CN111424114A - 2019-nCoV novel coronavirus saliva detection biomarker and application thereof - Google Patents
2019-nCoV novel coronavirus saliva detection biomarker and application thereof Download PDFInfo
- Publication number
- CN111424114A CN111424114A CN202010169789.9A CN202010169789A CN111424114A CN 111424114 A CN111424114 A CN 111424114A CN 202010169789 A CN202010169789 A CN 202010169789A CN 111424114 A CN111424114 A CN 111424114A
- Authority
- CN
- China
- Prior art keywords
- coronavirus
- novel coronavirus
- saliva
- ncov
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a 2019-nCoV novel coronavirus saliva detection biomarker and application thereof, and provides application of a coronavirus S protein gene as the biomarker in preparation of a 2019-nCoV novel coronavirus saliva detection product or a 2019-nCoV coronavirus pneumonia auxiliary saliva diagnosis product. The invention discovers the effect of the 2019-nCoV novel coronavirus gene as a biomarker in preparation of a 2019-nCoV novel coronavirus saliva detection product for the first time, can quickly detect 2019nCoV novel coronavirus infection, is easy to obtain a sample, is high in detection efficiency and speed, reduces the infection risk of an operator, and has high sensitivity and specificity.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a 2019-nCoV novel coronavirus saliva detection biomarker and application thereof.
Background
Because the coronavirus has long incubation period and the individual manifestations of the infected persons are greatly different, a great challenge is brought to rapid/accurate diagnosis. In the "diagnosis and treatment of pneumonia infected by novel coronavirus" (trial sixth edition) published by Wei Jian Wei K ", we can see a sum detection method of multiple concurrent attempts, which is respectively:
1) history of epidemiology. Primarily to determine whether contact has been made with a suspect person or occasion.
2) A physiological condition of the individual. It mainly includes whether there is fever or respiratory symptoms.
3) And (4) carrying out biochemical detection on blood. It is mainly detected by blood withdrawal, such as total white blood cells or lymphocyte count.
4) The pneumonia is imaged. Mainly realized by a CT device.
5) And (3) detecting nucleic acid.
Clinical diagnosis strategies are of great significance, and PCR detection methods for pathogenic microorganism nucleic acid components are still the gold standard for determining new coronavirus infection at present. The national drug administration officials network shows that 7 novel coronavirus nucleic acid detection kit products and detection software of 6 companies are approved to be marketed at present, related companies on the market have Huada genes (300676.SZ) and Daan genes (002030.SZ), and except for one of the Huada genes which is a joint probe anchoring polymerization sequencing method, other methods are based on a real-time fluorescent PT-PCR technology. The companies such as Wanfu organism (300482.SZ), Jingjing life (300642.SZ), West Long science (002584.SZ) and the like continuously transmit official messages in the near day, and all develop related products for detecting the new coronavirus.
The nucleic acid detection requires several steps of sampling, sample retention, preservation, nucleic acid extraction, and machine detection, wherein each step may cause false negative. Especially, in the emergency that the lung lavage fluid can not be carried out in scale at present, the virus sample of the patient is almost collected by a nasopharyngeal swab. The sampling quality of nasopharyngeal swab varies with the operation of experimenters, and is difficult to be constantly standardized, which is one of the important reasons for detecting false negative. The positive rate of the existing new coronavirus nucleic acid detection is only about 30-40%. In addition, the operator is susceptible to infection during the nasopharyngeal swab sampling procedure.
There is therefore a need for a simpler, faster and more accurate sampling method that reduces the risk of false negatives being detected, while reducing the risk of infection to the sampling personnel.
Disclosure of Invention
In view of the drawbacks of the prior art described above, the present invention aims at a new type of coronavirus saliva test biomarker 2019-nCoV and its application.
Since the new coronavirus can be transmitted by droplet, it is likely that the patient's saliva contains viral particles and exosomes with viral nucleic acid messages released by cells after viral infection of cells.
The saliva nucleic acid purification reagent (patent) and the experimental process only need to obtain 100 microliters of saliva supernatant, extract the nucleic acid in the saliva supernatant, perform RT-PCR amplification on a nucleic acid sample by using a specific primer of a target gene, and can complete the detection of a nucleic acid expression (mRNA) marker related to pathological conditions and a specific gene of pathogenic bacteria contained in saliva exosomes within two hours.
In order to achieve the above objects and other related objects, a first aspect of the present invention provides a use of a coronavirus S protein gene as a biomarker in the preparation of a 2019-nCoV novel coronavirus saliva test product or a 2019-nCoV coronavirus pneumonia auxiliary saliva diagnosis product.
The second aspect of the invention provides application of a substance specifically recognizing a coronavirus S protein gene in preparing a 2019-nCoV novel coronavirus saliva detection product.
The third aspect of the invention provides a 2019-nCoV novel coronavirus saliva detection kit, wherein the kit at least comprises a substance specifically recognizing a coronavirus S protein gene.
As described above, the 2019-nCoV novel coronavirus saliva detection biomarker and the application thereof have the following beneficial effects:
the invention discovers the effect of the coronavirus S protein gene as a biomarker in the preparation of a 2019-nCoV novel coronavirus saliva detection product for the first time, can quickly detect 2019nCoV novel coronavirus infection, has high detection efficiency, is simple in saliva sample sampling and constant in quantity, and is favorable for the reliability and stability of a detection result. During the sample, only need the patient or be suspected that the patient spits saliva in the collecting tube who provides by oneself, cover the lid hand over with the laboratory technician can, the chance that the laboratory technician that has significantly reduced infected is fast, and is pollution-free, has very high sensitivity and specificity.
Drawings
FIG. 1: the virus contained in the saliva or coronavirus S protein gene in the saliva exosome is adopted to carry out RT-PCR amplification electrophoresis picture.
Detailed Description
The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.
Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention; in the description and claims of the present application, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.
When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.
Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.
Various starting materials and reagents were purchased from commercial suppliers without further purification unless otherwise indicated. The raw materials and the reagents which are easy to be affected with damp are stored in a fully sealed bottle and are directly used without special treatment.
The invention provides application of a coronavirus S protein gene as a biomarker in preparation of a 2019-nCoV novel coronavirus saliva detection product or a 2019-nCoV coronavirus pneumonia auxiliary saliva diagnosis product.
The target sequence of the S protein gene is shown as SEQ ID NO: shown at 7. Specifically, the method comprises the following steps:
s protein-templete 2230bp (SEQ ID NO: 7)
ttattgccactagtctctagtcagtgtgttaatcttacaaccagaactcaattaccccctgcatacactaattctttcacacgtggtgtttattacc ctgacaaagttttcagatcctcagttttacattcaactcaggacttgttcttacctttcttttccaatgttacttggttccatgctatacatgtctctgggac caatggtactaagaggtttgataaccctgtcctaccatttaatgatggtgtttattttgcttccactgagaagtctaacataataagaggctggatttttg gtactactttagattcgaagacccagtccctacttattgttaataacgctactaatgttgttattaaagtctgtgaatttcaattttgtaatgatccatttttg ggtgtttattaccacaaaaacaacaaaagttggatggaaagtgagttcagagtttattctagtgcgaataattgcacttttgaatatgtctctcagcctt ttcttatggaccttgaaggaaaacagggtaatttcaaaaatcttagggaatttgtgtttaagaatattgatggttattttaaaatatattctaagcacacg cctattaatttagtgcgtgatctccctcagggtttttcggctttagaaccattggtagatttgccaataggtattaacatcactaggtttcaaactttactt gctttacatagaagttatttgactcctggtgattcttcttcaggttggacagctggtgctgcagcttattatgtgggttatcttcaacctaggacttttcta ttaaaatataatgaaaatggaaccattacagatgctgtagactgtgcacttgaccctctctcagaaacaaagtgtacgttgaaatccttcactgtaga aaaaggaatctatcaaacttctaactttagagtccaaccaacagaatctattgttagatttcctaatattacaaacttgtgcccttttggtgaagtttttaa cgccaccagatttgcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctatataattccgcatcattttccactt ttaagtgttatggagtgtctcctactaaattaaatgatctctgctttactaatgtctatgcagattcatttgtaattagaggtgatgaagtcagacaaatc gctccagggcaaactggaaagattgctgattataattataaattaccagatgattttacaggctgcgttatagcttggaattctaacaatcttgattcta aggttggtggtaattataattacctgtatagattgtttaggaagtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtag cacaccttgtaatggtgttgaaggttttaattgttactttcctttacaatcatatggtttccaacccactaatggtgttggttaccaaccatacagagtagt agtactttcttttgaacttctacatgcaccagcaactgtttgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatg gtttaacaggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtccgtg atccacagacacttgagattcttgacattacaccatgttcttttggtggtgtcagtgttataacaccaggaacaaatacttctaaccaggttgctgttct ttatcaggatgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcctacttggcgtgtttattctacaggttctaatgtttttcaaac acgtgcaggctgtttaataggggctgaacatgtcaacaactcatatgagtgtgacatacccattggtgcaggtatatgcgctagttatcagactcag actaattctcctcggcgggcacgtagtgtagctagtcaatccatcattgcctacactatgtcacttggtgcagaaaattcagttgcttactctaataac tctattgccatacccacaaattttactattagtgttaccacagaaattctaccagtgtctatgaccaagacatcagtagattgtacaatgtacatttgtg gtgattcaactgaatgca。
The 2019-nCoV novel coronavirus saliva detection product comprises a substance for specifically recognizing coronavirus S protein genes.
The invention provides application of a substance for specifically recognizing coronavirus S protein gene in preparing a 2019-nCoV novel coronavirus saliva detection product.
The 2019-nCoV novel coronavirus saliva detection product takes saliva as a detection sample source.
Furthermore, the 2019-nCoV novel coronavirus saliva detection product can detect whether saliva exosomes contain coronavirus S protein genes.
The dosage of the saliva sample required by the 2019-nCoV novel coronavirus saliva detection product is 1-1.5 ml.
The 2019-nCoV novel coronavirus detection product is used for judging 2019nCoV novel coronavirus infection, selecting a treatment scheme, judging treatment effect and/or performing prognosis evaluation.
The prognostic evaluation of the 2019-nCoV novel coronavirus refers to the prognostic judgment of the course and/or the ending of a patient with the 2019-nCoV novel coronavirus.
The judgment of the medication curative effect refers to that whether a patient is cured or not is judged by using the product of the invention to detect after the patient is treated for a period of time.
Further, the 2019-nCoV novel coronavirus detection product is a product for detecting the expression quantity of coronavirus S protein in exosomes in a saliva sample, and whether a patient has the 2019-nCoV novel coronavirus or not, and which treatment scheme and/or the course and/or the outcome of the patient are/is selected to carry out prognosis judgment according to the detection result.
It should be noted that the 2019-nCoV novel coronavirus detection product is not limited to be necessarily in a liquid form.
The substance specifically recognizing the coronavirus S protein can be selected from primers for specifically amplifying the coronavirus S protein gene.
In one embodiment, the primers for specifically amplifying the coronavirus gene S protein comprise any one or more of the following primer combinations:
(1) as shown in SEQ ID NO: 1 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 2, or a reverse primer;
(2) as shown in SEQ ID NO: 3 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 4, a downstream primer;
(3) as shown in SEQ ID NO: 5 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 6.
In particular, the method comprises the following steps of,
s protein-F1 ggaccaatggtactaagagg 259bp (SEQ ID NO: 1),
s protein-R1 tctgaactcactttccatcc (SEQ ID NO: 2).
S protein-F2 gactcctggtgattcttcttc 233bp (SEQ ID NO: 3)
S protein-R2 caatagattctgttggttggactc (SEQ ID NO: 4)
S protein-F3 tccctgttgctattcatgcag 215bp (SEQ ID NO: 5)
S protein-R3 ggattgactagctacactacg (SEQ ID NO: 6)
The 2019-nCoV novel coronavirus saliva detection kit provided by the invention at least comprises a substance for specifically recognizing the 2019-nCoV novel coronavirus S protein.
The substance specifically recognizing the 2019-nCoV novel coronavirus S protein can be selected from primers for specifically amplifying coronavirus S protein genes.
The primer for specifically amplifying the coronavirus S protein gene comprises any one or more of the following primer combinations:
(1) as shown in SEQ ID NO: 1 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 2, or a reverse primer;
(2) such as SEQ ID NO: 3 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 4, a downstream primer;
(3) as shown in SEQ ID NO: 5 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 6.
In one embodiment, the 2019-nCoV novel coronavirus saliva detection kit further comprises a nucleic acid purification solution, wherein the nucleic acid purification solution at least comprises the following components, and the content of each component is as follows based on the total amount of the purification solution:
specifically, the content of the sodium dodecyl sulfate in the nucleic acid purification solution is 5g/100ml-50g/100 ml. For example, the sodium lauryl sulfate may be present in an amount of 5g/100 ml. The sodium lauryl sulfate may be present in an amount of 10g/100 ml. The sodium lauryl sulphate content may be 15g/100 ml. The sodium lauryl sulfate may be present in an amount of 20g/100 ml. The sodium dodecyl sulfate may be present in an amount of 25g/100 ml. The sodium lauryl sulfate may be present in an amount of 30g/100 ml. The sodium lauryl sulfate may be present in an amount of 35g/100 ml. The sodium lauryl sulfate may be present in an amount of 40g/100 ml. The sodium lauryl sulfate may be present in an amount of 45g/100 ml. The sodium lauryl sulfate may be present in an amount of 50g/100 ml.
The sodium lauryl sulfate may be present in an amount of from 5g/100ml to 45g/100 ml. The sodium lauryl sulfate may be present in an amount of 5g/100ml to 40g/100 ml. The sodium lauryl sulfate may be present in an amount of from 5g/100ml to 35g/100 ml. The sodium lauryl sulfate may be present in an amount of 5g/100ml to 30g/100 ml. The sodium lauryl sulfate may be present in an amount of from 5g/100ml to 25g/100 ml. The sodium lauryl sulfate may be present in an amount of from 5g/100ml to 20g/100 ml. The sodium lauryl sulfate may be present in an amount of from 5g/100ml to 15g/100 ml. The sodium lauryl sulfate may be present in an amount of from 5g/100ml to 10g/100 ml.
The sodium lauryl sulfate may be present in an amount of from 10g/100ml to 50g/100 ml. The sodium lauryl sulfate may be present in an amount of from 10g/100ml to 45g/100 ml. The sodium lauryl sulfate may be present in an amount of from 10g/100ml to 40g/100 ml. The sodium lauryl sulfate may be present in an amount of from 10g/100ml to 35g/100 ml. The sodium lauryl sulfate may be present in an amount of from 10g/100ml to 30g/100 ml. The sodium lauryl sulfate may be present in an amount of from 10g/100ml to 25g/100 ml. The sodium lauryl sulfate may be present in an amount of from 10g/100ml to 20g/100 ml. The sodium lauryl sulfate may be present in an amount of from 10g/100ml to 15g/100 ml.
The sodium lauryl sulfate may be present in an amount of 15g/100ml to 50g/100 ml. The sodium lauryl sulfate may be present in an amount of 15g/100ml to 45g/100 ml. The sodium lauryl sulfate may be present in an amount of 15g/100ml to 40g/100 ml. The sodium lauryl sulfate may be present in an amount of 15g/100ml to 35g/100 ml. The sodium lauryl sulfate may be present in an amount of 15g/100ml to 30g/100 ml. The sodium lauryl sulfate may be present in an amount of 15g/100ml to 25g/100 ml. The sodium lauryl sulfate may be present in an amount of 15g/100ml to 20g/100 ml.
The sodium lauryl sulfate may be present in an amount of 20g/100ml to 50g/100 ml. The sodium lauryl sulfate may be present in an amount of 20g/100ml to 45g/100 ml. The sodium lauryl sulfate may be present in an amount of 20g/100ml to 40g/100 ml. The sodium lauryl sulfate may be present in an amount of 20g/100ml to 35g/100 ml. The sodium lauryl sulfate may be present in an amount of 20g/100ml to 30g/100 ml. The sodium lauryl sulfate may be present in an amount of 20g/100ml to 25g/100 ml.
The sodium lauryl sulfate may be present in an amount of 25g/100ml to 50g/100 ml. The sodium lauryl sulfate may be present in an amount of 25g/100ml to 45g/100 ml. The sodium lauryl sulfate may be present in an amount of 25g/100ml to 40g/100 ml. The sodium lauryl sulfate may be present in an amount of 25g/100ml to 35g/100 ml. The sodium lauryl sulfate may be present in an amount of 25g/100ml to 30g/100 ml.
The sodium lauryl sulfate may be present in an amount of 30g/100ml to 50g/100 ml. The sodium lauryl sulfate may be present in an amount of 30g/100ml to 45g/100 ml. The sodium lauryl sulfate may be present in an amount of 30g/100ml to 40g/100 ml. The sodium lauryl sulfate may be present in an amount of 30g/100ml to 35g/100 ml.
The sodium lauryl sulfate may be present in an amount of 35g/100ml to 50g/100 ml. The sodium lauryl sulfate may be present in an amount of 35g/100ml to 45g/100 ml. The sodium lauryl sulfate may be present in an amount of 35g/100ml to 40g/100 ml.
The sodium lauryl sulfate may be present in an amount of 40g/100ml to 50g/100 ml. The sodium lauryl sulfate may be present in an amount of 40g/100ml to 45g/100 ml.
The sodium lauryl sulfate may be present in an amount of 45g/100ml to 50g/100 ml.
In one embodiment, the nucleic acid purification solution contains at least the following components in amounts, based on the total amount of the nucleic acid purification solution:
in one embodiment, the nucleic acid purification solution contains at least the following components in amounts, based on the total amount of the nucleic acid purification solution:
in one embodiment, the nucleic acid purification solution contains at least the following components in amounts, based on the total amount of the nucleic acid purification solution:
in one embodiment, the nucleic acid purification solution contains at least the following components in amounts, based on the total amount of the nucleic acid purification solution:
in one embodiment, the nucleic acid purification solution contains at least the following components in amounts, based on the total amount of the nucleic acid purification solution:
in one embodiment, the final concentration of disodium edetate in the nucleic acid purification solution is 0.04g/100 ml.
In one embodiment, the nucleic acid purification solution has a final concentration of sodium dodecyl sulfate of 40g/100ml and a final concentration of disodium ethylenediaminetetraacetate of 0.04g/100 ml.
The nucleic acid in the saliva can be purified and extracted by the following method: and adding the supernatant of the centrifuged saliva sample into a nucleic acid purification solution for mixing treatment, and precipitating to obtain the purified nucleic acid.
For nucleic acid purification, the required amount of saliva sample is 1-1.5 ml.
The centrifugation conditions for the saliva samples were: 2000-3000g/min, and centrifuging for 10-15 min.
Preferably, the method for precipitating nucleic acid is: adding isopropanol, mixing, centrifuging, and removing supernatant to obtain nucleic acid precipitate. Further, the centrifugation conditions were: 11000g/min, and centrifuging for 10-15 min.
Preferably, the method for washing nucleic acid is washing with an aqueous ethanol solution. Specifically, the nucleic acid precipitate is mixed with an ethanol aqueous solution, centrifuged, and the supernatant is discarded to obtain purified nucleic acid. Further, the centrifugation conditions were: 10000-20000g/min, and centrifugation for 10-15 min.
Preferably, the volume fraction of ethanol in the ethanol water solution is 75-80%.
Preferably, the purification method further comprises the steps of: the resulting purified nucleic acid is stored dissolved.
Further, the reagent for solubilizing the purified nucleic acid does not contain a nuclease.
Preferably, the reagent used to solubilize the purified nucleic acid is water.
Example 1 purification of nucleic acids in minute quantities in saliva
1. Sample source:
shanghai public health clinic center
The leaving method comprises the following steps: before collection, the patient gargles 3-4 times with clear water to remove oral mucus and food debris. After gargling, the mixture is kept still for 3-5 minutes, 1.5-2 ml of saliva is secreted from the sublingual or the two cheeks and spitted into a 1-piece saliva collecting tube with a cover, and the collected sample is immediately placed in a refrigerator at the temperature of 4 ℃.
A total of 25 samples were collected.
2. The purification of trace nucleic acid in saliva is carried out by the following steps:
1) rinsing with clear water for 3-4 times to remove food residue and mucus in oral cavity; rest for 3 minutes.
2) Spit 1.5-2 ml of saliva into a high temperature and high pressure treated capped test tube.
3) Transferring the sample into a centrifugal tube which is treated at high temperature and high pressure and is 1.5 ml, centrifuging for 10-15 minutes at 3000 g/min;
4) taking 100 microliters of supernatant, and placing the supernatant in another 1.5 milliliter centrifuge tube which is processed at high temperature and high pressure;
5) adding 300 microliters of nucleic acid purification solution, and fully mixing for 10 minutes;
6) add 320 microliters of isopropyl alcohol and mix well for 5 minutes;
7) centrifuging at 11000g/min for 15min, and discarding the supernatant;
8) adding 500 microliter of 75-80% ethanol to clean nucleic acid precipitate;
9) centrifuging at 11000g/min for 5min, and discarding the supernatant;
10) air-drying the nucleic acid precipitate at room temperature;
11) the nucleic acid was dissolved and precipitated in 20. mu.l of distilled water containing no nuclease to obtain a nucleic acid sample, which was stored for use.
In the step 5), preparing a nucleic acid purification solution according to the following formula, wherein the percentage of each component is based on the total amount of the nucleic acid purification solution:
example 2 analysis of purification results
The purified saliva supernatant nucleic acid was reverse transcribed to produce cDNA (Qiagen reverse transcription kit), and then PCR amplification (PCR) was performed on the nucleic acid sample obtained in example 1 using primers specific for the coronavirus S protein, the sequences of which were:
an upstream primer: (SEQ ID NO: 1): a downstream primer: (SEQ ID NO: 2):
TABLE 1 amplification reaction System
| dNTP(2.5μM) | 160μL |
| 10X EX buffer | 2.0μL |
| Specific primer | 200μL |
| Template DNA | 1.0μL |
| Teq DNA polymerase | 10μL |
| PCR buffer (10 times working concentration) | 200μL |
(2) The results of the PCR were subjected to agarose gel electrophoresis and are shown in FIG. 1, which demonstrated that:
according to the method disclosed by the invention, 23 samples in the 25 samples are positive. 1 faint band and 1 negative.
Positive control: after admission, the patients are screened by nasopharyngeal swab nucleic acid detection, and the results are positive.
The sensitivity of the method of the invention compared to the positive control method was 92%. It can be seen that the sensitivity of the present invention is higher. Meanwhile, the method is high in testing speed, and a detection result can be obtained 2 hours after sampling, so that the method is an optional 2019-nCoV novel coronavirus detection means. Can also assist in the clinical diagnosis of the 2019-nCoV novel coronavirus.
The invention also carries out sampling detection on healthy people, the number of the tested people is 20, and the samples are all negative by adopting the detection method. Therefore, the specificity of the invention is high.
While the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and alterations without departing from the spirit and scope of the present invention, and all equivalent changes, modifications and alterations to the present invention are equivalent embodiments of the present invention; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.
Sequence listing
<110> Shanghai Libai Biotech Co., Ltd
<120>2019-nCoV novel coronavirus saliva detection biomarker and application thereof
<160>7
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
ggaccaatgg tactaagagg 20
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
tctgaactca ctttccatcc 20
<210>3
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gactcctggt gattcttctt c 21
<210>4
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
caatagattc tgttggttgg actc 24
<210>5
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
tccctgttgc tattcatgca g 21
<210>6
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ggattgacta gctacactac g 21
<210>7
<211>2230
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
ttattgccac tagtctctag tcagtgtgtt aatcttacaa ccagaactca attaccccct 60
gcatacacta attctttcac acgtggtgtt tattaccctg acaaagtttt cagatcctca 120
gttttacatt caactcagga cttgttctta cctttctttt ccaatgttac ttggttccat 180
gctatacatg tctctgggac caatggtact aagaggtttg ataaccctgt cctaccattt 240
aatgatggtg tttattttgc ttccactgag aagtctaaca taataagagg ctggattttt 300
ggtactactt tagattcgaa gacccagtcc ctacttattg ttaataacgc tactaatgtt 360
gttattaaag tctgtgaatt tcaattttgt aatgatccat ttttgggtgt ttattaccac 420
aaaaacaaca aaagttggat ggaaagtgag ttcagagttt attctagtgc gaataattgc 480
acttttgaat atgtctctca gccttttctt atggaccttg aaggaaaaca gggtaatttc 540
aaaaatctta gggaatttgt gtttaagaat attgatggtt attttaaaat atattctaag 600
cacacgccta ttaatttagt gcgtgatctc cctcagggtt tttcggcttt agaaccattg 660
gtagatttgc caataggtat taacatcact aggtttcaaa ctttacttgc tttacataga 720
agttatttga ctcctggtga ttcttcttca ggttggacag ctggtgctgc agcttattat 780
gtgggttatc ttcaacctag gacttttcta ttaaaatata atgaaaatgg aaccattaca 840
gatgctgtag actgtgcact tgaccctctc tcagaaacaa agtgtacgtt gaaatccttc 900
actgtagaaa aaggaatcta tcaaacttct aactttagag tccaaccaac agaatctatt 960
gttagatttc ctaatattac aaacttgtgc ccttttggtg aagtttttaa cgccaccaga 1020
tttgcatctg tttatgcttg gaacaggaag agaatcagca actgtgttgc tgattattct 1080
gtcctatata attccgcatc attttccact tttaagtgtt atggagtgtc tcctactaaa 1140
ttaaatgatc tctgctttac taatgtctat gcagattcat ttgtaattag aggtgatgaa 1200
gtcagacaaa tcgctccagg gcaaactgga aagattgctg attataatta taaattacca 1260
gatgatttta caggctgcgt tatagcttgg aattctaaca atcttgattc taaggttggt 1320
ggtaattata attacctgta tagattgttt aggaagtcta atctcaaacc ttttgagaga 1380
gatatttcaa ctgaaatcta tcaggccggt agcacacctt gtaatggtgt tgaaggtttt 1440
aattgttact ttcctttaca atcatatggt ttccaaccca ctaatggtgt tggttaccaa 1500
ccatacagag tagtagtact ttcttttgaa cttctacatg caccagcaac tgtttgtgga 1560
cctaaaaagt ctactaattt ggttaaaaac aaatgtgtca atttcaactt caatggttta 1620
acaggcacag gtgttcttac tgagtctaac aaaaagtttc tgcctttcca acaatttggc 1680
agagacattg ctgacactac tgatgctgtc cgtgatccac agacacttga gattcttgac 1740
attacaccat gttcttttgg tggtgtcagt gttataacac caggaacaaa tacttctaac 1800
caggttgctg ttctttatca ggatgttaac tgcacagaag tccctgttgc tattcatgca 1860
gatcaactta ctcctacttg gcgtgtttat tctacaggtt ctaatgtttt tcaaacacgt 1920
gcaggctgtt taataggggc tgaacatgtc aacaactcat atgagtgtga catacccatt 1980
ggtgcaggta tatgcgctag ttatcagact cagactaatt ctcctcggcg ggcacgtagt 2040
gtagctagtc aatccatcat tgcctacact atgtcacttg gtgcagaaaa ttcagttgct 2100
tactctaata actctattgc catacccaca aattttacta ttagtgttac cacagaaatt 2160
ctaccagtgt ctatgaccaa gacatcagta gattgtacaa tgtacatttg tggtgattca 2220
actgaatgca 2230
Claims (12)
1. Application of coronavirus S protein gene as biomarker in preparation of 2019-nCoV novel coronavirus saliva detection product or 2019-nCoV coronavirus pneumonia auxiliary saliva diagnosis product.
2. The use according to claim 1, characterized in that said 2019-nCoV novel coronavirus saliva test product comprises a substance specifically recognizing the coronavirus S protein gene.
3. Use of a substance specifically recognizing coronavirus S protein gene in preparation of 2019-nCoV novel coronavirus saliva detection products.
4. Use according to claim 3, further comprising one or more of the following features:
1) the 2019-nCoV novel coronavirus saliva detection product takes saliva as a detection sample source;
2) the dosage of a saliva sample required by the 2019-nCoV novel coronavirus saliva detection product is 1-1.5 ml;
3) the 2019-nCoV novel coronavirus saliva detection product is used for judging the 2019-nCoV novel coronavirus, selecting a treatment scheme, judging the treatment effect and/or performing prognosis evaluation.
5. Use according to claim 3, wherein the substance specifically recognizing the coronavirus S protein gene is selected from primers specifically amplifying the coronavirus S protein gene.
6. The use according to claim 4, wherein the primers for the specific amplification of the coronavirus S protein gene comprise any one or more of the following primer combinations:
(1) as shown in SEQ ID NO: 1 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 2, or a reverse primer;
(2) as shown in SEQ ID NO: 3 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 4, a downstream primer;
(3) as shown in SEQ ID NO: 5 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 6.
7. A2019-nCoV novel coronavirus saliva detection kit at least comprises a substance for specifically recognizing coronavirus S protein gene.
8. The 2019-nCoV novel coronavirus saliva detection kit according to claim 7, wherein the substance specifically recognizing coronavirus S protein gene is selected from primers specifically amplifying coronavirus S protein gene.
9. The 2019-nCoV novel coronavirus saliva detection kit according to claim 8, wherein the primers for specifically amplifying coronavirus S protein genes comprise any one or more of the following primer combinations:
(1) as shown in SEQ ID NO: 1 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 2, or a reverse primer;
(2) as shown in SEQ ID NO: 3 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 4, a downstream primer;
(3) as shown in SEQ ID NO: 5 and a 2019nCoV novel coronavirus upstream primer shown as SEQ ID NO: 6.
10. The 2019-nCoV novel coronavirus saliva test kit of claim 7, further comprising a nucleic acid purification solution, wherein the nucleic acid purification solution at least comprises the following components in percentage by weight based on the total amount of the nucleic acid purification solution:
11. the 2019-nCoV novel coronavirus saliva test kit according to claim 10, wherein the nucleic acid purification solution at least comprises the following components in percentage by weight based on the total amount of the nucleic acid purification solution:
12. the 2019-nCoV novel coronavirus saliva test kit as claimed in claim 10, wherein the final concentration of sodium dodecyl sulfate in the nucleic acid purification solution is 40g/100ml, and/or the final concentration of disodium edetate in the nucleic acid purification solution is 0.04g/100 ml.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010169789.9A CN111424114A (en) | 2020-03-12 | 2020-03-12 | 2019-nCoV novel coronavirus saliva detection biomarker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010169789.9A CN111424114A (en) | 2020-03-12 | 2020-03-12 | 2019-nCoV novel coronavirus saliva detection biomarker and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111424114A true CN111424114A (en) | 2020-07-17 |
Family
ID=71546494
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010169789.9A Pending CN111424114A (en) | 2020-03-12 | 2020-03-12 | 2019-nCoV novel coronavirus saliva detection biomarker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111424114A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112946294A (en) * | 2020-04-02 | 2021-06-11 | 长春西诺生物科技有限公司 | Novel coronavirus 2019-nCoV antibody detection test strip and preparation method and application thereof |
| CN113308560A (en) * | 2020-12-31 | 2021-08-27 | 郑州大学第一附属医院 | Oral microbial gene marker for noninvasive diagnosis of novel coronavirus infected patient and application of oral microbial gene marker |
| CN113786479A (en) * | 2021-01-12 | 2021-12-14 | 赛元生物科技(杭州)有限公司 | Method for examining neocoronal pneumonia |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1455003A (en) * | 2003-06-07 | 2003-11-12 | 王虹 | SARS coronavirus fluorescent molecular beacon PCR detecting technique |
| CN1802438A (en) * | 2003-05-09 | 2006-07-12 | 北京博奥生物芯片有限责任公司 | Method and composition for detecting SARS virus |
| CN101437941A (en) * | 2006-03-30 | 2009-05-20 | 科学与工业研究会 | A method for rapid isolation of RNA and a kit thereof |
| CN101565700A (en) * | 2009-05-08 | 2009-10-28 | 广州中医药大学 | Reagent for extracting RNA or DNA virus in body fluid |
| CN107557494A (en) * | 2017-09-26 | 2018-01-09 | 华中农业大学 | Differentiate the primer of detection diarrhea of pigs coronavirus and multiple RT PCR methods |
-
2020
- 2020-03-12 CN CN202010169789.9A patent/CN111424114A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1802438A (en) * | 2003-05-09 | 2006-07-12 | 北京博奥生物芯片有限责任公司 | Method and composition for detecting SARS virus |
| CN1455003A (en) * | 2003-06-07 | 2003-11-12 | 王虹 | SARS coronavirus fluorescent molecular beacon PCR detecting technique |
| CN101437941A (en) * | 2006-03-30 | 2009-05-20 | 科学与工业研究会 | A method for rapid isolation of RNA and a kit thereof |
| CN101565700A (en) * | 2009-05-08 | 2009-10-28 | 广州中医药大学 | Reagent for extracting RNA or DNA virus in body fluid |
| CN107557494A (en) * | 2017-09-26 | 2018-01-09 | 华中农业大学 | Differentiate the primer of detection diarrhea of pigs coronavirus and multiple RT PCR methods |
Non-Patent Citations (5)
| Title |
|---|
| JASPER FUK-WOO CHAN等: "A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster", 《THE LANCET》 * |
| KELVIN KAI-WANG TO等: "Consistent Detection of 2019 Novel Coronavirus in Saliva", 《CLINICAL INFECTIOUS DISEASES》 * |
| 张璟 等: "《食品微生物检验技术及设备操作指南》", 31 August 2017 * |
| 李力 等: "《实用生物医学概论教程》", 31 July 2016 * |
| 邱峰 等: "新型冠状病毒SARS-CoV-2的实验室检测技术", 《南方医科大学学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112946294A (en) * | 2020-04-02 | 2021-06-11 | 长春西诺生物科技有限公司 | Novel coronavirus 2019-nCoV antibody detection test strip and preparation method and application thereof |
| CN112946294B (en) * | 2020-04-02 | 2024-03-15 | 长春西诺生物科技有限公司 | Novel coronavirus 2019-nCoV antibody detection test strip and preparation method and application thereof |
| CN113308560A (en) * | 2020-12-31 | 2021-08-27 | 郑州大学第一附属医院 | Oral microbial gene marker for noninvasive diagnosis of novel coronavirus infected patient and application of oral microbial gene marker |
| CN113786479A (en) * | 2021-01-12 | 2021-12-14 | 赛元生物科技(杭州)有限公司 | Method for examining neocoronal pneumonia |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111424114A (en) | 2019-nCoV novel coronavirus saliva detection biomarker and application thereof | |
| CN112226538B (en) | Primer probe combination, kit and method for novel coronavirus detection | |
| CN103484565A (en) | Kit for detecting coronavirus through real-time fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) and application thereof | |
| CN108504774B (en) | Method for detecting rhinovirus typing and enterovirus | |
| CN116814812A (en) | Primer probe set for identifying scorpion of Buthus martensii Karsch and real-time fluorescence PCR identification method | |
| CN111518877B (en) | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples | |
| CN101864492A (en) | Nucleic acid detection kit for aided diagnosis of ankylosing spondylitis | |
| CN117050989B (en) | Primer probe group for identifying spike messenger scorpion and application thereof | |
| CN111944895B (en) | Kit for predicting semen collection fate of non-obstructive azoospermia patient | |
| CN111004849B (en) | Primer, method and kit for detecting multiple site mutations of CDH1 gene | |
| CN111471780A (en) | Helicobacter pylori saliva detection biomarker and application thereof | |
| WO2017092483A1 (en) | Kit for diagnosing tuberculosis through detecting free nucleic acid and use thereof | |
| CN112458196B (en) | Primer group and kit for quantitative detection of yersinia sporogenes and application of primer group and kit | |
| CN116042916A (en) | Kit for detecting monkey pox virus and method for detecting monkey pox virus | |
| CN102146467A (en) | Reagent for detecting Yersinia pestis and method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis | |
| CN102277418A (en) | Primer, kit and method used for detecting Treponema pallidum | |
| CN114196779A (en) | Pathogenic microorganism detection method and kit based on targeted sequencing | |
| CN103114154A (en) | Rhinovirus real-time fluorescent RT-PCR (reverse transcription-polymerase chain reaction) detection kit and application thereof | |
| CN113817870A (en) | Primer composition for simultaneously detecting seven respiratory tract-related viruses and application thereof | |
| CN108950064B (en) | Kit and method for detecting EBV infection in ocular trace biological sample | |
| CN113234812A (en) | Diagnostic reagent for diagnosing Alzheimer disease | |
| CN107236023B (en) | Antigen composition for detecting tuberculosis infection and application thereof | |
| CN112626204B (en) | Primers and method for detecting HLA-B1502 typing useful for guiding administration of carbamazepine | |
| CN106929605B (en) | Detection kit, primer and probe capable of simultaneously detecting and identifying foot-and-mouth disease and vesicular stomatitis | |
| CN111763751A (en) | Tuberculosis saliva detection biomarker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210525 Address after: 200086 room 101u, 98 Guokang Road, Yangpu District, Shanghai Applicant after: Shanghai Libai Biotechnology Co.,Ltd. Applicant after: Shanghai Lisheng Biotechnology Co.,Ltd. Address before: 200086 2nd floor, 100 Guokang Road, Yangpu District, Shanghai Applicant before: Shanghai Libai Biotechnology Co.,Ltd. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200717 |