CN108950087A - The primer pair and probe and corresponding reagent box identified for pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR - Google Patents
The primer pair and probe and corresponding reagent box identified for pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR Download PDFInfo
- Publication number
- CN108950087A CN108950087A CN201811001910.6A CN201811001910A CN108950087A CN 108950087 A CN108950087 A CN 108950087A CN 201811001910 A CN201811001910 A CN 201811001910A CN 108950087 A CN108950087 A CN 108950087A
- Authority
- CN
- China
- Prior art keywords
- strain
- probe
- street
- pcr
- pig
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides one group of primer pair and probe for the strain of pig prevalence diarrhea virus vaccines and street strain QRT-PCR identification, primer pair are as follows: upstream primer: GGTGGCAGATGTGGCTAACT, downstream primer: AATAAAGGACAAAGTTGCGGC;Street strain probe P1:5 '-FAM-AGGATGATGGTCTTAATGTAGCTCCTGAA-BHQ1-3 ', vaccine strain probe P2:5 '-ROX-TGAGGCTGATGATGTAGAGTCTGAAGT-BHQ2-3 '.The present invention also provides kits and discrimination method.The present invention compares the street strain of PEDV and vaccine strain gene order, and the one-step method real-time fluorescent for establishing pig prevalence diarrhea street strain and vaccine strain quantifies QRT-PCR detection and identification method, and this method high specificity, high sensitivity, easy to operate, the time is short.
Description
Technical field
The present invention relates to the primer pair identified for pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR and probe and
Corresponding reagent box.
Background technique
Pig prevalence diarrhea is that one kind caused by pig prevalence diarrhea virus (PEDV) is acute, contagious disease, is clinically led
The symptoms such as severe diarrhea, vomiting and dehydration, and the equal easy infection of pig of each age in days are shown as, wherein with nursery-age pig sense
It is high to contaminate disease incidence, even up to 100%, huge economic loss is caused to world's pig breeding industry.
In the 1970s, Britain reports the disease for the first time, then also reported in succession in the multiple countries in the whole world such as Germany, Japan
The road generation of the disease.China's report since the 1980s has the generation of PEDV, then in multiple area outbursts, in ground
Side's property and seasonal epidemic.Furthermore PEDV and transmissible gastro-enteritis virus (TGEV), pig circular ring virus (PCV), rotavirus
(RV), caused after pig ridge viral (PKV), swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV) infection
Clinical symptoms it is similar, and the PEDV that can not effectively differentiate infection is street strain or vaccine strain, to the epidemic disease of disease
It learns and brings huge difficulty with prevention and control.
Summary of the invention
In order to solve the problems in the existing technology, PEDV and transmissible gastro-enteritis virus can effectively be distinguished
(TGEV), pig circular ring virus (PCV), rotavirus (RV), pig ridge viral (PKV), swine fever virus (CSFV), pig breeding and breathing
The viruses such as syndrome virus (PRRSV), and the PEDV that can effectively differentiate infection is street strain or vaccine strain,
38 plants of PEDV street strains that the present invention is announced by GenBank and 4 strain vaccine strains (CV777, DR13, JS2008,
KC189944 whole genome sequence comparison), finds there are 24 base deletions in the area the rdrp gene ORF1 vaccine strain of PEDV
(see Fig. 1), the applicant are based on this 24 base deletion design primers and probe, it is established that PEDV street strain and vaccine strain
One-step method real-time fluorescent quantifies the differential diagnostic method of QRT-PCR, and is used preliminarily for detection clinical sample.The probe and primer have
There is good specificity, PEDV street strain and vaccine strain can be quickly detected.
The present invention provides one group of primer pair and spy for the strain of pig prevalence diarrhea virus vaccines and street strain QRT-PCR identification
Needle, the primer pair are as follows:
Upstream primer: GGTGGCAGATGTGGCTAACT
Downstream primer: AATAAAGGACAAAGTTGCGGC
Street strain probe P1:5 '-FAM-AGGATGATGGTCTTAATGTAGCTCCTGAA-BHQ1-3 '
Vaccine strain probe P2:5 '-ROX-TGAGGCTGATGATGTAGAGTCTGAAGT-BHQ2-3 '.
The present invention is provided to the kit that pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR identify, the examinations
Agent box includes primer pair described in claim 1 and probe.
Preferably, further including 2 × One Step RT-PCR Buffer III, TaKaRa Ex Taq in the kit
HS, PrimeScript RT Enzyme Mix II and template ribonucleic acid.
The present invention provides the strain of pig prevalence diarrhea virus vaccines and street strain QRT-PCR discrimination method, comprising the following steps:
(1) pig prevalence diarrhea virus RNA is extracted from measuring samples;
(2) using primer pair described in claim 1, respectively using street strain's probe P1 and vaccine strain probe P2 to step
Suddenly the RNA that (1) is extracted carries out real-time fluorescence quantitative PCR amplification;
(3) if using amplification curve and CT value is obtained when street strain probe P1 within 24, measuring samples are pig stream
Row diarrhea virus street strain;If using amplification curve and CT value is obtained when vaccine strain probe P2 within 33, measuring samples
For pig prevalence diarrhea virus vaccines strain;If without amplification curve or using the CT value for obtaining amplification curve when street strain's probe P1
Greater than 24, then measuring samples are pig prevalence diarrhea virus negative sample.
Preferably, when real-time fluorescence quantitative PCR described in step (2) expands, 25 μ l QRT-PCR reaction systems are as follows: 2
×One Step RT-PCR BufferⅢ 12.5μl;TaKaRa Ex Taq HS 0.5μl;PrimeScript RT
Enzyme MixⅡ 0.5μl;0.5 μ l of upstream primer;0.5 μ l of downstream primer;1 μ l of probe;H2O 5.5μl;4 μ l of template ribonucleic acid.
Preferably, real-time fluorescence quantitative PCR amplified reaction program described in step (2): 42 DEG C of 5min, 95 DEG C of 10s
95 DEG C of 5s, 60 DEG C of 30s 40 circulations.
The present invention compares the street strain of PEDV and vaccine strain gene order, and the one-step method for establishing pig prevalence diarrhea virus is real
When fluorescent quantitation QRT-PCR detection method, this method has the characteristics that high specificity, high sensitivity, easy to operate, the time is short,
Reliable antidiastole means are provided for the aetology and epidemiology of pig prevalence diarrhea.
Detailed description of the invention
Attached drawing is used to provide further understanding of the present invention, and constitutes part of specification, with reality of the invention
It applies example to be used to explain the present invention together, not be construed as limiting the invention.In the accompanying drawings:
Fig. 1 is PEDV street strain and 4 strain vaccine strain base ratios pair.
Fig. 2 is detection PEDV street strain probe specificity.
Fig. 3 is detection PEDV vaccine strain probe specificity.
Fig. 4 is PEDV street strain and vaccine strain mixed probe P1/P2 amplification.
Fig. 5 is street strain's probe P1 and primers F 1/R1 testing result.
Fig. 6 is vaccine strain probe P2 and primers F 1/R1 testing result.
Fig. 7 is street strain's standard plasmid ORF1 with 10 times of successively diluted testing results.
Fig. 8 is the standard curve of street strain's standard plasmid ORF1.
Fig. 9 is vaccine strain standard plasmid ORF2 with 10 times of successively diluted testing results.
Figure 10 is the standard curve of vaccine strain standard plasmid ORF2.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified city
It sells.
Embodiment 1
1 materials and methods
1.1PEDV vaccine strain (CV777) and street strain (JX, DX, YS) (preservation of this laboratory).
1.2 primers and probe
According to the street strain of PEDV and vaccine strain base sequence contrast design primer and probe, it is specifically shown in Table 1.
1 primer and probe of table
The extraction of 1.3 viral RNAs
This experimental method is tried referring to TaKaRa MiNiBEST Viral RNA/DNA Extraction Kit Ver.5.0
Agent specification extracts the RNA of PEDV from intestinal contents.
The preparation and extraction of 1.4 standard plasmids
By PEDV replicase ORF1 area design primer Fs2/Ra2With Forf/Rorf, PEDV is expanded through One step RT-PCR respectively
Street strain and vaccine strain amplify the PCR product of 793bp Yu 414bp size, are connected respectively to pMD18-T Vector, are transferred to
Competent cell is simultaneously cultivated.Extracted plasmid is simultaneously identified, PEDV street strain standard plasmid ORF1 and PEDV vaccine is built into
Strain standard plasmid ORF2.
Wherein, One step RT-PCR reaction system are as follows: 2 × One Step RT-PCR Buffer, III 12.5 μ l;TaKaRa
Ex Taq HS(5U/μl)0.5μl;PrimeScript RT Enzyme MixⅡ 0.5μl;Upstream primer (25 μm of ol/L)
0.5μl;Downstream primer (25 μm of ol/L) 0.5 μ l;H2O 6.5μl;4 μ l (takara) of template ribonucleic acid.
Response procedures are as follows: 50 DEG C of 45min, 94 DEG C of 2min;94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 34 circulations;
72℃ 10min。
RT-PCR the primer are as follows:
Street strain: Fs2: ACACTATACTATCCCACCG
Ra2: CACCCAAAGATCCCAAGA
Vaccine strain: Forf: CACCGATCCTAATCTGCCCG
Rorf: TGGACCAACTCTACCAGCAC
Plasmid extracting method is operated according to AxyPrep Plasmid Miniprep Kit specification.
1.5 plasmid QPCR and one-step method real-time fluorescent quantify QRT-PCR reaction system and program
(1) standard plasmid QPCR
Standard plasmid QPCR reaction system: 2 × Super TaqMan Mixture, 12.5 μ l (takara);Upstream primer
(10μmol/L)0.5μl;Downstream primer (10 μm of ol/L) 0.5 μ l;Probe (10 μm of ol/L) 1 μ l; H2O 8.5μl;Template plasmid
2 μ l of DNA (health is century).
Standard plasmid QPCR response procedures: 95 DEG C of 3min, 95 DEG C of 5s, 60 DEG C of 30s, 40 circulations.
Wherein, upstream primer is the F1 in table 1, and downstream primer is the R1 in table 1, and probe is the P1 and P2 in table 1.
(2) one-step method real-time fluorescent quantifies QRT-PCR
QRT-PCR reaction system: 2 × One Step RT-PCR Buffer, III 12.5 μ l (takara);TaKaRa Ex
Taq HS(5U/μl)0.5μl;PrimeScript RT Enzyme MixⅡ 0.5μl;Upstream primer (10 μm of ol/L) 0.5 μ
l;Downstream primer (10 μm of ol/L) 0.5 μ l;Probe (10 μm of ol/L) 1 μ l;H2O 5.5μl;4 μ l (takara) of template ribonucleic acid.
QRT-PCR response procedures: 42 DEG C of 5min, 95 DEG C of 10s, 95 DEG C of 5s, 60 DEG C of 30s 40 circulations.
Wherein, upstream primer is the F1 in table 1, and downstream primer is the R1 in table 1, and probe is the P1 and P2 in table 1. 1.6
The specificity of detection probe and primer
Detect the probe and primer of street strain and vaccine strain respectively with PEDV street strain and vaccine strain, it is wild containing PEDV simultaneously
Strain and vaccine strain detection street strain and vaccine strain probe and primer.
1.7 specificity experiments-difference enterovirus detection probe and primer specificity
Take pig enterovirus (pig prevalence diarrhea virus street strain and vaccine strain, transmissible gastro-enteritis virus, pig colyliform disease
Poison, pig ridge virus, pig circular ring virus, swine fever virus, pig blue-ear disease are malicious) RNA is extracted with same method, reaction system is added,
And the specificity that QRT-PCR verifies primer and probe is quantified by the one-step method real-time fluorescent in 1.5 steps (2).1.8 sensitive
Property experiment
Make the standard plasmid ORF1 (2.25 × 10 of PEDV10Cospie/ μ L) and ORF2 (2.25 × 1010cospie/ μ
L), respectively as the standard items of street strain and vaccine strain QPCR, copy number is calculated, and with 10 times of gradient dilution standard plasmid,
The sensibility of primer and probe is verified by QPCR.
1.9 preliminary sample detection verifyings
The chitling content or fecal specimens of the suspected infection PEDVD of 50 parts of different regions are taken, RNA is extracted.By RT-
PCR amplification and product are sequenced and quantify QRT-PCR detection technique using PEDV one-step method real-time fluorescent of the invention and detected,
The coincidence rate of both verifyings method testing result.
2 results
The specificity of 2.1 detection probes and primer
The probe P1 and primers F 1/R1 of street strain can only detect PEDV street strain, and cannot detect PEDV vaccine strain
(such as Fig. 2).The probe P2 and primers F 1/R1 of vaccine strain can only detect PEDV vaccine strain, and cannot detect PEDV street strain
(such as Fig. 3), viral RNA and primers F 1/R1 and probe P1/P2 simultaneously containing PEDV street strain and vaccine strain then can be simultaneously
Detect street strain and vaccine strain (such as Fig. 4).The segment that amplification is obtained recycles sequencing, compares confirmation through GenBank database
For PEDV sequence.
Fig. 2 is detection PEDV street strain probe specificity;Wherein, 1:PEDV street strain probe P1 and primer and street strain
RNA;2: street strain probe P1 and primer and ddH20;3:PEDV street strain probe P1 and primer and vaccine strain RNA;4: vaccine strain
Probe P2 and primer and ddH20。
Fig. 3 is detection PEDV vaccine strain probe specificity;Wherein, 1:PEDV vaccine strain probe P2 and primer and vaccine strain
RNA;2: vaccine strain probe P2 with primer and ddH20;3:PEDV vaccine strain probe P2 and primer and street strain RNA;4: street strain
Probe P1 and primer and ddH20。
Fig. 4 is PEDV street strain and vaccine strain mixed probe P1/P2 amplification;Wherein, 1:PEDV vaccine strain and open country poison
Strain mixes street strain probe P1 and primers F 1/R1 amplification curve in RNA and mixed probe;2:PEDV vaccine strain and street strain's mixing
Vaccine strain probe P2 and primers F 1/R1 amplification curve in RNA and mixed probe;3:ddH20 and street strain probe P1 and primer;4:
ddH20 and vaccine strain probe P2 and primer.
2.2 specificity experiments
The experimental results showed that the vaccine strain of only PED virus has phase with street strain using one-step method QRT-PCR of the invention
The fluorescence curve answered, other viruses do not have, show that the primer and probe have good specific (such as Fig. 5, Fig. 6).
Fig. 5 is street strain's probe P1 and primers F 1/R1 testing result;Wherein, 1:PEDV street strain;2: pig transmissible stomach and intestine
Scorching virus;3: porcine rotavirus;4: pig ridge virus;5: pig circular ring virus;6: swine fever virus;7: pig blue-ear disease poison;8:ddH2O。
Fig. 6 is vaccine strain probe P2 and primers F 1/R1 testing result;Wherein, 1:PEDV vaccine strain;2: pig transmissible stomach and intestine
Scorching virus;3: porcine rotavirus;4: pig ridge virus;5: pig circular ring virus;6: swine fever virus;7: pig blue-ear disease poison;8:ddH2O。
2.3 sensitivity experiments
The results showed that by standard plasmid ORF1 (2.25x1010Copies/ μ L) and ORF2 (2.25x1010copies/
μ L) 10 are diluted respectively8Times (about 2.25 × 102Copies/ul it after), remains to detect fluorescence signal (such as Fig. 7, Fig. 9), according to expansion
Increase result and construct corresponding standard curve (Fig. 8, Figure 10) respectively, shows the PEDV of minimum detectable 225copies/ μ l
RNA, and street strain can detect 2250copies/ μ l.
Fig. 7 is street strain's standard plasmid ORF1 with 10 times of successively diluted testing results;Wherein, each gradient is done repeats three times.
Fig. 8 is the standard curve of street strain's standard plasmid ORF1.
Fig. 9 is vaccine strain standard plasmid ORF2 with 10 times of successively diluted testing results;Wherein, each gradient is done repeats three times.
Figure 10 is the standard curve of vaccine strain standard plasmid ORF2.
2.4 clinical sample testing results
Doubtful 50 parts of infection PEDV sample is chosen, shows that positive sample there are 31 parts by RT-PCR amplification and sequencing result,
Using one-step method QRT-PCR detection method of the invention, as a result, it has been found that having 38 parts of positive samples (includes that RT-PCR expands in 38 parts
Increase 31 parts detected), wherein 38 parts of street strain, are specifically shown in Table 2 by 0 part of vaccine strain.
Table 2
It is fixed by one-step method real-time fluorescent of the present invention known to specific test, sensitivity tests and last testing result
The pig PEDV that amount QRT-PCR can be detected quickly has good specificity and sensibility, is convenient for clinical use.
Embodiment 2
The foundation of Porcine epidemic diarrhea virus one-step method real-time fluorescent quantification kit:
(1) upstream primer is the F1 in table 1, and downstream primer is the R1 in table 1, and probe is the P1 and P2 in table 1.
(2) sample RNA.
(3) reaction system: 2 × One Step RT-PCR Buffer, III 12.5 μ l;TaKaRa Ex Taq HS(5U/ μ
l)0.5μl;PrimeScript RT Enzyme MixⅡ 0.5μl;Upstream primer (concentration is 10 μm of ol/L) 0.5 μ l;Downstream
Primer (concentration is 10 μm of ol/L) 0.5 μ l;Probe (concentration is 10 μm of ol/L) 1 μ l;H2O 5.5 μl;4 μ l of template ribonucleic acid
(takara)。
Response procedures: 95 DEG C of 5s of 42 DEG C of 5min, 95 DEG C of 10s, 60 DEG C of 30s 40 circulations.
(4) result judgement:
The minimum detectable PEDV street strain of the one-step method real-time fluorescent quantitative RT-PCR of foundation is 2250copies/ul, with
Negative control is compared, and sample CT value is positive for PEDV street strain within 24, and sample CT value is greater than 24 or equal without ascending curve
For PEDV feminine gender;And minimum detectable vaccine strain is 225copies/ul, compared with negative control, sample CT value is within 33
PEDV vaccine strain is positive.
Finally, it should be noted that the foregoing is only a preferred embodiment of the present invention, it is not intended to restrict the invention,
Although the present invention is described in detail referring to the foregoing embodiments, for those skilled in the art, still may be used
To modify the technical solutions described in the foregoing embodiments or equivalent replacement of some of the technical features.
All within the spirits and principles of the present invention, any modification, equivalent replacement, improvement and so on should be included in of the invention
Within protection scope.
Claims (6)
1. one group of primer pair and probe, feature for the strain of pig prevalence diarrhea virus vaccines and street strain QRT-PCR identification exists
In: the primer pair are as follows:
Upstream primer: GGTGGCAGATGTGGCTAACT
Downstream primer: AATAAAGGACAAAGTTGCGGC
Street strain probe P1:5 '-FAM-AGGATGATGGTCTTAATGTAGCTCCTGAA-BHQ1-3 '
Vaccine strain probe P2:5 '-ROX-TGAGGCTGATGATGTAGAGTCTGAAGT-BHQ2-3 '.
2. for the real time fluorescent quantitative kit that the strain of pig prevalence diarrhea virus vaccines and street strain QRT-PCR identify, feature
Be: the kit includes primer pair described in claim 1 and probe.
3. kit according to claim 2, it is characterised in that: further include 2 × One Step RT- in the kit
PCR Buffer III, TaKaRa Ex Taq HS, PrimeScript RT Enzyme Mix II and template ribonucleic acid.
4. pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR discrimination method, it is characterised in that: the following steps are included:
(1) pig prevalence diarrhea virus RNA is extracted from measuring samples;
(2) using primer pair described in claim 1, respectively using street strain's probe P1 and vaccine strain probe P2 to step
(1) RNA extracted carries out real-time fluorescence quantitative PCR amplification;
(3) if using amplification curve and CT value is obtained when street strain probe P1 within 24, measuring samples are pig prevalence abdomen
Diarrhea virus street strain;If measuring samples are pig using amplification curve and CT value is obtained when vaccine strain probe P2 within 33
Popular diarrhea virus vaccines strain;If being greater than without amplification curve or using the CT value for obtaining amplification curve when street strain probe P1
24, then measuring samples are pig prevalence diarrhea virus negative sample.
5. according to the method described in claim 4, it is characterized by: real-time fluorescence quantitative PCR described in step (2) expand when,
25 μ l QRT-PCR reaction systems are as follows: 2 × One Step RT-PCR Buffer, III 12.5 μ l;TaKaRa Ex Taq HS 0.5
μl;PrimeScript RT Enzyme MixⅡ0.5μl;0.5 μ l of upstream primer;0.5 μ l of downstream primer;1 μ l of probe;H2O
5.5μl;4 μ l of template ribonucleic acid.
6. according to the method described in claim 4, it is characterized by: real-time fluorescence quantitative PCR amplified reaction described in step (2)
Program: 95 DEG C of 5s of 42 DEG C of 5min, 95 DEG C of 10s, 60 DEG C of 30s 40 circulations.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811001910.6A CN108950087A (en) | 2018-08-30 | 2018-08-30 | The primer pair and probe and corresponding reagent box identified for pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811001910.6A CN108950087A (en) | 2018-08-30 | 2018-08-30 | The primer pair and probe and corresponding reagent box identified for pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108950087A true CN108950087A (en) | 2018-12-07 |
Family
ID=64473526
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811001910.6A Pending CN108950087A (en) | 2018-08-30 | 2018-08-30 | The primer pair and probe and corresponding reagent box identified for pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108950087A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111411171A (en) * | 2020-01-07 | 2020-07-14 | 吉林正业生物制品股份有限公司 | Fluorescent quantitative PCR primer, probe and kit for identifying porcine epidemic diarrhea virus vaccine strain and epidemic strain and application |
CN116904667A (en) * | 2023-09-06 | 2023-10-20 | 广东省农业科学院动物卫生研究所 | Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010061000A1 (en) * | 2008-11-28 | 2010-06-03 | Ceva Sante Animale | Novel porcine circovirus type 2b isolate and uses thereof |
CN106435033A (en) * | 2016-11-22 | 2017-02-22 | 湖南新南方养殖服务有限公司 | Dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting and identifying wild strain and vaccine strain of CSFV (classical swine fever virus) in swine umbilical cord blood and application of dual real-time fluorescence RT-PCR kit |
CN106947832A (en) * | 2017-03-30 | 2017-07-14 | 河南省农业科学院 | The primer and probe of Porcine epidemic diarrhea virus quantitative fluorescent PCR |
CN107937603A (en) * | 2017-09-27 | 2018-04-20 | 中国农业科学院兰州兽医研究所 | Porcine epidemic diarrhea virus vaccine virus and street strain's diagnostic primers and preparation method thereof |
-
2018
- 2018-08-30 CN CN201811001910.6A patent/CN108950087A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010061000A1 (en) * | 2008-11-28 | 2010-06-03 | Ceva Sante Animale | Novel porcine circovirus type 2b isolate and uses thereof |
CN106435033A (en) * | 2016-11-22 | 2017-02-22 | 湖南新南方养殖服务有限公司 | Dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting and identifying wild strain and vaccine strain of CSFV (classical swine fever virus) in swine umbilical cord blood and application of dual real-time fluorescence RT-PCR kit |
CN106947832A (en) * | 2017-03-30 | 2017-07-14 | 河南省农业科学院 | The primer and probe of Porcine epidemic diarrhea virus quantitative fluorescent PCR |
CN107937603A (en) * | 2017-09-27 | 2018-04-20 | 中国农业科学院兰州兽医研究所 | Porcine epidemic diarrhea virus vaccine virus and street strain's diagnostic primers and preparation method thereof |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111411171A (en) * | 2020-01-07 | 2020-07-14 | 吉林正业生物制品股份有限公司 | Fluorescent quantitative PCR primer, probe and kit for identifying porcine epidemic diarrhea virus vaccine strain and epidemic strain and application |
CN116904667A (en) * | 2023-09-06 | 2023-10-20 | 广东省农业科学院动物卫生研究所 | Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus |
CN116904667B (en) * | 2023-09-06 | 2023-12-19 | 广东省农业科学院动物卫生研究所 | Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104745731B (en) | Triple fluorescent RT PCR detection reagents of African swine fever virus, CSFV and porcine reproductive and respiratory syndrome virus and preparation method thereof and purposes | |
CN103509882B (en) | The fluorescence quantification PCR primer of Porcine epidemic diarrhea virus and probe | |
CN104263853B (en) | The kit of the main virus of fluorescence quantitative PCR detection pig | |
CN110358867A (en) | African hog cholera virus fluorescent type RAA detection kit | |
CN108866243B (en) | Porcine enterocoronavirus 4-fold fluorescent quantitative PCR detection kit | |
CN108384890A (en) | Differentiate the double FQ-PCR detection kits of porcine circovirus 2 type and 3 types | |
WO2018059195A1 (en) | Hrm detection primer, kit, and method for quickly identifying classical strain and variant strain of porcine epidemic diarrhea virus | |
CN107557494A (en) | Differentiate the primer of detection diarrhea of pigs coronavirus and multiple RT PCR methods | |
CN107475459A (en) | Differentiate the detection method of american type PRRSV classical strainses, variation strain and new virus class NADC30 strains simultaneously | |
CN107686864A (en) | Porcine epidemic diarrhea virus TaqMan fluorescent quantitation RT PCR kits and its detection method | |
CN103725794B (en) | Detect fluorescent quantitation RT PCR primers, probe and its method for PRRSV | |
CN109097499A (en) | It is a kind of for detecting the dual fluorescence quantification RT-PCR detection kit of PEDV-TGEV nucleic acid | |
CN107475456A (en) | PEDV quick determination methods and its kit based on isothermal reverse transcription recombinase polymeric enzymatic amplification method | |
CN106435033A (en) | Dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting and identifying wild strain and vaccine strain of CSFV (classical swine fever virus) in swine umbilical cord blood and application of dual real-time fluorescence RT-PCR kit | |
CN107236824A (en) | A kind of fluorescent quantitation RT PCR kits and application for porcine reproductive and respiratory syndrome virus specific detection | |
CN109913591A (en) | A type Sai Nika virus fluorescent quantitative RT-PCR detection method and kit based on TaqMan probe method | |
CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
CN108950087A (en) | The primer pair and probe and corresponding reagent box identified for pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR | |
CN104498623B (en) | Primers for differential diagnosis of porcine epidemic diarrhea virus virulent strain and attenuated strain and detection kit thereof | |
CN105907890A (en) | Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain | |
CN106520763A (en) | Composition, application thereof and kit with same | |
CN104673936A (en) | RT-qPCR detection method and primers and TaqMan probe for detecting swine transmissible gastroenteritis virus N gene | |
CN107699635A (en) | Porcine epidemic diarrhea virus fluorescence RPA detection methods | |
CN104745729A (en) | Double fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for African swine fever viruses and porcine reproductive and respiratory syndrome viruses and preparation method and application thereof | |
CN105506186A (en) | Primers for detecting porcine epidemic diarrhea viruses and fluorescent quantitative RT-PCR detecting method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |