and 4 weeks after serological positive transfer are taken, total RNA is extracted to be used as a sample template to be detected, qRT-PCR kit developed by the invention is utilized to carry out PALV serotype quantitative detection, and CHUV, BCV and DAV Seg-2ssRNA with a plurality of concentration gradients are set to be used as standard sample templates to carry out amplification reaction, so that a standard curve is obtained. And simultaneously carrying out qRT-PCR amplification reaction on the standard template and the sample template to be detected in different reaction holes.

The reaction result of qRT-PCR is displayed in the form of Ct value, and the negative and positive judgment standards are as follows: the Ct value is more than 39.5, the Ct value is judged to be negative, the Ct value is judged to be suspicious at 38.5-39.5, and the Ct value is less than 38.5, the Ct value is judged to be positive; and determining the copy number of PALV RNA in the positive sample template to be detected according to a standard curve established by using CHUV, BCV and DAV Seg-2ssRNA as standard sample templates and Ct value of the sample template to be detected. The results of the C-ELISA method are displayed in the form of inhibition ratio, and the negative and positive judgment standards of the reaction results are as follows: the inhibition rate is more than 50 percent positive, and the inhibition rate is less than 50 percent negative. The PALV serotype qRT-PCR detection kit developed by the invention can detect the PALV RNA at a higher level before the generation of the PALV antibody, and the PALV RNA level gradually decreases after the generation of the antibody; the C-ELISA method detected panv antibody positive transfer at week 4, with panv antibody levels maintained at higher levels throughout the next 4 weeks.

TABLE 6 results of follow-up detection of sentinel cattle using qRT-PCR kit and C-ELISA method

C. The qRT-PCR kit developed by the invention is utilized to detect clinical blood samples

A total of 120 livestock blood samples are collected, 50 mu L of blood is taken for extracting total RNA, and CHUV, BCV and DAV are detected by the qRT-PCR primer, the probe, the detection kit and the C-ELISA method. 36 positive samples are detected by the C-ELISA method, 42 positive samples are detected by the primer, the probe and the detection kit, and the coincidence rate is 85.71%. And 6 samples which are not matched with the detection result are detected by utilizing nested PCR developed by Imadeldin and the like, and the detection results are positive. Since the C-ELISA method mainly detects antibodies, 2-3 weeks are required from PALV infection to the generation of detectable antibodies, and the qRT-PCR detection kit developed by the invention detects pathogenic nucleic acids, the qRT-PCR primer, probe and detection kit developed by the invention have good sensitivity when a host is infected but no antibodies are generated yet. Of positive samples detected by the qRT-PCR detection kit developed by the invention, 13 parts are CHUV positive, 10 parts are BCV positive, 11 parts are DAV positive and 8 parts are mixed infection positive, which proves that the qRT-PCR primer, the probe and the detection kit related to the invention have good reliability.

Primer sequences derived from the primer pairs of the invention are also within the scope of the invention. The derivative sequence refers to a primer sequence obtained by substitution, deletion or addition of one to ten bases on the basis of SEQ ID NO.1 to SEQ ID NO. 9.

The foregoing has shown and described the basic principles, principal features and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and that the above embodiments and descriptions are merely illustrative of the principles of the present invention, and various changes and modifications may be made without departing from the spirit and scope of the invention, which is defined in the appended claims. The scope of the invention is defined by the appended claims and equivalents thereof.

/>

Sequence listing

<110> Yuan nan province academy of sciences of livestock and veterinary medicine

<120> real-time fluorescent quantitative RT-PCR detection primer, probe and detection kit for Pariemam serogroup virus serotype

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 1

ggagagggtc atccactcaa 20

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 2

tcccatcaaa cgttccatat gt 22

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence ()

<400> 3

gtacatgatt ttccgcaact atc 23

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence ()

<400> 4

tcctctattt tgatccgaaa cata 24

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 5

ggaggagtgt cgaagagcac 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 6

gtgctgccac tctgtytcat 20

<210> 7

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 7

tgccccgcaa cacctcttct actct 25

<210> 8

<211> 28

<212> DNA

<213> Artificial sequence ()

<400> 8

ctcttcggct tattccattc ytcatctc 28

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 9

tagytgaata taaacgtgcg ggycg 25

<210> 10

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 10

tatgcgttga accttatgta gg 22

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 11

catatcgcac aatcctatca tc 22

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 12

gaaccatttg agagggagag a 21

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 13

ggatgtggtc caacttcaca 20

<210> 14

<211> 23

<212> DNA

<213> Artificial sequence ()

<400> 14

caatgttgta tggatttgga tcc 23

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 15

acatgtccat aggaacacct t 21

<210> 16

<211> 767

<212> DNA

<213> Artificial sequence ()

<400> 16

tatgcgttga accttatgta ggctctattt cagtggatcc aacgtatagt gattttacga 60

tgcaaatgag ggtaccctta catcggaaaa agtgtgacgc tttcccaggt gaaaatcttt 120

atgaaagcgc gctacgagga cactttacta ttgatgtgcc aaaacagaga gggttaggag 180

cttcatatag tgttcagact gataacatca tcgaaagtgt agttggcgaa agtggtataa 240

cttctagaca atttcaggaa atttcaaggt tgggagaggg tcatccactc aaaattattt 300

atacaaacat gttgatcgag ttcagagtag aagaggtgtt gcggggcatg caggcatata 360

gctgtaaaac atatggaacg tttgatggga tgatagatga acagagttta acgcgtaagc 420

taacttggcg ggtccggaaa atcatgtcgt atgacgagag agatttatat gatttcaaaa 480

agaaagaaaa agcatttcta gacgaatgga agaggaaaat agagcaacag ggagggataa 540

tcaacagtcc agctaaattt agcacatatg atcaaaatct ttctgtattg aagacacagt 600

ttcaaagtca gtataacttt gacattacaa caggtggtcc attatggcaa gcgtatgtac 660

agactgcagg gggaagaatt aatgtagaag attggttgaa atggatgttc aaagttaaat 720

attgtgggga ttcacgctat tactcggatg ataggattgt gcgatat 767

<210> 17

<211> 891

<212> DNA

<213> Artificial sequence ()

<400> 17

gaaccatttg agagggagag attagaagaa atcgctaatg aagcgagaca cccgtggatg 60

cgaaggatct tatatgtagt tgccgcaata ataatcgaag aaggcggatg tgttacatta 120

gggagaagga aatggtattc caccatactg caagcatgta tcgatctaaa tccaagggtg 180

ctagacgagt gcaggcaaaa gttgaatttc gaggtttcat gcgggttaga ggcaacagac 240

ccaacgacta atttaggttc atattctgag agagatgtat tgagtgttag ttatgtagaa 300

atgcaatggg ttggggatca aatgttagat ggaaacgaga ttgattgtac tgatgttgat 360

gtgcttgaca gtaatgagga gagttttata gccaccgggt ggtcggctgt gagtaaaaat 420

acggatagct atttcaacga tatcaaagta catgattttc cgcaactatc taaatttgaa 480

cagaagggaa gaaatatatt agtgactttg aagagagatg aagaatggaa taagccgaag 540

aggttcagtt cgtatatgtt tcggatcaaa atagaggatt cagttaagat aagaattgga 600

gatcatgatg tttatgaagt gaaaggaagg aaatatccct atccttttag tgaattagga 660

ccacatacac ggacttatat gcttgagagc atgttaaccg ggcaaacacg cattatgacg 720

aaggagccga atgaaaagtg gttatggatt aagaatgaat tccagcagag gggggctcaa 780

catagagtag gaagtgagtg ggagggatgc ggagcgtcag agtggtcgca catctatctg 840

aatgaaatgg ctagattatt gcaatttaca ttaaggagaa tttgtgaagt t 891

<210> 18

<211> 828

<212> DNA

<213> Artificial sequence ()

<400> 18

caatgttgta tggatttgga tccgcaggtt ttaaatgaga taaaaaagaa gttcgatatc 60

gatgtaacgt gtgaaataga gttaaatgat ccaaccagtg atttaggacc atacgcatta 120

agaagttcga ataccgttgc atatgttgag atgaaatggg aaggagattt gtttttggat 180

aataattgga ttgaatgtgg tgatcaagat atcatcgacg aaaataatga gtcattcatt 240

aatattggtt ggggaggagt gtcgaagagc actgatagtt attttaaaga tgtcgaggtt 300

cataacttcc caaagttagc tgaatataaa cgtgcgggcc ggaacataga ggtgatattt 360

gatgaaacag agtggcagca cccaaaaaga ttccaatcat ataaattcag aattaaggta 420

gaggaagtga tgaagttttc ttttcagaca agagaagttt acgaagtatt aggtcaaaaa 480

tatcctcacc cttttggaga gtgggcaccg cacattagaa catatatgac agagaactta 540

tttacgggta tggtcagaga taaaacaccg gaaccaaacg aaaagtggaa gtgggttgaa 600

agtgaatacc gcaaacgtgg gagtttgcga agactagcgc gagattggga tggatgtcat 660

gtaagcaatt ggtccgcatg tgagatgttt gagacaagaa ggcttcttat ttttcttcta 720

agacgtattt cccagccagg accccatcca ttattttcaa aatttgatga tgaagattgg 780

ttggagagta agggatatgg cctgggtaaa ggtgttccta tggacatg 828

Claims

1. The real-time fluorescence quantitative RT-PCR detection kit for the serovars of the parlimus serogroup viruses is characterized by comprising 3 pairs of primers, namely CHUV_F and CHUV_ R, BCV _F and BCV_ R, DAV _F and DAV_R;

CHUV_F：ggagagggtcatccactcaa；

CHUV_R：tcccatcaaacgttccatatgt；

BCV_F：gtacatgattttccgcaactatc；

BCV_R：tcctctattttgatccgaaacata；

DAV_F：ggaggagtgtcgaagagcac；

DAV_R：gtgctgccactctgtytcat；

the kit also comprises a probe matched with the primer, and specifically comprises: probes CHUV_Probe used in combination with the CHUV_F and CHUV_R primers; probes BCV_Probe used in cooperation with BCV_F and BCV_R primers; probes DAV_Probe used in conjunction with DAV_F and DAV_R primers;

CHUV_Probe：FAM-tgccccgcaacacctcttctactct-BHQ1；

BCV_Probe：FAM-ctcttcggcttattccattcytcatctc-BHQ1；

DAV_Probe：FAM-tagytgaatataaacgtgcgggycg-BHQ1。

2. the kit of claim 1, further comprising: a negative control template, a positive control template, a standard template and a PCR amplification reagent;

the negative control template is RNase-free water;

three standard templates are respectively CHUV, BCV, DAV gene segment 2 single-stranded RNA.

3. The kit of claim 2, wherein the CHUV, BCV, DAV inactivated virus in the positive control template has a copy number of 2.6X10, respectively ⁷ copy/mL, 3.1X10 ⁷ copy/mL and 1.9X10 ⁷ copy/mL; copy number of Seg-2ssRNA of CHUV, BCV, DAV in Standard template was 2.07×10, respectively ¹⁴ copy/mL, 2.52×10 ¹⁴ copy/mL and 3.03X10 ¹⁴ copy/mL.

4. The kit of claim 2, wherein the PCR amplification reagents comprise One Step PrimeScript RT-PCR reagents and a ROX reference dye.

5. The kit of claim 1, wherein the amplification system is:

2×One Step RT-PCR Buffer Ⅲ，10.0 μL；

TaKaRa Ex Taq HS（5 U/μL），0.4 μL；

PrimeScript RT Enzyme Mix Ⅱ，0.4 μL；

ROX Reference Dye Ⅱ（50×），0.4 μL；

an upstream primer (10. Mu. Mol/L), 0.4. Mu.L;

downstream primer (10. Mu. Mol/L), 0.4. Mu.L;

probe (10. Mu. Mol/L), 0.8. Mu.L;

template, 1.0 μl;

RNase-free water, 6.2. Mu.L;

total 20.0 μl;

the primer pair consisting of the upstream primer and the downstream primer is any one of three pairs of primers CHUV_F and CHUV_ R, BCV _F and BCV_ R, DAV _F and DAV_R; the probe is matched with a primer pair consisting of an upstream primer and a downstream primer.

6. The kit of claim 1, wherein the kit comprises an amplification procedure of: