CN107557494A

CN107557494A - Differentiate the primer of detection diarrhea of pigs coronavirus and multiple RT PCR methods

Info

Publication number: CN107557494A
Application number: CN201710877114.8A
Authority: CN
Inventors: 方六荣; 肖少波; 孙郑; 刘寒; 刘康; 王荡
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2017-09-26
Filing date: 2017-09-26
Publication date: 2018-01-09

Abstract

The invention belongs to animal virology and epizootiology technical field.It is related to Porcine epidemic diarrhea virus classical strainses and variation strain, pig δ coronavirus and transmissible gastro-enteritis virus more particularly to the primer and multiple RT PCR methods, described diarrhea of pigs coronavirus for differentiating detection diarrhea of pigs coronavirus.The invention discloses detect Porcine epidemic diarrhea virus classical strainses and variation strain and multiple the RT PCR primers and detection method of pig δ coronavirus and transmissible gastro-enteritis virus simultaneously, realize that once experiment detects and distinguished Porcine epidemic diarrhea virus classical strainses and variation strain, pig δ coronavirus and transmissible gastro-enteritis virus that current serious endangers pig industry simultaneously, new, fast and effectively detection method is provided for this several viral discriminating and the clinically diagnosis of disease, and detection time can be shortened, reduce testing cost.

Description

Differentiate the primer and multiplex RT-PCR method of detection diarrhea of pigs coronavirus

Technical field

The invention belongs to animal virology and epizootiology technical field.It is coronal more particularly to discriminating detection diarrhea of pigs Virus primer and multiplex RT-PCR method, described diarrhea of pigs coronavirus be related to Porcine epidemic diarrhea virus classical strainses with Variation strain, pig δ coronavirus and transmissible gastro-enteritis virus and its multiple RT-PCR primer and detection method.

Background technology

Porcine epidemic diarrhea virus (PEDV), pig δ coronavirus (PDCoV) and transmissible gastro-enteritis virus (TGEV) are equal Belong to the more viraleses of Buddhist nun, coronaviridae, be 3 kinds of main viruses for causing diarrhea of pigs.Caused clinic after 3 kinds of viral infected pigs Symptom and pathological change are very much like, and mixed infection phenomenon is universal, is clinically difficult to differentiate between.Although this 3 kinds of diseases are detected The multiplex RT-PCR method report of poison, but occurred the Porcine epidemic diarrhea virus variation poison that virulence is remarkably reinforced since 2010 The prevalence of strain, and clinically Porcine epidemic diarrhea virus classical strainses exist simultaneously with variation strain, and there is presently no can be same When distinguish the inspection of Porcine epidemic diarrhea virus classical strainses and variation strain and pig δ coronavirus and transmissible gastro-enteritis virus Survey method.

The content of the invention

The defects of purpose of the present invention exists aiming at above-mentioned prior art, there is provided one kind can distinguish pig popularity simultaneously The multiple RT-PCR primer of diarrhea virus classical strainses and variation strain and pig δ coronavirus and transmissible gastro-enteritis virus and Detection method.

Technical solution of the present invention is as described below：

Suitable for differentiating detection diarrhea of pigs coronavirus such as Porcine epidemic diarrhea virus classical strainses and variation strain, pig δ The DNA sequence dna of coronavirus and transmissible gastro-enteritis virus multiple RT-PCR detection primer is as follows：

(1) primer sequence of Porcine epidemic diarrhea virus classical strainses：

Sense primer F1：5 '-TTGCAAGTGGCGCTGTGATT-3 ',

Anti-sense primer R1-1：5’-GCCGACAACAATATCTTTTCCA-3’；

Amplification obtains 748bp Porcine epidemic diarrhea virus classical strainses S genetic fragments；

(2) primer sequence of Porcine epidemic diarrhea virus variation strain：

Sense primer F1：5 '-TTGCAAGTGGCGCTGTGATT-3 ',

Anti-sense primer R1-2：5’-GACACCCTGGTTTTCACCAA-3’；

Amplification obtains 445bp Porcine epidemic diarrhea virus variation strain S genetic fragments；

(3) pig δ coronavirus primer sequence：

Sense primer F2：5 '-TACTGGCTGCGTTACACC-3 ',

Anti-sense primer R2：5’-CCGCCTGAAAGTTGCTCT-3’；

Amplification obtains 622bp pig δ coronavirus N genetic fragments；

(4) primer sequence of transmissible gastro-enteritis virus：

Sense primer F3：5 '-CTTGGTAGTCGTGGTGCT-3 ',

Anti-sense primer R3：5’-TATCTGGTCGCCATCTTC-3’；

Amplification obtains 528bp transmissible gastro-enteritis virus N genetic fragments；

Applicant provide one kind and utilize above-mentioned primer detection Porcine epidemic diarrhea virus classical strainses and variation strain, pig δ coronavirus, the multiplex RT-PCR method of transmissible gastro-enteritis virus, described multiplex RT-PCR method are carried out in two steps, After extracting viral RNA, the reverse transcription reagent box specification reverse transcription of Dalian treasured biotech firm (TaKaRa) is first according into cDNA, Virus is detected by PCR reactions again.Reverse transcription and multi-PRC reaction system and reaction condition are as follows：

Reverse transcription reaction system, following composition is added in 10 μ L systems：

The reaction condition of reverse transcription is：42 DEG C of 30min, 99 DEG C of 5min, 5 DEG C of 5min.After the completion of reverse transcription, cDNA is directly used - 20 DEG C of preservations are expanded or are placed in PCR.

Multi-PRC reaction system, following composition is added in 25 μ L systems：

Reaction condition is：95 DEG C, 5min, 95 DEG C, 30s, 54 DEG C, 30s, 72 DEG C, 1min；35 circulations, 72 DEG C of extensions 10min。

The detection Porcine epidemic diarrhea virus classical strainses of the present invention and variation strain and pig δ coronavirus and pig transmissible The application that the multiple RT-PCR primer of marcy agent can be used in the detection kit and detection and identification method of non-diagnostic purpose.

The described application in kit, it is using described primer as core detection reagent, coordinates other conventional examinations Agent can be used for above-mentioned Porcine epidemic diarrhea virus classical strainses and variation strain and pig δ coronavirus and pig (according to a conventional method) The kit of infectious gastroenteritis virus, the assembling of described kit are assembled and prepared with reference to conventional method.

Beneficial effects of the present invention：

The invention provides detect simultaneously Porcine epidemic diarrhea virus classical strainses and variation strain and pig δ coronavirus and The multiple RT-PCR primer and detection method of transmissible gastro-enteritis virus, it can be worked as by once testing while detecting and distinguish The preceding Porcine epidemic diarrhea virus classical strainses for seriously endangering pig industry and variation strain, pig δ coronavirus and pig transmissible stomach Enteritis virus.The present invention provides new, quickly for the discriminating of these three Main Pig diarrhea viruses and the diagnosis of clinically disease Effective detection method, and detection time can be shortened, reduce testing cost.

Brief description of the drawings

Sequence table SEQ ID NO:1 and SEQ ID NO:2 be amplification Porcine epidemic diarrhea virus (PEDV) classical strainses The primer sequence of CV777 strain S genes.

Sequence table SEQ ID NO:1 and SEQ ID NO:3 be amplification Porcine epidemic diarrhea virus (PEDV) variation strain The primer sequence of AJ1102 strain S genes.

Sequence table SEQ ID NO:4 and SEQ ID NO:5 be amplification pig δ coronavirus (PDCoV) CHN-HN-2014 strains N The primer sequence of gene.

Sequence table SEQ ID NO:6 and SEQ ID NO:7 be amplification transmissible gastro-enteritis virus (TGEV) WH-1 strain N bases The primer sequence of cause.

Sequence table SEQ ID NO:8 be Porcine epidemic diarrhea virus (PEDV) the i.e. PEDV CV777 strains S gene sequences of amplification Row.

Sequence table SEQ ID NO:9 be Porcine epidemic diarrhea virus (PEDV) the i.e. PEDV AJ1102 strains S gene sequences of amplification Row.

Sequence table SEQ ID NO:10 be pig δ coronavirus (PDCoV) the i.e. PDCoV CHN-HN-2014 strains N bases of amplification Because of sequence.

Sequence table SEQ ID NO:11 be transmissible gastro-enteritis virus (TGEV) the i.e. TGEV WH-1 strains N genes of amplification Sequence.Fig. 1：Multiple RT-PCR electrophoretogram.Description of reference numerals：M is DL2000DNA marker；1st, 2 be multiple RT-PCR；3、 4 be PEDV classical strainses RT-PCR；5th, 6 be PEDV variation strains RT-PCR；7th, 8 be PDCoV RT-PCR；9th, 10 be TGEV RT-PCR；1st, 3,5,7,9 template is PEDV CV777 strains, PEDV AJ1102 strains, PDCoV CHN-HN-2014 strains, TGEV The mixing RNA of the strain virus of WH-1 strains 4；2nd, 4,6,8,10 template is ddH₂O

Fig. 2：Multiple RT-PCR specific test result.Description of reference numerals：M is DL2000DNA marker；1 template For PEDV CV777 strains, PEDV AJ1102 strains, PDCoV CHN-HN-2014 strains, the strain virus of TGEV WH-1 strains 4 mixing RNA； 2 template is PEDV CV777 strains RNA；3 template is PEDV AJ1102 strains RNA；4 template is PDCoV CHN-HN-2014 Strain RNA；5 template is TGEV WH-1 strains RNA；6 template is PRRSV WUH-3 strains RNA；7 template is PoRV TM-a strains RNA；8 template is CSFV C strains RNA；9 template is PCV2WH strains DNA.

Fig. 3：PEDV-CV777 RT-PCR sensitivity tests results.Description of reference numerals：M is DL2000DNA marker；1-8 template is viral dilution multiple successively for 5 ×, 50 ×, 100 ×, 500 ×, 1000 ×, 2000 ×, 5000 ×, 10000 × hybrid virus liquid extraction RNA；9 be negative control

Fig. 4：PEDV-AJ1102 RT-PCR sensitivity tests results.Description of reference numerals：M is DL2000DNA marker；1-8 template is viral dilution multiple successively for 5 ×, 50 ×, 100 ×, 500 ×, 1000 ×, 2000 ×, 5000 ×, 10000 × hybrid virus liquid extraction RNA；9 be negative control

Fig. 5：PDCoV RT-PCR sensitivity tests results.Description of reference numerals：M is DL2000DNA marker；1-8 Template be viral dilution multiple successively for 5 ×, 50 ×, 100 ×, 500 ×, 1000 ×, 2000 ×, 5000 ×, 10000 × The RNA of hybrid virus liquid extraction；9 be negative control

Fig. 6：TGEV RT-PCR sensitivity tests results.Description of reference numerals：M is DL2000DNA marker；1-8's Template is viral dilution multiple successively for 5 ×, 50 ×, 100 ×, 500 ×, 1000 ×, 2000 ×, 5000 ×, 10000 × it is mixed The RNA of combination of syndromes venom extraction；9 be negative control.

Fig. 7：Multiple RT-PCR sensitivity tests result.Description of reference numerals：M is DL2000DNA marker；1-7 mould Plate is viral dilution multiple successively for 5 ×, 50 ×, 100 ×, 500 ×, 1000 ×, 2000 ×, 5000 × hybrid virus liquid carry The RNA taken；8 be negative control.

Embodiment

(1) Porcine epidemic diarrhea virus (PEDV) classical strainses CV777 strain full genomes that the present invention logs according to GenBank (accession number is for group sequence (accession number AF353511.1), (2) PEDV variation strains AJ1102 strains whole genome sequence JX188454.1), (accession number is (3) pig δ coronavirus (PDCoV) CHN-HN-2014 strains whole genome sequence KT336560.1), (accession number is (4) transmissible gastro-enteritis virus (TGEV) WH-1 strains whole genome sequence HQ462571.1), PEDV CV777 strain S genes, PEDV AJ1102 strain S genes, PDCoV CHN- are obtained by sequence analysis The highly conserved specific sequence of HN-2014 strain N genes, TGEV WH-1 strain N genes, and it is directed to 7 spies of above-mentioned sequences Design Specific primer, established using the specific primer of design and distinguish the more of PEDV classical strainses and variation strain, PDCoV and TGEV Weight RT-PCR detection method, and its specificity and sensitiveness are analyzed.

Suitable for Porcine epidemic diarrhea virus classical strainses and variation strain, pig δ coronavirus, transmissible gastroenteritis of swine disease The DNA sequence dna of malicious multiple RT-PCR detection primer：

Wherein：

(1) primer sequence of Porcine epidemic diarrhea virus classical strainses is as follows：

Sense primer F1：5 '-TTGCAAGTGGCGCTGTGATT-3 ' (corresponding SEQ ID NO:1)

Anti-sense primer R1-1：5 '-GCCGACAACAATATCTTTTCCA-3 ' (corresponding SEQ ID NO:2)

Expand Porcine epidemic diarrhea virus classical strainses S genetic fragments, length 748bp；

(2) primer sequence of Porcine epidemic diarrhea virus variation strain is as follows：

Sense primer F1：5 '-TTGCAAGTGGCGCTGTGATT-3 ', (corresponding SEQ ID NO:1)

Anti-sense primer R1-2：5’-GACACCCTGGTTTTCACCAA-3’；(corresponding SEQ ID NO:3)

Expand Porcine epidemic diarrhea virus variation strain S genetic fragments, length 445bp；

(3) pig δ coronavirus primer sequence is as follows：

Sense primer F2：5 '-TACTGGCTGCGTTACACC-3 ', (corresponding SEQ ID NO:4)

Anti-sense primer R2：5’-CCGCCTGAAAGTTGCTCT-3’；(corresponding SEQ ID NO:5)

Expand pig δ coronavirus N genetic fragments, length 622bp；

(4) primer sequence of transmissible gastro-enteritis virus is as follows：

Sense primer F3：5 '-CTTGGTAGTCGTGGTGCT-3 ', (corresponding SEQ ID NO:6)

Anti-sense primer R3：5’-TATCTGGTCGCCATCTTC-3’；(corresponding SEQ ID NO:7)

Expand transmissible gastro-enteritis virus N genetic fragments, length 528bp.

Applicant establishes a kind of Porcine epidemic diarrhea virus classical strainses using described in above-mentioned primer detection and variation Strain, pig δ coronavirus, the multiplex RT-PCR method of transmissible gastro-enteritis virus, are mainly comprised the following steps：

(method that the reverse transcription reagent box specification according to Dalian treasured biotech firm is reported operates) is logical after extracting viral RNA Reverse transcription is crossed into cDNA, above-mentioned three kinds of virus is detected by following multiple RT-PCR reaction system and reaction condition, system It is as follows：

Multiple RT-PCR reaction system (adds following composition) in 25 μ L systems：

Reaction cumulative volume is 25 μ L.

Reaction condition is：95 DEG C, 5min；95 DEG C, 30s；54 DEG C, 30s；72 DEG C, 1min；35 circulations；72 DEG C of extensions 10min。

Concrete operations are as follows：

1 test material

It is 1.1 viral

(whole genome sequence has been filed on GenBank, logs in for Porcine epidemic diarrhea virus (PEDV) classical strainses CV777 strains Number be AF353511.1), (whole genome sequence has been filed on GenBank to the AJ1102 strains of PEDV variation strains, and accession number is JX188454.1), (whole genome sequence has been filed on GenBank, accession number for pig δ coronavirus (PDCoV) CHN-HN-2014 strains For KT336560.1), (whole genome sequence has been filed on GenBank, and accession number is for transmissible gastro-enteritis virus WH-1 strains HQ462571.1), type PCV-II (PCV-2) WH strains (research Central China of Guo sea soldier's porcine circovirus 2 type inactivated vaccines of pig 2 Agriculture university Master's thesis .2009), (Li Bin Central Chinas are high to be caused for porcine reproductive and respiratory syndrome virus (PRRSV) WUH-3 strains The molecular evolution properties study Hua Zhong Agriculture University Ph.D. Dissertation .2009 of characteristic of disease porcine reproductive and respiratory syndrome virus), Porcine rotavirus (PoRV) TM-a strains (separation of the pig A rotavirus such as storehouse rising sun steel and identification journal of animal science and veterinary medicine, 2012, 43(2)：275-281), (whole genome sequence has been filed on GenBank, and accession number is for CSFV (CSFV) C strains AY805221.1), preserved and supplied by Hua Zhong Agriculture University's animal medicine institute Preventive Veterinary Medicine laboratory.Vero cells, ST are thin Born of the same parents and LLC-PK1 cells are purchased from Chinese Wuhan Wuhan Universitys, China typical culture collection center.

1.2 main agents or kit

RNA PCR Kit (AMV) kit, DNA Marker and reverse transcription reagent box are limited purchased from precious bioengineering Dalian Company.Ago-Gel QIAquick Gel Extraction Kit is purchased from biochemical (Beijing) Science and Technology Ltd. of Tiangeng, Trizol total RNA extraction reagent boxes Purchased from OMEGA companies.

The design and synthesis of 1.3 primers

Using the genetic analysis softwares of primer primer 5.0, with reference to the full base of PEDV CV777 strains logged in GenBank Because of a group sequence (accession number AF353511.1), PEDV AJ1102 strain whole genome sequences (accession number JX188454.1), PDCoV CHN-HN-2014 strain whole genome sequences (accession number KT336560.1), TGEV WH-1 strain whole genome sequences (accession number HQ462571.1), designing 7 primers, (wherein amplification PEDV classical strainses S genes and variation strain's S genes is upper It is identical to swim primer), amplification respectively obtains PEDV classical strainses S genetic fragments (748bp), variation strain's S genetic fragments (445bp), PDCoV N genetic fragments (622bp) and TGEV N genetic fragments (528bp).Above-mentioned primer holds up section's biology by Wuhan Co., Ltd synthesizes.10 μm of ol/L are diluted to DEPC water, are preserved at -20 DEG C.

The multiple RT-PCR primer information of table 1

2 test methods

2.1 viral TCID₅₀Measure

2.1.1PEDV CV777 strains TCID₅₀Measure

(contain the DMEM nutrient solutions of 10% cow's serum, wherein DMEM nutrient solutions are public purchased from GIBCO with DMEM cell growth mediums Take charge of) PEDV CV777 strain virus liquid is made into continuous 10 times of dilutions, take the viral suspension of acceptable diluent degree to be inoculated with 96 hole cell culture Plate, each dilution factor is inoculated with a tandem totally 8 hole, and per the μ L of hole 100, then it is 3 × 10 to add 100 μ L cell densities in every hole⁵~5 × 10⁵(cell concentration per hole is 3 × 10 to individual/mL Vero cell suspensions⁴~5 × 10⁴It is individual)；8 hole normal cell controls are set simultaneously, Normal cell controls hole first adds 100 μ L DMEM cell growth mediums per hole, adds 100 μ L cell densities as 3 × 10⁵~5 × 10⁵Individual/mL cell suspension.37 DEG C are put, 5%CO₂Under the conditions of culture observation 4 days, normal cell controls hole should occur without cytopathy Become.By Reed-Muench methods (Yin Zhen, Liu Jinghua chief editor animal virology (second edition) Beijing：Science Press .1997) meter Calculate TCID₅₀。

2.1.2PEDV AJ1102 strains TCID₅₀Measure

With the serum-free DMEM nutrient solutions (being purchased from GIBCO companies) containing 7.5 μ g/mL pancreatin by PEDV AJ1102 strain virus Liquid makees continuous 10 times of dilutions, takes the viral suspension of acceptable diluent degree to be inoculated with and washes the Vero of 2 times with serum-free DMEM nutrient solutions in advance Cell monolayer, each dilution factor is inoculated with a tandem totally 8 holes (96 porocyte culture plates), per the μ L of hole 100；It is normally thin to set 8 holes simultaneously Born of the same parents are compareed, and the cell monolayer of cell control well is equally washed 2 times with serum-free DMEM nutrient solutions, and are added 100 μ L and contained 7.5 μ g/mL The serum-free DMEM nutrient solutions of pancreatin.37 DEG C are put, 5%CO₂Under the conditions of culture observation 4 days.Normal cell controls hole should occur without Cytopathy.By Reed-Muench methods (Yin Zhen, Liu Jinghua chief editor animal virology (second edition) Beijing：Science Press .1997 TCID) is calculated₅₀。

2.1.3PDCoV CHN-HN-2014 strains TCID₅₀Measure

With the serum-free MEM nutrient solutions (being purchased from GIBCO companies) containing 7.5 μ g/mL pancreatin by PDCoV CHN-HN-2014 strains Virus liquid makees continuous 10 times of dilutions, takes the viral suspension of acceptable diluent degree to be inoculated with and is washed 2 times with serum-free MEM nutrient solutions in advance LLC-PK1 cell monolayers, each dilution factor is inoculated with a tandem totally 8 holes (96 porocyte culture plates), per the μ L of hole 100；Set 8 holes simultaneously Normal cell controls, the cell monolayer of cell control well are equally washed 2 times with serum-free MEM nutrient solutions, and are added 100 μ L and contained 7.5 μ The serum-free MEM nutrient solutions of g/mL pancreatin.37 DEG C are put, 5%CO₂Under the conditions of culture observation 4 days.Normal cell controls hole should not go out Existing cytopathy.By Reed-Muench methods (Yin Zhen, Liu Jinghua chief editor animal virology (second edition) Beijing：Scientific publication Society .1997) calculate TCID₅₀。

2.1.4TGEV WH-1 strains TCID₅₀Measure

(contain the DMEM nutrient solutions of 10% cow's serum, wherein DMEM nutrient solutions are public purchased from GIBCO with DMEM cell growth mediums Take charge of) TGEV WH-1 strain virus liquid is made into continuous 10 times of dilutions, take the viral suspension of acceptable diluent degree to be inoculated with 96 hole cell culture Plate, each dilution factor is inoculated with a tandem totally 8 hole, and per the μ L of hole 100, then it is 3 × 10 to add 100 μ L cell densities in every hole⁵~5 × 10⁵(cell concentration per hole is 3 × 10 to individual/mL ST cell suspensions⁴~5 × 10⁴It is individual)；8 hole normal cell controls are set simultaneously, just Normal cell control well first adds 100 μ L DMEM cell growth mediums per hole, adds 100 μ L cell densities as 3 × 10⁵~5 × 10⁵ Individual/mL cell suspension.37 DEG C are put, 5%CO₂Under the conditions of culture observation 4 days, normal cell controls hole should occur without cytopathy Become.By Reed-Muench methods (Yin Zhen, Liu Jinghua chief editor animal virology (second edition) Beijing：Science Press .1997) meter Calculate TCID₅₀。

The extraction and reverse transcription of 2.2 4 plants of diarrhea of pigs viral RNAs

4 strain virus are adjusted to the virus liquid of same concentrations according to 2.1 measurement result with serum-free DMEM nutrient solutions, then By its isometric mixing, utilize the Trizol total RNA extraction reagents box of OMEGA companies to extract the RNA of hybrid virus liquid, recycle The reverse transcription reagent box reverse transcription of precious bioengineering Dalian Co., Ltd obtains cDNA (being operated according to the specification of the kit).

2.3 substance RT-PCR react

The substance RT-PCR reactions of 4 strain virus are carried out in 25 μ L systems, including the μ L of 2 × Master Mix 12.5, The μ L of cDNA templates 2, the upstream and downstream primer volume of appropriate upstream and downstream primer, wherein PEDV classical strainses substance RT-PCR reaction For 0.65 μ L (concentration is 10 μm of ol/L), PEDV variation strains, the upstream and downstream primer of PDCoV and TGEV substances RT-PCR reactions Volume be 0.5 μ L (concentration is 10 μm of ol/L), use ddH₂O complements to 25 μ L.

PCR reaction conditions：95 DEG C, 5min；94 DEG C, 30s；54 DEG C, 30s；72 DEG C, 45s；Totally 35 circulations, 72 DEG C of extensions 10min.The PCR primer of gained is subjected to electrophoresis detection with 2% Ago-Gel of routine.

2.4 multiple RT-PCRs react

By the annealing temperature to multiple RT-PCR, primer concentration, 2 × Taq Master Mix concentration and reaction volume Optimization, present invention determine that the cumulative volume of the reaction of the multiple RT-PCR of the present embodiment is 25 μ L, including 2 × Master Mix12.5 μ L, the volume for being related to the upstream and downstream primer of PEDV classics strains are respectively 0.65 μ L (concentration is 10 μm of ol/L)；PEDV becomes The volume of the upstream and downstream primer of different strain, PDCoV and TGEV is 0.5 μ L (concentration is 10 μm of ol/L).

Reaction condition：95 DEG C, 5min；95 DEG C, 30s；54 DEG C, 30s；72 DEG C, 1min；Totally 35 circulations.72 DEG C of extensions 10min.5 μ L RT-PCR amplified productions are taken to carry out electrophoresis detection in 2% Ago-Gel of routine.

2.5 specific test

Use the multiplex RT-PCR method of foundation respectively with PEDV CV777 strains, PEDV AJ1102 strains, TGEV WH-1 strains, The cDNA, PEDV CV777 strains, PEDV AJ1102 strains, TGEV WH-1 strains, PDCoV of PDCoV CHN-HN-2014 strains mixing CHN-HN-2014 strains, PRRSV WUH-3 strains, PoRV TM-a strains, the DNA of cDNA and PCV-2WH strains of CSFV C strains are template Expanded, electrophoresis, the specificity of checking institute method for building up are carried out with 2% Ago-Gel after the completion of amplification.

2.6 sensitivity tests

According to the TCID of measure₅₀As a result 4 strain virus as described above is adjusted to identical TCID₅₀Equivalent is carried out afterwards Mixing, add the DMEM (equivalent to every kind of viral dilution 5 times) of 1/4 volume, remake 10 after well mixed ×, 20 ×, 100 ×, 200 ×, 400 ×, 1000 ×, 2000 × dilution, the viral mixed liquors of 8 kinds of different dilution factors is obtained, in this 8 kinds of mixed liquors The final extension rate of every kind of virus is 5 ×, 50 ×, 100 ×, 500 ×, 1000 ×, 2000 ×, 5000 × and 10000 ×, profit The Trizol total RNA extraction reagents box produced with OMEGA companies (is operated) each dilution factor of extraction by the kit specification and mixed The RNA of virus liquid, the reverse transcription reagent box for recycling precious bioengineering Dalian Co., Ltd to produce, cDNA is obtained by reverse transcription (being operated by the kit specification).Substance is carried out according to the substance RT-PCR of above-mentioned determination and the reaction condition of multiple RT-PCR And multiplex RT-PCR amplification, carry out electrophoresis detection with 2% Ago-Gel of routine after the completion of amplification.

3 result of the tests

3.1 4 plants of diarrhea of pigs virus TCID₅₀Measure and dilution

The hole count of lesion is recorded after cytopathy is stable, TCID is calculated by Reed-Muench methods₅₀, as a result PEDV CV777 strains TCID₅₀For 10^5.5/ 100 μ L, PEDV AJ1102 strains TCID₅₀For 10^5.0/ 100 μ L, PDCoV CHN-HN-2014 strains TCID₅₀For 10^6.5/ 100 μ L, TGEV WH-1 strains TCID₅₀For 10^6.0/100μL.Will with DMEM nutrient solutions according to the result of measure The virus liquid of PEDV CV777 strains, PDCoV CHN-HN-2014 strains and TGEV WH-1 strains is diluted to 10^5.0TCID₅₀/100μL。

3.2 multiple RT-PCRs react

Mixed with PEDV CV777 strains, PEDV AJ1102 strains, PDCoV CHN-HN-2014 strains and TGEV WH-1 strain virus liquid The RNA extracted after conjunction is template, carries out multiple and substance RT-PCR amplifications (reaction condition is with the present embodiment 2.3 and 2.4), knot Fruit multiplex RT-PCR amplification gone out the S genetic fragments of 445bp PEDV variation strains, 748bp PEDV classical strainses S genes The TGEV N genetic fragments of fragment, 622bp PDCoV N genetic fragments and 528bp.Substance RT-PCR also amplifies corresponding big Small specific fragment, and negative control does not occur any specific band (result is shown in Fig. 1).

3.3 specific test

The RNA mixed with PEDV CV777 strains, PEDV AJ1102 strains, TGEV WH-1 strains, PDCoV CHN-HN-2014 strains For template and PEDV CV777 strains, PEDV AJ1102 strains, TGEV WH-1 strains and the single RNA of PDCoV CHN-HN-2014 strains Respectively template, correspondingly sized band is obtained by multiple RT-PCR, and respectively with PRRSV, PoRV, CSFV and PCV2 RNA or DNA be template, do not occur specific band by multiplex RT-PCR amplification, illustrate the multiple RT- that establishes of the present invention PCR specificity is good (result is shown in Fig. 2).

3.4 substance RT-PCR sensitivity tests

Using the RNA of different dilution factor hybrid virus liquid as template, expanded with the substance RT-PCR method of foundation, as a result Minimum detection limit to PEDV classical strainses, PDCoV and TGEV is 50TCID₅₀/ 100 μ L (result is shown in Fig. 3, Fig. 5 and Fig. 6), 100TCID is limited to the lowest detection of PEDV variation strains₅₀/ 100 μ L (result is shown in Fig. 4).

3.5 multiple RT-PCR sensitivity tests

Multiplex RT-PCR amplification is carried out as template using the RNA of different dilution factor hybrid virus liquid extraction, as a result multiple RT- PCR is 100TCID to the minimum detection limit of PEDV classical strainses and variation strain and PDCoV and TGEV₅₀/ 100 μ L (be shown in by result Fig. 7).

Sequence table

<110>Hua Zhong Agriculture University

<120>Differentiate the primer and multiplex RT-PCR method of detection diarrhea of pigs coronavirus

<141> 2017-09-23

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213>Porcine epidemic diarrhea virus (PEDV)

<220>

<221> primer_bind

<222> (1)..(20)

<400> 1

ttgcaagtgg cgctgtgatt 20

<210> 2

<211> 22

<212> DNA

<213>Porcine epidemic diarrhea virus (PEDV)

<220>

<221> primer_bind

<222> (1)..(22)

<400> 2

gccgacaaca atatcttttc ca 22

<210> 3

<211> 20

<212> DNA

<213>Porcine epidemic diarrhea virus (PEDV)

<220>

<221> primer_bind

<222> (1)..(20)

<400> 3

gacaccctgg ttttcaccaa 20

<210> 4

<211> 18

<212> DNA

<213>Pig δ coronavirus (PDCoV)

<220>

<221> primer_bind

<222> (1)..(18)

<400> 4

tactggctgc gttacacc 18

<210> 5

<211> 18

<212> DNA

<213>Pig δ coronavirus (PDCoV)

<220>

<221> primer_bind

<222> (1)..(18)

<400> 5

ccgcctgaaa gttgctct 18

<210> 6

<211> 18

<212> DNA

<213>Transmissible gastro-enteritis virus (TGEV)

<220>

<221> primer_bind

<222> (1)..(18)

<400> 6

cttggtagtc gtggtgct 18

<210> 7

<211> 18

<212> DNA

<213>Transmissible gastro-enteritis virus (TGEV)

<220>

<221> primer_bind

<222> (1)..(18)

<400> 7

tatctggtcg ccatcttc 18

<210> 8

<211> 748

<212> DNA

<213>Porcine epidemic diarrhea virus (PEDV)

<220>

<221> gene

<222> (1)..(748)

<400> 8

ttgcaagtgg cgctgtgatt gacggcaaca ccatgcatgc caattatatc ttctggcgta 60

attccacaat tatgactatg tcttacaaca gtgtgcttga tttaagcaag ttcaattgta 120

agcataaggc tacagttgtt gttaatttaa aagactcatc cattagtgat gttgtgttag 180

gcttgttgaa gaatggtaag ttgctagtgc gtaataatga cgccatttgt ggcttttcta 240

atcatttggt caacgtaaac aaatgaggtc tttaatttac ttctggttgc tcttaccagt 300

acttccaaca ctcagcctac cacaagatgt cactaggtgc cagtctacta ctaactttag 360

gcggttcttt tcaaaattta atgttcaggc acctgccgtc gtcgttttgg gtggttacct 420

acctagtatg aactcttcta gctggtactg tggcacaggc attgaaactg ctagtggcgt 480

tcatggtatt tttctcagct acatcgattc tggtcagggc tttgagattg gcatttcgca 540

agagccgttt gatcctagtg gttaccagct ttatttacat aaggccacta atggtaacac 600

taatgctatt gcacgactgc gcatttgcca gtttcccgat aataaaacat tgggccctac 660

tgttaatgat gttacaacag gtcgtaactg cctattcaac aaagccattc cagcttatat 720

gcgtgatgga aaagatattg ttgtcggc 748

<210> 9

<211> 445

<212> DNA

<213>Porcine epidemic diarrhea virus (PEDV)

<220>

<221> gene

<222> (1)..(445)

<400> 9

ttgcaagtgg cgctgtgatt gacggcaaca ctatgcatgc caattatatc ttctggcgta 60

attccacaat tatgactatg tcttacaata gtgtacttga tttaagcaag ttcaattgta 120

agcataaggc tacagttgtt attaatttaa aagattcatc cattagtgat gttgtgttag 180

gtttgttgaa gaatggtaag ttgctagtgc gtaataatga cgccatttgt ggtttttcta 240

atcatttggt caacgtaaac aaatgaagtc tttaacctac ttctggttgt tcttaccagt 300

actttcaaca cttagcctac cacaagatgt caccaggtgc tcagctaaca ctaattttag 360

gcggttcttt tcaaaattta atgttcaggc gcctgcagtt gttgtactgg gcggttatct 420

acctattggt gaaaaccagg gtgtc 445

<210> 10

<211> 622

<212> DNA

<213>Pig δ coronavirus (PDCoV)

<220>

<221> gene

<222> (1)..(622)

<400> 10

tactggctgc gttacaccag acaaaagcca ggtggtactc cgattcctcc atcctatgcc 60

ttttattata ctggcacagg tcccagagga aatcttaagt atggtgaact ccctcctaat 120

gataccccag caaccactcg tgttacttgg gttaagggtt cgggagctga cacttctatt 180

aagcctcatg ttgccaaacg caaccccaac aatcctaaac atcagctgct acctctccga 240

ttcccaaccg gagatggccc agctcaaggt ttcagagttg accccttcaa cgctagagga 300

agacctcagg agcgtggaag tggcccaaga tctcaatctg ttaactccag aggcacaggc 360

aatcagccca ggaaacgcga ccaatctgca cccgctgcgg tacgtcgtaa gacccaacat 420

caagctccca agcggacttt acctaagggt aaaaccattt ctcaggtatt tggcaaccgg 480

tctcgtactg gtgccaatgt cggctctgca gacactgaga agacgggtat ggctgatcct 540

cgcatcatgg ctctagccag acatgtgcct ggtgttcagg aaatgctttt cgctggccac 600

cttgagagca actttcaggc gg 622

<210> 11

<211> 528

<212> DNA

<213>Transmissible gastro-enteritis virus (TGEV)

<400> 11

cttggtagtc gtggtgctaa taatgaatcc aaagctttga aattcgatgg taaagtgcca 60

ggcgaatttc aacttgaagt taatcaatca agagacaatt caaggtcacg ctctcaatct 120

agatctcggt ctagaaatag atctcaatct agaggcaggc aacaattcaa taacaagaag 180

gatgacagtg tagaacaagc tgttcttgcc gcacttaaaa agttaggtgt tgacacagaa 240

aaacaacagc aacgctctcg ttctaaatct aaagaacgta gtaactctaa gacaagagat 300

actacaccta agaatgaaaa caaacacacc tggaagagaa ctgcaggtaa aggtgatgtg 360

acaagatttt atggagctag aagcagttca gccaattttg gtgacactga cctcgttgcc 420

aatgggagca gtgccaagca ttacccacaa ctggctgaat gtgttccatc tgtgtctagc 480

attctgtttg gaagctattg gacttcaaag gaagatggcg accagata 528

Claims

1. distinguish Porcine epidemic diarrhea virus classical strainses and variation strain, pig δ coronavirus and pig transmissible stomach and intestine simultaneously The multiple RT-PCR primer of scorching virus, it is characterised in that the DNA sequence dna of the primer is as follows：

(1) primer sequence of Porcine epidemic diarrhea virus classical strainses：

Sense primer F1：TTGCAAGTGGCGCTGTGATT,

Anti-sense primer R1-1：GCCGACAACAATATCTTTTCCA；

Amplification obtains 748bp Porcine epidemic diarrhea virus classical strainses S genetic fragments, its nucleotide sequence sequence such as SEQ ID NO:Shown in 8；

(2) primer sequence of Porcine epidemic diarrhea virus variation strain：

Sense primer F1：TTGCAAGTGGCGCTGTGATT ',

Anti-sense primer R1-2：5’-GACACCCTGGTTTTCACCAA-3’；

Amplification obtains 445bp Porcine epidemic diarrhea virus variation strain S genetic fragments, its nucleotide sequence sequence such as SEQ ID NO:Shown in 9；

(3) pig δ coronavirus primer sequence is as follows：

Sense primer F2：TACTGGCTGCGTTACACC,

Anti-sense primer R2：CCGCCTGAAAGTTGCTCT；

Amplification obtains 622bp pig δ coronavirus N genetic fragments, its nucleotide sequence sequence such as SEQ ID NO:Shown in 10；

(4) primer sequence of transmissible gastro-enteritis virus is as follows：

Sense primer F3：CTTGGTAGTCGTGGTGCT,

Anti-sense primer R3：TATCTGGTCGCCATCTTC,

Amplification obtains its nucleotide sequence sequence of 528bp transmissible gastro-enteritis virus N genetic fragments such as SEQ ID NO:11 It is shown.

2. the primer described in claim 1 is in the Porcine epidemic diarrhea virus classical strainses for non-diagnostic purpose and variation poison The multiple RT-PCR system of strain, pig δ coronavirus and transmissible gastro-enteritis virus, it is characterised in that multiple RT-PCR point Reverse transcription and PCR, which react two steps, to be carried out, and described reaction system and reaction condition are as described below：

The reaction condition of reverse transcription is：42 DEG C of 30min, 99 DEG C of 5min, 5 DEG C of 5min.

Multi-PRC reaction is carried out by template of the cDNA that reverse transcription obtains, the cumulative volume of multi-PRC reaction system is 25 μ L：

Reaction condition：95 DEG C, 5min；95 DEG C, 30s；54 DEG C, 30s；72 DEG C, 1min；35 circulations；72 DEG C of extension 10min.

3. the primer combination described in claim 1 is preparing detection and identification Porcine epidemic diarrhea virus classical strainses and variation poison Application in strain, pig δ coronavirus and transmissible gastro-enteritis virus kit.