CN106435033A

CN106435033A - Dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting and identifying wild strain and vaccine strain of CSFV (classical swine fever virus) in swine umbilical cord blood and application of dual real-time fluorescence RT-PCR kit

Info

Publication number: CN106435033A
Application number: CN201611031305.4A
Authority: CN
Inventors: 喻正军; 李增强; 石建; 廖娟红
Original assignee: Hunan Xinnanfang Culture Service Co Ltd
Current assignee: Hunan Xinnanfang Culture Service Co Ltd
Priority date: 2016-11-22
Filing date: 2016-11-22
Publication date: 2017-02-22

Abstract

The invention discloses a dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting and identifying a wild strain and a vaccine strain of a CSFV (classical swine fever virus) in swine umbilical cord blood and an application of the dual real-time fluorescence RT-PCR kit. The kit comprises a pair of primers and two fluorescent probes, wherein the sequences of the pair of primers are shown as SEQ ID NO.1 and SEQ ID NO.2, and the sequences of the two fluorescent probes are shown as SEQ ID NO.3 and SEQ ID NO.4. The kit has the advantages of high specificity, sensitivity and accuracy and excellent repeatability, meanwhile, the wild strain and the vaccine strain of the CSFV can be identified and detected by detecting the same sample once, and the problem of genetic crossover of the CSFV with the bovine viral diarrhea virus and the border disease virus which belong to the same genus can be solved. The kit is applicable to fast identification and detection of the wild strain and the vaccine strain of the CSFV in scientific research and clinical detection, can be used for precisely evaluating and diagnosing CSFV carrying and expelling conditions of sows and latent infection conditions of piglets and can be further used for evaluating effects of CSFV vaccines.

Description

The dual reality of wild strains of classical swine fever virus and vaccine strain in a kind of detection and identification pig Cord blood When fluorescence RT-PCR test kit and application thereof

Technical field

Animal pathogenic molecular diagnostic techniques field involved in the present invention, particularly to pig in a kind of detection and identification pig Cord blood Dual real-time fluorescence PCR test kit of Pestivirus street strain and vaccine strain and application thereof.

Background technology

Swine fever is a kind of height of the pig being caused by swine fever virus (Classical Swine Fever Virus, CSFV) Contact, acute infectious disease, are mainly shown as that morbidity is anxious, hyperpyrexia is delaied, and microcirculatory vascular wall degeneration and its whole body leading to are general The property sent out point bleeding, in internal organs, multiple hemorrhages, necrosis and infarction, have contagiousness and higher fatality rate.Closely Nian Lai, the popular and characteristics of incidence of China's swine fever has a very large change, and low toxicity power hog cholera field virus strain or persistent infection draw Rise mild swine fever or non-typical swine fever relatively conventional, its pathological characters in Clinical anatomic also different from classical swine fever, Bring very big puzzlement to veterinary clinic diagnosis.

Swine fever is a class infectious disease, is one of object of state compulsion immunity, therefore in the case of compulsory immunization, swinery pig Pestilence antibody horizontal majority is positive, and the antibody that existing Serologic detection cannot be produced with vaccine strain immunity to street strain's infection is carried out Distinguish.Additionally, in Pigs Inoculated pestilence after seedling 2 weeks or in the longer time, virus can be detected in some tissues, and vaccine strain and open country The gene order of strain is highly conserved, and conventional molecular diagnosis method cannot be distinguished from two kinds of strains substantially, and the purification to swine fever is deposited In larger interference.

Detection method currently used for swine fever virus has animal inoculation to test, virus isolation techniques, traget antibody technology, enzyme Linked immunosorbent adsorption test and molecular biosciences detection technique.(1) in animal inoculation test, susceptible pig inoculation is detection swine fever virus Classical way, but the method needs higher bio-safety facility, and there is experimental animal standard disunity simultaneously, animal dis exist Individual variation, and potentially dissipate poison, the method uses less.(2) virus purification adopts cell culture method isolated viral, is test Room detection and the standard method of identification swine fever, gather the typical suspect tissue of pathological changes, blood or internal organs, ground, cracking, differential Virus is extracted in centrifugation, and using the cell line such as ST sensitive to swine fever virus, the cell such as PK-15 is cultivated.(3) serology inspection Survey method：Commercial test kit has hog cholera antibody to block the detection of ELISA method, chlamydia trachomatis, the method because It is simple to operate, quickly, technically reliable, can detect batch sample, advantage of lower cost, much country using it as execution swine fever Eliminate the official test of illness.But jointly resist because swine fever is existed with the bovine viral diarrhea virus belonging to together and sheep border disease viruses Former, on gene structure, homology reaches more than 60%.Cross reaction phenomenon is existed on Serologic detection.(4) molecular biology Detection technique：European Union employs swine fever nest-type PRC as international standard, and China also establishes swine fever virus RT-nPCR detection side Method, pig pestivirus fluorescence quantitative RT-PCR detection method and pig pestivirus fluorescence quantitative differentiate RT-PCR detection method.But it is domestic The test kit of the commercialization of independent research is also less.Regular-PCR detection method exists and false positive easily simultaneously, and the operating time is long, Shell type expands, and technical operation requires the defect of technology height etc..

All there is respective deficiency at sensitivity, specificity and the aspect such as ageing in above-mentioned Diagnosis of Classical swine fever, and these Method all can not efficiently differentiate street strain's infection and vaccination.Real-time fluorescence PCR technology (real-time Fluorescence quantitative PCR) it is a kind of newer nucleic acid growing up on the basis of Standard PCR technology Detection technique, possess sensitivity height, rapid and convenient, contamination resistance is strong, safety coefficient is good, result visualization the advantages of.Pass through Ingehious design to probe, can detect and distinguish single nucleotide base differences, therefore can be used for dissimilar poison well The differentiation detection of strain.

Daily pathogeny of hog cholera detection and disease purification process in, live body sampling need to be carried out, to swinery stress be larger, adopt Sample difficulty is also high.Inventors herein propose Cord blood detection technique, Cord blood has collection convenience, safety saves time, do not affect production The advantages of, and swine fever can pass through Placenta Hominiss vertical transmission.Although Cord blood toxic amount is low for tissue, answer actual With in also mutual confirmation has been carried out to tissue and corresponding Cord blood it is ensured that the specificity of the inventive method and sensitivity.In conjunction with umbilicuss With the detection of blood, both can accomplish Differential Diagnosiss, can avoid again stress, swinery early warning judge can be carried out simultaneously.Therefore, develop A kind of necessary with the fluorescence RT-PCR method of vaccine strain by Cord blood detection and identification wild strains of classical swine fever virus.

Content of the invention

It is an object of the invention to proposing the double of wild strains of classical swine fever virus and vaccine strain in a kind of detection and identification pig Cord blood Weight real-time fluorescence RT-PCR test kit, this test kit has sensitivity height, specificity is good, repeatability is excellent, testing result is quickly objective The advantages of see accurate, and can effectively differentiate wild strains of classical swine fever virus and vaccine strain, have simultaneously easy and simple to handle, stress not, directly Sight, special, quick and height accurately effect, can reflect mother, piglet swine fever virus band poison and toxin expelling situation, assessment sow pig simultaneously The immune effect of pestilence Seedling, side reflect sow health status level, be beneficial to the purification to colony's swine fever virus infection and The early warning of Immunity is passed judgment on, and further helps in pig farm and carries out the early warning of this disease, prevention and control.

Based on wild strains of classical swine fever virus and vaccine strain in a kind of detection and identification pig Cord blood that above-mentioned purpose, the present invention provide Dual real-time fluorescent RT test kit it is characterised in that this test kit includes amplimer and specificity fluorescent probe, institute State amplimer and the sequence of specificity fluorescent probe is as follows：

Upstream amplification primer CSFV-F：5 '-GCCATGCCCATAGTAGGA-3 ', it is SEQ ID NO:1 sequence；

Downstream amplification primer CSFV-R：5 '-CTACTGACGACTGYCCTGTA-3 ', it is SEQ ID NO:2 sequences, its Middle Y=C/T；

Specificity fluorescent probe CSFV-LV：VIC-5 '-TGGCTAGTCCCTCCGTTTTGC-3 '-BHQ1, it is SEQ ID NO:3 sequences, wherein VIC are fluorescent reporter group, and BHQ1 is non-fluorescence quenching group；

Specificity fluorescent probe CSFV-Wt：FAM-5 '-ACGGCTAGTCCCTCCGTTTG-3 '-BHQ1, it is SEQ ID NO:4 sequences, wherein FAM are fluorescent reporter group, and BHQ1 is non-fluorescence quenching group.

Rational primer and fluorescent probe design are the keys of successful Application real-time fluorescence PCR technology.Primer and probe Specificity has a significant impact to reaction, if primer and probe specificity be not high, may produce non-target bar in amplification is constituted Band, the judgement of impact testing result.

The present invention (includes cattle to the CSFV (including street strain and attenuated vaccine strain) announcing in GenBank and other virus Viral diarrhea virus and sheep border disease viruses) gene order is analyzed, in 5 ' highly conserved-UTR noncoding regions On devise general upstream and downstream amplimer CSFV-F and CSFV-R for CSFV, and contain in downstream amplification primer CSFV-R There is merger base Y, make the scope of amplification more extensive.Utilize CSFV street strain and hog cholera lapinised virus vaccine pnca gene group simultaneously The difference of 2 bases in 5 '-UTR, devises CSFV street strain (Shimen strain) specificity fluorescent of different fluorophor labellings Probe CSFV-Wt and hog cholera lapinised virus vaccine strain (HCLV strain) specificity fluorescent probe CSFV-LV, specificity fluorescent probe CSFV-Wt and Shimen strain RNA specifically binds, and amplified reaction is shown blue-fluorescence (FAM passage), is no combined with HCLV strain RNA, Amplified reaction redgreen fluorescence display (VIC passage)；Specificity fluorescent probe CSFV-LV is no combined with Shimen strain RNA, amplification Reaction no blue-fluorescence shows (FAM passage), specifically binds with HCLV strain RNA, and amplified reaction shows green fluorescence and shows (VIC Passage).Show that two probe specificity are good, wild strains of classical swine fever virus and vaccine strain can be differentiated.

Primer of the present invention and probe design on swine fever virus genome 5 '-UTR noncoding region, this group primer and probe High specificity, on the one hand can solve the problem that swine fever virus with the bovine viral diarrhea virus belonging to together and sheep border disease viruses and there is gene The problem intersected, on the other hand can distinguish wild strains of classical swine fever virus and vaccine strain, detection more specificity simultaneously.

Sow swine fever virus band poison and toxin expelling shape are evaluated using detection CSFV genome 5 '-UTR from piglet Cord blood Condition, piglet in the health status of female In vivo infection situation and feedback sow, be one kind more science, directly and effectively diagnose pig One of method of plague disease, assessment swine Fever Vaccine protection level and Disease Warning Mechanism aspect, in the hog cholera of large-scale pig farm Relatively reliable technical support is played in purification process.

In the present invention, it is preferred to, described upstream amplification primer CSFV-F, described downstream amplification primer CSFV-R, described The mol ratio of specificity fluorescent probe CSFV-LV and described specificity fluorescent probe CSFV-Wt is 2:2:1:1.

In the present invention, it is preferred to, described upstream amplification primer CSFV-F, described downstream amplification primer CSFV-R, described The specificity fluorescent probe CSFV-LV and described specificity fluorescent probe CSFV-Wt final concentration in described test kit is 0.2 ～0.8 μM.

In the present invention, it is preferred to, described test kit also includes negative control, positive control, the reaction of 2 × fluorescence RT-PCR Liquid；UNG enzyme system is contained in described 2 × fluorescence RT-PCR reactant liquor.

Add 2 × fluorescence RT-PCR reactant liquor in PCR reaction system, it includes UNG enzyme system, permissible in amplification link Effectively solving expands contamination phenomenon, and contamination resistance is strong etc..

In the present invention, it is preferred to, described negative control is the ddH of no DNA enzymatic₂O；Described positive control has pig for clone Pestivirus street strain (Shimen) genome 5 '-UTR fragment and rabbitization attenuated vaccine strain (HCLV) genome 5 '-UTR fragment Final concentration of the 1.0 × 10 of cloned plasmids pEASY-5UTR2, cloned plasmids pEASY-5UTR2⁵Copies/ μ l～1.0 × 10⁷copies/μl.

In the present invention, it is preferred to, described wild strains of classical swine fever virus (Shimen) genome 5 '-UTR fragment and described pig The nucleotide sequence of pestilence rabbitization attenuated vaccine strain (HCLV) genome 5 '-UTR fragment is respectively as SEQ ID NO:5 and SEQ ID NO:Shown in 6.

Wild strains of classical swine fever virus (Shimen) genome 5 '-UTR

GCCATGCCCATAGTAGGACTAGCAAACGGAGGGACTAGCCGTAGTGGCGAGCTCCCTGGGTGGTCTAAGTCCTGAGT ACAGGACAGTCGTCAGTAG(SEQ ID NO:5)；

Rabbitization attenuated vaccine strain (HCLV) genome 5 '-UTR fragment sequence is：

GCCATGCCCATAGTAGGACTAGCAAAACGGAGGGACTAGCCATAGTGGCGAGCTCCCTGGGTGGTCTAAGTCCTGAG TACAGGACAGTCGTCAGT AG(SEQ ID NO:6).

In the present invention, it is preferred to, described cloned plasmids pEASY-5UTR2 is prepared using following methods：Using SEQ ID NO:1 and SEQ ID NO:Primer shown in 2 expands wild strains of classical swine fever virus (Shimen) genome 5 '-UTR fragment respectively With rabbitization attenuated vaccine strain (HCLV) genome 5 '-UTR fragment, cloned wild strains of classical swine fever virus (Shimen) gene by TA Group 5 '-UTR fragments and rabbitization attenuated vaccine strain (HCLV) genome 5 '-UTR fragment are cloned into pEASY-T1 carrier, and screening is positive Clone, the correct cloned plasmids that are sequenced are named as pEASY-5UTR2.

Further, present invention also offers wild strains of classical swine fever virus and vaccine strain in described detection and identification pig Cord blood Dual real-time fluorescent RT test kit using method, comprise the following steps：

(1), when being expanded using described dual real-time fluorescent RT test kit, reaction system is calculated as with 20 μ L：

10μM SEQ ID NO:Upstream amplification primer shown in 1：0.4～0.8 μ L；

10μM SEQ ID NO:Downstream amplification primer shown in 2：0.4～0.8 μ L；

10μM SEQ ID NO:Specificity fluorescent probe CSFV-LV shown in 3：0.2～0.4 μ L；

10μM SEQ ID NO:Specificity fluorescent probe CSFV-Wt shown in 3：0.2～0.4 μ L；

2 × fluorescence RT-PCR reactant liquor：10μL；

RNA template：2μL；

ddH₂O：Complement to 20 μ L；

(2) Fluorescence PCR condition is：50 DEG C of reverse transcription 20min；95 DEG C of denaturations 1min；95 DEG C of degeneration 10Sec, 60 DEG C annealing 45Sec collect fluorescence, totally 40 circulations；Last 25 DEG C of cooling 10sec, terminate reaction；

(3) interpretation of result：

Quality control：Negative control FAM Air conduct measurement no Ct value, VIC Air conduct measurement no Ct value；Positive control FAM passage Detection Ct value≤30, VIC Air conduct measurement Ct value≤30；Above-mentioned condition meets simultaneously, and testing result is effective；

Result judgement：FAM Air conduct measurement Ct value≤40, VIC Air conduct measurement no Ct value, then judge sample as wild-type classical swine fever Virus strain infection is positive；FAM Air conduct measurement no Ct value, VIC Air conduct measurement≤40, then judge sample as swine fever virus vaccine sun Property；FAM Air conduct measurement Ct value≤40, VIC Air conduct measurement≤40, then judge that sample contains wild strains of classical swine fever virus and vaccine simultaneously Strain；FAM Air conduct measurement no Ct value, VIC Air conduct measurement no Ct value, then judge that sample is negative as swine fever virus infection.

In the present invention, in order that detection street strain and vaccine strain specific probe and template occur the efficiency of mispairing Low, the concentration of annealing temperature, primer concentration and two probes is optimized, especially the concentration of two probes, probe is dense Spend low specific fluorescence signal can be caused to die down, and excessive concentration that two probes and template then can be caused to occur is non-specific In conjunction with generation non-specific fluorescence signal is thus disturb specific fluorescence signal.The present invention tests through series of optimum, finally Determine Fluorescence PCR system and the reaction condition of the present invention, using the dual real-time fluorescent RT method detection of the present invention The amplification efficiency of wild strains of classical swine fever virus and vaccine strain all reaches more than 90%, and occur mispairing efficiency minimum.

In the present invention, it is preferred to, described RNA template is prepared using following methods：

(1) take 100-200 μ L pig Cord blood to put in 1.5mL EP pipe, add 1mL lysate fully to mix, room temperature stands 5min；

The composition of described lysate and proportioning are as follows：1. guanidine hydrochloride 4-6M；2. dodecyl sodium sulfate SDS 0.1- 0.2%；3. polysorbas20 1-2%；4. Nonidet P40 NP40 1-2%；

(2) add 0.6mL isopropanol and 10 μ L magnetic beads, vibrate 15s, stand 2min；

(3) EP pipe is put into magnetic frame absorption 1-2min, discard liquid；

(4) add 0.5mL isopropanol, liquid in EP pipe is gently mixed, room temperature stands 10min；

(5) EP pipe is put into magnetic frame absorption 1-2min, discard liquid；

(6) ethanol solution that 1mL mass percent is 70%, gently washing precipitation are added；EP pipe is put into magnetic frame inhale Attached 1-2min, discards liquid；

(7) dry, add appropriate DEPC H₂O dissolves, 56 DEG C of dissolutions 10-15min；

(8) quick electrophoresis detection RNA integrity.

The present invention in nucleic acid extraction link, using guanidine hydrochloride, SDS, polysorbas20, NP40, isopropanol and mass percent Ethanol solution for 70% etc. washs, and can effectively reduce the interference removing haemolysis, obtains high-quality nucleic acid.

Further, present invention also offers described test kit swine fever virus in preparing detection and identification pig Cord blood Purposes in the dual real-time fluorescent RT reagent of street strain and vaccine strain.

The present invention designs universal primer and two different fluorophors on swine fever virus genome 5 '-UTR noncoding region The specific probe of labelling, by being optimized to annealing temperature, primer concentration and two specific probe concentration etc., sets up The dual real-time fluorescent RT method of wild strains of classical swine fever virus and vaccine strain in detection and identification pig Cord blood.Sensitivity test Result shows, the detection range of the method is 10⁸-10¹Copies/ μ L, can detect the viral level of minimum 10copies Sample.Specific test result shows, the method passes to bovine viral diarrhea virus, pig circular ring virus, PRV (Pseudorabies virus), pig Metachromia marcy agent, Porcine epidemic diarrhea virus, Porcine reproductive and respiratory syndrome variant and classical strain, Shimen, HCLV The cell culture of infection and normal cell all no nonspecific reactions, illustrate the method specificity and highly reliable.Accuracy Result of the test shows, for the detection of positive control and negative control, the method is accorded with RT-PCR method testing result 100% Close；For the detection of clinical sample, the method detection positive 5/36, RT-PCR method detection positive 3/36, and the 3 of the latter's detection Part sample is the positive using the method detection, illustrates that the method is more more sensitive than RT-PCR method, and accuracy is high.Replica test Result shows, the method is respectively less than 1% to the positive control detection coefficient of variation (CV) of different nucleic acid concentrations, has preferably heavy Renaturation.

Present invention application dual real-time fluorescent RT detection and identification wild strains of classical swine fever virus and the operation principle of vaccine strain： Because pig belongs to epithelium villous placenta, there is the reason of blood placental barrier between sow and fetus independence blood circulation, just Normal " Cord blood " is free from pathogen and antibody materials, there is not the related gene fragment of any cause of disease, therefore, can lead to Cross and whether there is swine fever virus nucleic acid in detection " Cord blood " to judge the situation of sow of not falling ill with poison, early warning Infection in Piglets pig The risk of Pestivirus, and then evaluate immune level and the malicious situation of band of sow etc., design simultaneously is respectively directed to street strain and vaccine Whether the probe of strain accurately distinguishes further is street strain's infection.Concretely comprise the following steps：(1) sample collecting；(2) sample treatment；(3) RNA extracts；(4) dual real-time fluorescent RT：Specific primer and probe using present invention design are carried out；(5) judge knot Really.

Compared with prior art, the test kit of the present invention has the advantages that：

(1) detection method of the present invention overcomes conventional sense technology time-consuming, sensitivity is low, safety coefficient is low, anti-soil With the problems such as being unable to accurate quantitative analysis, detection rapidly and efficiently, does not result in sample cross contamination to dye ability.

(2) the detection method accuracy of the present invention is high, and sensitivity is high, high specificity, and repeatability is excellent, it is possible to achieve big flux The detection of sample.

(3) detection method of the present invention is applicable not only to detect Cord blood detection, applies also for spleen, the lymph of pig to be checked The samples such as knot, serum and blood plasma, can be used for any laboratory and basic unit prevention and control at different levels unit, veterinary station and large, medium and small plant Deng.

(4) in the detection of daily swine fever and disease purification process, live body sampling need to be carried out, to swinery stress be larger, difficult Degree is also high, and Cord blood avoids these problems, although Cord blood toxic amount is low for tissue, in actual applications Also mutual confirmation has been carried out to tissue and corresponding Cord blood it is ensured that the specificity of detection method and sensitivity.

(5) present invention fully uses efficient amplification, the good specificity of nucleic acid hybridization technique and the fluorescence inspection of round pcr The quick sensitivity of survey technology, carries out one-time detection operation and can complete wild strains of classical swine fever virus and vaccine strain to same sample Discriminating detection it may be determined that sample is wild strains of classical swine fever virus infection, or swine fever virus vaccine infection, or two Person's co-infection；And can solve the problem that swine fever virus and there is gene with the bovine viral diarrhea virus belonging to together and sheep border disease viruses The problem intersected.

Brief description

Fig. 1 is gradient amplification canonical plotting (FAM passage) of 10 times of dilutions of positive control of the present invention；

Fig. 2 is gradient amplification canonical plotting (VIC passage) of 10 times of dilutions of positive control of the present invention；

Fig. 3 detects the wild strains of classical swine fever virus result figure of variable concentrations for fluorescence RT-PCR of the present invention；

Fig. 4 detects the swine fever virus vaccine result figure of variable concentrations for fluorescence RT-PCR of the present invention；

Fig. 5 is wild strains of classical swine fever virus sensitivity Detection result figure of the present invention；

Fig. 6 is swine fever virus vaccine sensitivity Detection result figure of the present invention；

Fig. 7 is test kit specific detection result figure (FAM passage) of the present invention；

Fig. 8 is test kit specific detection result figure (VIC passage) of the present invention；

Fig. 9 is test kit repeatability testing result figure of the present invention.

Specific embodiment

In embodiment 1 detection and identification pig Cord blood, wild strains of classical swine fever virus and the dual real-time fluorescent RT of vaccine strain try The composition of agent box

(1) 2 × fluorescence RT-PCR reactant liquor (containing enzyme)：Raw material only praises (VAZYME) company purchased from Nanjing promise；This reactant liquor In contain UNG enzyme system, contamination phenomenon can be expanded with effectively solving in amplification link, contamination resistance is strong etc.；

(2) RT-PCR primer group CSFV-F and CSFV-R：Synthesized by Shanghai Sheng Gong bio-engineering corporation, prepared with DEPC water Concentration is become to be 10 μM.

(3) specificity fluorescent probe CSFV-LV and CSFV-Wt：Synthesized by Huada gene company, be configured to DEPC water dense Spend for 10 μM.

Specificity fluorescent probe CSFV-Wt：FAM-5 '-ACGGCTAGTCCCTCCGTTTG-3 '-BHQ1, it is SEQ ID NO:4 sequences, wherein FAM are fluorescent reporter group, and BHQ1 is non-fluorescence quenching group；

The present invention (includes cattle to the CSFV (including street strain and attenuated vaccine strain) announcing in GenBank and other virus Viral diarrhea virus and sheep border disease viruses) gene order is analyzed, in 5 ' highly conserved-UTR noncoding regions On devise general upstream and downstream amplimer CSFV-F and CSFV-R for CSFV, and contain in downstream amplification primer CSFV-R There is merger base Y, make the scope of amplification more extensive.Utilize CSFV street strain and hog cholera lapinised virus vaccine pnca gene group simultaneously The difference of 2 bases in 5 '-UTR, devises CSFV street strain (Shimen strain) specificity fluorescent of different fluorophor labellings Probe CSFV-Wt and hog cholera lapinised virus vaccine strain (HCLV strain) specificity fluorescent probe CSFV-LV, specificity fluorescent probe CSFV-Wt and Shimen strain RNA specifically binds, and amplified reaction is shown blue-fluorescence (FAM passage), is no combined with HCLV strain RNA, Amplified reaction redgreen fluorescence display (VIC passage)；Specificity fluorescent probe CSFV-LV is no combined with Shimen strain RNA, amplification Reaction no blue-fluorescence shows (FAM passage), specifically binds with HCLV strain RNA, and amplified reaction shows green fluorescence and shows (VIC Passage).Show that two probe specificity are good, wild strains of classical swine fever virus and vaccine strain can be distinguished.

(4) positive control has wild strains of classical swine fever virus (Shimen) genome 5 '-UTR fragment and rabbitization weak poison epidemic disease for clone The recombiant plasmid pEASY-5UTR2 of Seedling strain (HCLV) genome 5 '-UTR fragment, is built by this laboratory, plasmid is in ultraviolet spectrometry Photometer OD260nm quality measurement concentration, by formula 6.02 × 10²³×(X ng/μL×10^-9)/DNA changes length × 660 Calculate as copy number, compound concentration is 1.0 × 10⁵Copies/ μ L～1.0 × 10⁷copies/μL；

Wherein, the construction method of cloned plasmids pEASY-5UTR2 is as follows：1. extract according to commercial reagents box operating instruction Wild strains of classical swine fever virus (Shimen) RNA and rabbitization attenuated vaccine strain (HCLV) RNA；With SEQ ID NO:1 and SEQ ID NO:2 As primer amplified wild strains of classical swine fever virus (Shimen) genome 5 '-UTR fragment sequence and hog cholera lapinised virus epidemic disease Seedling strain (HCLV) genome 5 '-UTR fragment sequence, reaction condition is：50 DEG C of reverse transcription 20min；95 DEG C of denaturations 1min；95℃ Degeneration 10Sec, 60 DEG C of annealing 45Sec, 72 DEG C of extension 30s, totally 40 circulations；72 DEG C re-extend 10min, 4 DEG C of insulation 5min. PCR primer carries out electroresis appraisal in 2% agarose gel；

2. the purification of PCR primer, Cloning and sequence analysis：The PCR primer AxyPrep DNAGel of AXYGEN company Excraction Kit glue reclaim test kit reclaims, and is cloned wild strains of classical swine fever virus (Shimen) genome 5 '-UTR by TA Fragment sequence and hog cholera lapinised virus vaccine strain (HCLV) genome 5 '-UTR fragment sequence are cloned into pEASY-T1 carrier, then Conversion Trans1-T1Phage Resistant Competent cell, coats the LB culture medium flat plate containing IPTG and X-gal On, 37 DEG C of culture 12h-18h.After the screening of blue white macula, with the Plasmid Mini Kit 1 plasmid extraction reagent of OMEGA company Box extracts plasmid, is then expanded with primer and is sequenced, and compares successful cloned plasmids name pEASY-5UTR2 after sequencing.

Wherein：Wild strains of classical swine fever virus (Shimen) genome 5 '-UTR fragment sequence is：

GCCATGCCCATAGTAGGACTAGCAAAACGGAGGGACTAGCCATAGTGGCGAGCTCCCTGGGTGGTCTAAGTCCTGAG TACAGGACAGTCGTCAGTAG(SEQ ID NO:6).

(5) negative control is the no ddH of DNAase₂O；

(6) operation instructions.

In embodiment 2 detection and identification pig Cord blood, wild strains of classical swine fever virus and the dual real-time fluorescent RT of vaccine strain try The using method of agent box

Test kit using method of the present invention specifically includes following steps：(1) sample collecting；(2) sample treatment；(3) RNA carries Take；(4) dual real-time fluorescent RT：Specific primer and probe using present invention design carry out dual real-time fluorescence RT- PCR detects；(5) result of determination.

(1) sample collecting

1. take clean penicillin bottle and bottle stopper, clean up, boiling sterilization 30 minutes, collect standby after drying；

2., when piglet is born, " Cord blood " of all piglets of every Farrowing is all extruded into a clean penicillium sp In plain bottle, every piglet 3-5 drips, and its " Cord blood " is extruded into penicillin bottle, sealing；

Points for attention：1. have to gather all of piglet that brood sow produces, it is to avoid brood sow litter Body difference causes missing inspection；2. can be with operated by two people it is also possible to individually operated, if piglet Cord blood inconvenience extrusion, can be by umbilical cord It is cut into several sections to operate again；If 3. mummy in Farrowing, during stillborn fetuses, brood piglet Cord blood emphasis detection；4. weak In addition young Cord blood can individually regather portion, and emphasis detects；

3. cover bottle stopper after Cord blood has been collected, carry out labelling with label paper or medical white glue cloth in penicillin bottle, note The information such as bright acquisition time, sow overbit, parity；

4. the penicillin bottle of the Cord blood of collection is put and preserve to -20 ° of refrigerator freezings, deliver to test in laboratory, and enclose The collection quantity of cord blood sample, sow overbit, need the inventory of detection project.

(2) in sample, template ribonucleic acid extracts

1. take 50-100mg pig Cord blood to put in 1.5ml homogenizer, add 1ml lysate to be fully homogenized, room temperature stands 5min；

The composition of lysate and proportioning are as follows：1. guanidine hydrochloride 4-6M；2. dodecyl sodium sulfate SDS, it is in lysate Mass fraction be 0.1-0.2%；3. polysorbas20, its mass fraction in lysate is 1-2%；4. the poly- second of ethylphenyl two Alcohol NP40, its mass fraction in lysate is 1-2%；

2. add 0.6ml isopropanol and 10 μ L magnetic beads (purchased from Sai Mofei company), vibrate 15s, stand 2min；

3. EP pipe is put into magnetic frame absorption 1-2min, discard liquid；

4. add 0.5ml isopropanol, liquid in EP pipe is gently mixed, room temperature stands 10min；

5. EP pipe is put into magnetic frame absorption 1-2min, discard liquid；

6. add the ethanol solution that 1ml mass percent is 70%, gently washing precipitation；EP pipe is put into magnetic frame absorption 1-2min, discards liquid；

7. dry, add appropriate DEPC H₂O dissolves (56 DEG C of dissolution 10～15min)；

8. quick electrophoresis detection RNA integrity.

The present invention extracts in link in RNA, using guanidine hydrochloride, SDS, polysorbas20, NP40, and isopropanol and mass percent are 70% ethanol solution etc. washs, and can effectively reduce the interference removing haemolysis, obtains high-quality nucleic acid.

Extract 6 parts of random cord blood sample total serum IgE according to said method, through the detection of nucleic acid-protein detector, the equal energy of concentration Reach more than 0.132 μ g/ μ l, A260/A280 ratio, all between 1.9-2.0, shows that RNA purity height, integrity are good, specifically counts According to being shown in Table 1.

Table 1RNA quality measurements

Sample number into spectrum	Volume (μ l)	Concentration (μ g/ μ l)	Total amount (μ g)	A260/A280	Quality evaluation
						001	50	0.248	12.4	1.93	Qualified
002	50	0.239	12.0	1.95	Qualified
						003	50	0.162	8.1	1.90	Qualified
004	50	0.252	12.6	1.94	Qualified
						005	50	0.132	6.6	1.91	Qualified
006	50	0.163	8.2	1.95	Qualified

(3) real-time fluorescence RT-PCR

In order that detection street strain and vaccine strain specific probe occur the efficiency of mispairing minimum with template, to dual real-time Fluorescence PCR system and reaction condition are optimized.Through optimizing, real-time fluorescence PCR reaction system and reaction condition are as follows Shown：

Real-time fluorescence RT-PCR reaction system：SEQ ID NO:Upstream amplification primer CSFV-F (10 μM) shown in 1：0.4 ～0.8 μ L；SEQ ID NO:Downstream amplification primer CSFV-R (10 μM) shown in 2：0.4～0.8 μ L；SEQ ID NO:Shown in 3 Specificity fluorescent probe CSFV-LV：(10μM)：0.2～0.4 μ L；SEQ ID NO:Specificity fluorescent probe shown in 4 CSFV-Wt(10μM)：0.2～0.4 μ L；2 × fluorescence RT-PCR reactant liquor (containing enzyme)：10μL；RNA template：2μL；ddH₂O：Mend Enough to 20 μ L.

The reaction condition of fluorescent PCR is：RT-PCR reaction condition is：50 DEG C of reverse transcription 20min；95 DEG C of denaturations 1min； 95 DEG C of degeneration 10Sec of circulation step, 60 DEG C of annealing 45Sec simultaneously collect fluorescence, totally 40 circulations；Last 25 DEG C of cooling 10sec, knot Shu Fanying；

It is simultaneously provided with negative control and positive control, the addition of negative control and positive control is 2 μ L

(4) result of determination

In embodiment 3 detection and identification pig Cord blood, wild strains of classical swine fever virus and the dual real-time fluorescent RT of vaccine strain try The checking of agent box

1. amplification efficiency checking

Positive control cloned plasmids pEASY-5UTR2 is carried out with 10 times of gradient dilutions so as to copy number is：10⁸- 10¹Copies/ μ l, each gradient carries out real-time fluorescence RT-PCR in triplicate, makes standard curve according to amplification.

Fig. 1 is gradient amplification standard curve (FAM passage) of 10 times of dilutions of positive control of the present invention, wherein this standard curve Parameter as follows：Slope：- 3.56, intercept：39.78, correlation coefficient：0.998, amplification efficiency：0.91.

Fig. 2 is gradient amplification standard curve (VIC passage) of 10 times of invention positive control dilution, wherein this standard curve Parameter is as follows：Slope：- 3.45, intercept：40.40, correlation coefficient：0.996, amplification efficiency：0.95.

To sum up, illustrate that this test kit detects that wild strains of classical swine fever virus and the amplification efficiency of vaccine strain all reach more than 90%.

2. double fluorescent RT-PCR specificity verification

Concentration is taken to be 10 respectively⁷、10⁶、10⁵Copies/ μ L wild strains of classical swine fever virus (Shimen strain) RNA or swine fever virus Vaccine strain (HCLV strain) RNA, as template, is separately added into the RT- containing specificity fluorescent probe CSFV-LV and CSFV-Wt simultaneously In PCR reaction system, carry out real-time fluorescence RT-PCR amplification, the specificity matching degree of two probes of checking and corresponding templates.Knot Fruit is as follows, and specificity fluorescent probe CSFV-Wt and Shimen strain RNA specifically binds, and amplified reaction shows blue-fluorescence, and (FAM leads to Road), be no combined with HCLV strain RNA, amplified reaction redgreen fluorescence display (VIC passage), as shown in Figure 3；Specificity fluorescent is visited Pin CSFV-LV is no combined with Shimen strain RNA, and amplified reaction no blue-fluorescence shows (FAM passage), special with HCLV strain RNA Property combine, amplified reaction show green fluorescence show (VIC passage), as shown in Figure 4.Show that two probe specificity are good, can reflect Other wild strains of classical swine fever virus and vaccine strain.

3. sensitivity test

Using the positive control cloned plasmids pEASY-5UTR2 of 10 times of gradient dilutions as template, carry out test kit of the present invention Sensitivity technique, detection range be 10⁸-10¹copies/μL.Result shows, the detection range of the method is 10⁸- 10¹Copies/ μ L, can obtain reliable result in the viral level of this scope, i.e. the sensitivity of the method can detect The sample of the viral level of minimum 10copies.Testing result is shown in Fig. 5 and Fig. 6.

4. special Journal of Sex Research

In order to detect the specificity of test kit of the present invention, using the present invention test kit detect bovine viral diarrhea virus, Pig circular ring virus, PRV (Pseudorabies virus), transmissible gastro-enteritis viruss, Porcine epidemic diarrhea virus, pig breeding is comprehensive with breathing Levy variant and classical strain, the cell culture of Shimen, HCLV infection and normal cell controls etc..

Testing result shows：The test kit of the present invention only expands to wild strains of classical swine fever virus and vaccine strain, not with it There is cross reaction in its nucleic acid, see Fig. 7 and Fig. 8.

5. study on accuracy

Using the test kit and conventional RT-PCR of the present invention, 36 cord blood samples are detected simultaneously and 5 parts strong The cord blood sample of health is detected, the results are shown in Table 2.

Table 2 carries out the comparison of testing result using test kit of the present invention and conventional RT-PCR to clinical sample

As can be seen from Table 2：This test kit dual real-time fluorescent RT method detection positive and common RT- PCR method detects that the result 100% of positive meets；For the detection of clinical sample, this test kit dual real-time fluorescence RT- PCR method detection positive 5/36, logical RT-PCR method detection positive 3/36, and 3 parts of samples of the latter's detection use the former to detect It is the positive, test kit dual real-time fluorescent RT detection of the present invention is more more sensitive than conventional RT-PCR detection, and clinical symptoms Performance is consistent.

6. repetitive research

From positive control pEASY-5UTR2 cloned plasmids 10⁶、10⁵、10⁴Copies/ μ L, does to the sample of each concentration 3 repetitions, the detection coefficient of variation (CV) of result difference nucleic acid concentration is respectively less than 1%, has preferable repeatability.Testing result It is shown in Table 3 and Fig. 9.

Table 3 fluorescence quantitative PCR detection wild strains of classical swine fever virus and the replica test of vaccine strain

As fully visible, the reagent of a pair of specific primer of present invention design and two specificity fluorescent probes and composition Box can differentiate the wild strains of classical swine fever virus in pig Cord blood and vaccine strain with quick detection, and this detection method simple, quick, Specificity is good, sensitivity is high, favorable repeatability, and testing result is true and reliable.Those of ordinary skill in the art should be understood： The discussion of any of the above embodiment is exemplary only it is not intended that hint the scope of the present disclosure (inclusion claim) is limited to These examples；Under the thinking of the present invention, can also carry out between the technical characteristic in above example or different embodiment Combine, and there are many other changes of the different aspect of the present invention as above, in order to concisely they do not have in details There is provided.Therefore, all any omissions within the spirit and principles in the present invention, made, modification, equivalent, improvement etc., all should It is included within protection scope of the present invention.

.

Sequence table

<110>Hunan newly south cultivation Services Co., Ltd

<120>The dual real-time fluorescent RT reagent of wild strains of classical swine fever virus and vaccine strain in a kind of detection and identification pig Cord blood Box and application thereof

<130> FI160636-ND

<160> 6

<170>PatentIn version 3.5

<210> 1

<211> 18

<212> DNA

<213>Artificial sequence

<400> 1

gccatgccca tagtagga 18

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

ctactgacga ctgycctgta 20

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<400> 3

tggctagtcc ctccgttttg c 21

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence

<400> 4

acggctagtc cctccgtttg 20

<210> 5

<211> 96

<212> DNA

<213>Shimen 5 '-UTR gene order

<400> 5

gccatgccca tagtaggact agcaaacgga gggactagcc gtagtggcga gctccctggg 60

tggtctaagt cctgagtaca ggacagtcgt cagtag 96

<210> 6

<211> 97

<212> DNA

<213>HCLV 5 '-UTR gene order

<400> 6

gccatgccca tagtaggact agcaaaacgg agggactagc catagtggcg agctccctgg 60

gtggtctaag tcctgagtac aggacagtcg tcagtag 97

Claims

1. in a kind of detection and identification pig Cord blood wild strains of classical swine fever virus and vaccine strain dual real-time fluorescent RT test kit, It is characterized in that, this test kit includes amplimer and specificity fluorescent probe, described amplimer and specificity fluorescent probe Sequence as follows：

Downstream amplification primer CSFV-R：5 '-CTACTGACGACTGYCCTGTA-3 ', it is SEQ ID NO:2 sequences, wherein Y= C/T；

Specificity fluorescent probe CSFV-LV：VIC-5 '-TGGCTAGTCCCTCCGTTTTGC-3 '-BHQ1, it is SEQ ID NO: 3 sequences, wherein VIC are fluorescent reporter group, and BHQ1 is non-fluorescence quenching group；

Specificity fluorescent probe CSFV-Wt：FAM-5 '-ACGGCTAGTCCCTCCGTTTG-3 '-BHQ1, it is SEQ ID NO:4 Sequence, wherein FAM are fluorescent reporter group, and BHQ1 is non-fluorescence quenching group.

2. in detection and identification pig Cord blood according to claim 1 wild strains of classical swine fever virus and vaccine strain dual glimmering in real time Light RT-PCR kit is it is characterised in that described upstream amplification primer CSFV-F, described downstream amplification primer CSFV-R, described The mol ratio of specificity fluorescent probe CSFV-LV and described specificity fluorescent probe CSFV-Wt is 2:2:1:1.

3. in detection and identification pig Cord blood according to claim 2 wild strains of classical swine fever virus and vaccine strain dual glimmering in real time Light RT-PCR kit is it is characterised in that described upstream amplification primer CSFV-F, described downstream amplification primer CSFV-R, described The specificity fluorescent probe CSFV-LV and described specificity fluorescent probe CSFV-Wt final concentration in described test kit is 0.2 ～0.8 μM.

4. in detection and identification pig Cord blood according to claim 1 wild strains of classical swine fever virus and vaccine strain dual glimmering in real time Light RT-PCR kit is it is characterised in that described test kit also includes negative control, positive control, the reaction of 2 × fluorescence RT-PCR Liquid；UNG enzyme system is contained in described 2 × fluorescence RT-PCR reactant liquor.

5. in detection and identification pig Cord blood according to claim 4 wild strains of classical swine fever virus and vaccine strain dual glimmering in real time Light RT-PCR kit is it is characterised in that described negative control is the ddH of no DNA enzymatic₂O；Described positive control has pig for clone Pestivirus street strain (Shimen) genome 5 '-UTR fragment and rabbitization attenuated vaccine strain (HCLV) genome 5 '-UTR fragment Final concentration of the 1.0 × 10 of cloned plasmids pEASY-5UTR2, cloned plasmids pEASY-5UTR2⁵Copies/ μ l～1.0 × 10⁷copies/μl.

6. in detection and identification pig Cord blood according to claim 5 wild strains of classical swine fever virus and vaccine strain dual glimmering in real time Light RT-PCR kit is it is characterised in that described wild strains of classical swine fever virus (Shimen) genome 5 '-UTR fragment and described rabbit The nucleotide sequence changing attenuated vaccine strain (HCLV) genome 5 '-UTR fragment is respectively as SEQ ID NO:5 and SEQ ID NO:6 Shown.

7. in detection and identification pig Cord blood according to claim 6 wild strains of classical swine fever virus and vaccine strain dual glimmering in real time Light RT-PCR kit is it is characterised in that described cloned plasmids pEASY-5UTR2 is prepared using following methods：Using SEQ ID NO:1 and SEQ ID NO:Primer shown in 2 expands wild strains of classical swine fever virus (Shimen) genome 5 '-UTR fragment respectively With rabbitization attenuated vaccine strain (HCLV) genome 5 '-UTR fragment, cloned wild strains of classical swine fever virus (Shimen) gene by TA Group 5 '-UTR fragments and rabbitization attenuated vaccine strain (HCLV) genome 5 '-UTR fragment are cloned into pEASY-T1 carrier, and screening is positive Clone, the correct cloned plasmids that are sequenced are named as pEASY-5UTR2.

8. wild strains of classical swine fever virus and vaccine strain in the detection and identification pig Cord blood as described in a kind of any one as claim 1-7 The using method of dual real-time fluorescent RT test kit is it is characterised in that comprise the following steps：

(1) when usage right requires the dual real-time fluorescent RT test kit described in any one of 1-7 to be expanded, reaction system It is calculated as with 20 μ L：

10μM SEQ ID NO:Upstream amplification primer shown in 1：0.4～0.8 μ L；

10μM SEQ ID NO:Downstream amplification primer shown in 2：0.4～0.8 μ L；

2 × fluorescence RT-PCR reactant liquor：10μL；

RNA template：2μL；

ddH₂O：Complement to 20 μ L；

(2) Fluorescence PCR condition is：50 DEG C of reverse transcription 20min；95 DEG C of denaturations 1min；95 DEG C of degeneration 10Sec, 60 DEG C are moved back Fiery 45Sec simultaneously collects fluorescence, totally 40 circulations；Last 25 DEG C of cooling 10sec, terminate reaction；

(3) interpretation of result：

Quality control：Negative control FAM Air conduct measurement no Ct value, VIC Air conduct measurement no Ct value；Positive control FAM Air conduct measurement Ct value≤30, VIC Air conduct measurement Ct value≤30；Above-mentioned condition meets simultaneously, and testing result is effective；

Result judgement：FAM Air conduct measurement Ct value≤40, VIC Air conduct measurement no Ct value, then judge sample as wild strains of classical swine fever virus Infection is positive；FAM Air conduct measurement no Ct value, VIC Air conduct measurement≤40, then judge that sample is positive as swine fever virus vaccine；FAM Air conduct measurement Ct value≤40, VIC Air conduct measurement≤40, then judge that sample contains wild strains of classical swine fever virus and vaccine strain simultaneously；FAM Air conduct measurement no Ct value, VIC Air conduct measurement no Ct value, then judge that sample is negative as swine fever virus infection.

9. in detection and identification pig Cord blood according to claim 8 wild strains of classical swine fever virus and vaccine strain dual glimmering in real time The using method of light RT-PCR kit is it is characterised in that described RNA template is prepared using following methods：

The composition of described lysate and proportioning are as follows：1. guanidine hydrochloride 4-6M；2. dodecyl sodium sulfate SDS0.1-0.2%；3. tell Warm 20 1-2%；4. Nonidet P40 NP40 1-2%；

(3) EP pipe is put into magnetic frame absorption 1-2min, discard liquid；

(5) EP pipe is put into magnetic frame absorption 1-2min, discard liquid；

(6) ethanol solution that 1mL mass percent is 70%, gently washing precipitation are added；EP pipe is put into magnetic frame absorption 1- 2min, discards liquid；

(8) quick electrophoresis detection RNA integrity.

10. the test kit described in any one of claim 1-7 in preparing detection and identification pig Cord blood wild strains of classical swine fever virus with Purposes in the dual real-time fluorescent RT reagent of vaccine strain.