CN105695635A - Multiplex RT-PCR (reverse transcription-polymerase chain reaction) detection kit for porcine epidemic diarrhea virus - Google Patents
Multiplex RT-PCR (reverse transcription-polymerase chain reaction) detection kit for porcine epidemic diarrhea virus Download PDFInfo
- Publication number
- CN105695635A CN105695635A CN201610194077.6A CN201610194077A CN105695635A CN 105695635 A CN105695635 A CN 105695635A CN 201610194077 A CN201610194077 A CN 201610194077A CN 105695635 A CN105695635 A CN 105695635A
- Authority
- CN
- China
- Prior art keywords
- epidemic diarrhea
- porcine epidemic
- diarrhea virus
- pcr
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The invention discloses a multiplex RT-PCR (reverse transcription-polymerase chain reaction) detection kit for a porcine epidemic diarrhea virus and belongs to the technical fields of animal virology and molecular biology. The kit comprises primer sequences shown in SEQ ID 1-4 and also comprises components, such as RT-PCR buffer solution, reverse transcriptase and polymerase. The kit discloses by the invention can carry out triple RT-PCR detection on a porcine epidemic diarrhea virus variant strain, a classical strain and an attenuated vaccine strain by adopting a one-step process, the multiplex RT-PCR detection kit has strong specificity and high sensitivity and is simple in operation, and a referenced technological means is provided for differential diagnosis and study of epidemiology and pathogenesis of porcine epidemic diarrhea.
Description
Technical field
The invention belongs to animal virology and technical field of molecular biology, relate to the multiple RT-PCR detection kit of a kind of Porcine epidemic diarrhea virus, be specially the detection method for variation strain, classical strains and the triple RT-PCR of attenuated vaccine strain one-step method and application。
Background technology
Porcine epizootic diarrhea (porcineepidemicdiarrhea, PED) it is by Porcine epidemic diarrhea virus (porcineepidemicdiarrheavirus, a kind of high degree in contact infectious intestinal disease of the pig PEDV) caused, this disease to be mainly characterized by acute watery diarrhea, vomiting and dehydration dead；The equal susceptible of pig of various age levels, 1～2 week old suckling pig harm is the most serious, and death rate of the onset may be up to 90%～100%, causes serious harm and economic loss to pig industry。20 century 70s, Britain and Belgium each take the lead in reporting the generation of this disease, and this disease multiple main pig-raising countries in the world break out with popular in succession subsequently, and Asia some country such as Thailand, Korea S, Vietnam and China repeatedly report PED in recent years。
PEDV is the member of shell type virales (Nidovirales) coronaviridae (Coronaviridae) coronavirus subfamily (Coronavirinae) A type coronavirus genus (Alphacoronavirus), for there being the single strand plus RNA virus of cyst membrane。PEDV full-length genome is about 28Kb, noncoding region, 3 ' end noncoding region and at least 7 open reading frame (ORF1a are held including 5 ', ORF1b, ORF2 ~ 6), it is separately encoded major structural protein: spike protein (S), memebrane protein (M), nucleocapsid protein (N), little envelope protein (E) and non-structural protein (replicative enzyme 1a, 1b, ORF3 albumen)。S protein is I type transmembrane protein, is positioned at the surface of virion, and it plays highly important effect in the generation of inductive infection host's neutralizing antibody and the combination of specific receptor and cell membrane fusion。Additionally, the variation of S gene in coronavirus can cause the change of Frozen tissue preferendum and the change of virus virulence。ORF3 gene is a subsidiary gene of PEDV, a kind of ionophorous protein of coding, scalable viral yield, it is possible to the virulence of virus is relevant。There is the disappearance of 49 or 51 nucleotide at 245-294bp in the ORF3 gene of PEDV attenuated vaccine strain, is the important molecular marker of low virulent strain。
In the end of the year 2010, PED is in China's outbreak of epidemic on a large scale, and main manifestations is suckling pig diarrhoea (case fatality rate reaches 80%～100%) of high incidence and high mortality clinically, causes substantial amounts of suckling pig dead。Currently, the popular PEDV strain of China is primarily present two types, i.e. PEDV classical strains and PEDV variation strain, and with variation strain for advantage epidemic isolates。The maximum region that makes a variation in PEDV genome is positioned at S gene, and most variation is all gathered in the N end of S gene。Compared with the classical strains (PEDVCV777) popular with early stage, there is the insertion of 15 bases and the disappearance of 6 bases in the S gene of PEDV variation strain, thus causing that the antigen site of epidemic isolates S protein, glycosylation site and transbilayer helix all have significant change at N end。There is also and the strain of attenuated vaccine strain very high homology additionally, research is shown in the clinical sample of collection。
The pandemic PEDV of current China for advantage strain, classical strains and saves as feature with variation strain, adds widely using of low virulent strain so that PEDV strain clinically is intricate。Conventional sense virus purification, SABC, immunofluorescence test and conventional RT-PCR etc. can not distinguish PEDV strain type；Gene sequencing is to identify the effective means of strain type, but the method complicated operation, elapsed time length, expense cost are high。China there is no the multiplex RT-PCR method of Differential Diagnosis Porcine epidemic diarrhea virus variant, classical strains and attenuated vaccine strain at present。Therefore, it is necessary to the multiple RT-PCR setting up a kind of fast and convenient effective Porcine epidemic diarrhea virus variant, classical strains and attenuated vaccine strain differentiates detection method。
Based on above research and current demand, the feature that this research is inserted according to PEDV 49 nucleotide of attenuated vaccine strain ORF3 gene delection and variation strain S gene continuous print nucleotide, design and synthesize the primer of 2 pairs of detection Porcine epidemic diarrhea virus, adopt multiplex RT-PCR method amplification ORF3 gene and S genetic fragment, by the quantity of amplified fragments and molecular size range, judgement is Porcine epidemic diarrhea virus variant, classical strains or pig epidemic diarrhea virus attenuated vaccine strain, thus it is special, sensitive, fast and convenient, low cost, the strain type of effective Differential Diagnosis Porcine epidemic diarrhea virus。
Summary of the invention
The purpose of the present invention quickly differentiates detection method for setting up Porcine epidemic diarrhea virus (PEDV) variation strain, classical strains and attenuated vaccine strain, reduce cost, and three kinds of strains of Porcine epidemic diarrhea virus can be detected fast and effectively, it is provided that the multiple RT-PCR detection kit of a kind of Porcine epidemic diarrhea virus。The technical scheme used for realizing the object of the invention is:
A kind of multiple RT-PCR detection kit of Porcine epidemic diarrhea virus, described test kit includes following primer sequence:
ORF3-F5 '-gcgcgttttgctgtcat-3 ' (SEQID1),
ORF3-R5 '-gtcaccaccttctaaaatcac-3 ' (SEQID2)；
S-P15 '-gaaaaccagggtgtcaat-3 ' (SEQID3),
S-P25 '-cagcaagaatgacagaggtg-3 ' (SEQID4)。
Preferably, described primer ORF3-F, ORF3-R expands the ORF3 genetic fragment of PEDV。
Preferably, described test kit includes following components: RT-PCR reaction buffer, reverse transcription, polymerase。
Preferably, described RT-PCR reaction buffer includes RNA template 14 μ L, 5 × PrimeScriptTM buffer 4 μ L, RTEnzymeMix1.0 μ L, reverse transcription primer Oligo18T1.0 μ L。
Preferably, described RT-PCR reaction condition is: 95 DEG C of denaturation 3min；94 DEG C of degeneration 40s, 52 DEG C of renaturation 40s, 72 DEG C extend 50s, 40 circulations；Last 72 DEG C extend 8min。
Preferably, the multiple RT-PCR detection kit of a kind of Porcine epidemic diarrhea virus is in the application of detection Porcine epidemic diarrhea virus variation strain, classical strains and attenuated vaccine strain。
Preferably, described primer ORF3-F, ORF3-R expands variation strain and classical strains expection purpose clip size is 234bp, and attenuated vaccine strain expection purpose clip size is 185bp。
The invention have the benefit that
According to the PEDV variation strain announced in GenBank, the S gene of classical strains and attenuated vaccine strain and ORF3 gene, design synthesis 2 is to specificity amplification primer, in order to specific amplification PEDVS gene and ORF3 gene, by the quantity of purpose fragment and clip size to judge the strain type of PEDV；By the optimization to reaction conditions such as annealing temperatures, establish the multiple RT-PCR detection kit of the different PEDV strain type of detection。
The multiple RT-PCR detection kit energy specificity that the present invention sets up distinguishes PEDV variation strain, classical strains and attenuated vaccine strain；PEDV variation strain amplifies the band of 2 entries, respectively the S genetic fragment of the ORF3 genetic fragment of 234bp and 826bp；PEDV classical strains amplifies the band of 1 entry, and clip size is the ORF3 genetic fragment of 234bp；And attenuated vaccine strain amplifies the band of 1 entry, clip size is the ORF3 genetic fragment of 185bp；With transmissible gastro-enteritis virus, A group's porcine rotavirus, pig ridge virus, porcine reproductive and respiratory syndrome virus, PRV (Pseudorabies virus), swine fever virus, porcine circovirus 2 type, Latex agglutination test, the thin circovirus virus of pig and the equal no cross reaction of pig parvoviral；Sensitivity tests shows, the minimum nucleic acid concentration that the method can detect is 2.3 × 10-4Ng/ μ L；And the method has good repeatability。The method is utilized to detect from 91 parts of some areas of Guangxi clinical diarrhoea samples gathering, in clinical diarrhoea sample, PEDV positive has 64 parts, wherein variation strain accounts for 89.06%(57/64), classical strains accounts for 4.69%(3/64), attenuated vaccine strain accounts for 6.25%(4/64)。It is shown that this multiple RT-PCR detection kit there is high specificity, highly sensitive, simple to operate, the Differential Diagnosis research for the epidemiology of porcine epizootic diarrhea and cause of disease provides the technological means being available for using for reference。
Accompanying drawing explanation
Fig. 1 is the RT-PCR amplification of genes of interest in detailed description of the invention；Wherein M:DNA molecular mass standard；1: Porcine epidemic diarrhea virus variation strain, classical strains, attenuated vaccine strain mixture；2: Porcine epidemic diarrhea virus variation strain；3: Porcine epidemic diarrhea virus classical strains；4: pig epidemic diarrhea virus attenuated vaccine strain；5: negative control。
Fig. 2 is the different annealing temperature of multiple RT-PCR in detailed description of the invention；Wherein M:DNA molecular mass standard；1:49.0 DEG C；2:49.6 DEG C；3:50.4 DEG C；4:51.6 DEG C；5:52.5 DEG C；6:53.4 DEG C；7:54.3 DEG C；8:56.5 DEG C。
Fig. 3 is the sensitivity tests of multiple RT-PCR in detailed description of the invention；Wherein M:DNA molecular mass standard；1:2.3ng/ μ L；2:2.3 × 10-1Ng/ μ L；3:2.3 × 10-2Ng/ μ L；4:2.3 × 10-3Ng/ μ L；5:2.3 × 10-4Ng/ μ L；6:2.3 × 10-5Ng/ μ L；7:2.3 × 10-6Ng/ μ L；8:2.3 × 10-7Ng/ μ L；9:2.3 × 10-8Ng/ μ L；10:H2O
Fig. 4 is the specific test of multiple RT-PCR in detailed description of the invention；Wherein M:DNA molecular mass standard；1: Porcine epidemic diarrhea virus variation strain, classical strains, attenuated vaccine strain mixture；2: Porcine epidemic diarrhea virus variation strain；3: Porcine epidemic diarrhea virus classical strains；4: pig epidemic diarrhea virus attenuated vaccine strain；5: transmissible gastro-enteritis virus；6:A group's pig colyliform is sick；7: pig ridge virus；8: pseudorabies virus；9: swine fever virus；10: pig parvoviral；11: porcine reproductive and respiratory syndrome virus；12: porcine circovirus；13: Latex agglutination test；14: the thin circovirus virus of pig；15: negative control。
Fig. 5 is clinical sample detection in detailed description of the invention；Wherein M:DNA molecular mass standard；1-14: clinical sample 15: positive control (Porcine epidemic diarrhea virus variation strain)；16: negative control。
Detailed description of the invention
1 materials and methods
1.1 strains
Pig epidemic diarrhea virus attenuated vaccine strain (PEDVattenuatedstrainCV777), Porcine epidemic diarrhea virus classical strains (PEDVclassicalstrain), Porcine epidemic diarrhea virus classical strains (PEDVvariantstrain), transmissible gastro-enteritis virus (TGEV), A group's porcine rotavirus (PRoVA), swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), pig parvoviral (PPV), pseudorabies virus (PRV), pig ridge virus (PKV), Latex agglutination test (JEV), porcine circovirus 2 type (PCV-2), the thin circovirus virus of pig (TTV) preserves by this laboratory and provides。
1.2 clinical samples
Diarrheic stools and intestine of young pigs sample of having loose bowels pick up from the piglet of Nanning, Guangxi Zhuang Autonomous Region, Liuzhou, Guilin, Guigang, Yulin, Deng Di pig farm, Chongzuo generation diarrhoea。
1.3 main agents
Virus genom DNA/RNA Rapid extraction test kit is Axygen bio tech ltd product；Reverse Transcription box (PrimeScriptRTreagentKit) is Dalian treasured biological engineering company limited product；DL500DNAMarker, 2 × TaqPCRMasterMix are purchased from Beijing Tian Gen biochemical technology company limited。
The design of 1.4 primers and synthesis
According to the pig epidemic diarrhea virus attenuated vaccine strain CV777 logged on GenBank, classical strains and the ORF3 gene of variation strain in recent years, S gene order, the region utilizing MegAlign (DNAStar) and PrimerPremier7.0 software maximum at the two ends of ORF3 gene delection fragment and S genetic variability designs two to specific primer, is respectively designated as ORF3-F, ORF3-R and S-P1, S-P2。It is 234bp that primer ORF3-F, ORF3-R expand the ORF3 genetic fragment of PEDV, variation strain and classical strains expection purpose clip size, and attenuated vaccine strain expection purpose clip size is 185bp；Primer S-P1, S-P2 are only capable of amplification variation strain, and producing expection purpose clip size is 826bp。Above-mentioned primer is synthesized by Dalian treasured biological engineering company limited。
Table 1 primer sequence
The process of 1.5 fecal specimens and the extraction of viral RNA
By the fecal specimens gathered, intestinal contents PBS(0.01mol/L, pH7.2) make 10% suspension, after vortex concussion, collect supernatant after the centrifugal 10min of 10000r/min under 4 DEG C of conditions, carry out RNA extracting or store for future use in-20 DEG C。According to AxyPrepBodyFluidViralDNA/RNAMiniprepKit operation instructions, PEDV variation strain, classical strains, attenuated vaccine strain cell toxicant virus liquid and fecal specimens, intestinal contents supernatant being carried out RNA extraction, extracted RNA is made directly RT-PCR or is placed in-20 DEG C of preservations。
1.6 reverse transcription-polymerase chain reaction (RT-PCR)
Reverse transcription synthesis cDNA: according to RT(reverse transcription) test kit explanation, adopt 20 μ L systems: RNA template 14 μ L, 5 × PrimeScriptTM buffer 4 μ L, RTEnzymeMix1.0 μ L, reverse transcription primer Oligo18T1.0 μ L, reverse transcription reaction is carried out: 37 DEG C of 20min by following procedure, 85 DEG C of 30s, 12 DEG C of preservations。
PCR reaction system 25 μ L, aquesterilisa 7.5 μ L, 2 × TaqPCRMasterMix12.5 μ L, primer ORF3-F, ORF3-R and S-P1, S-P2 each 0.5 μ L, template 3.0 μ L。Expand according to following condition: 95 DEG C of denaturation 3min；94 DEG C of degeneration 40s, 52 DEG C of renaturation 40s, 72 DEG C extend 50s, 40 circulations；Last 72 DEG C extend 8min。Take amplified production electrophoresis in 10g/L agarose gel observed result。
1.7 specific tests
Take respectively porcine reproductive and respiratory syndrome virus (PRRSV), pig ridge virus (PKV), transmissible gastro-enteritis virus (TGEV), Porcine epidemic diarrhea virus (PEDV), A group's porcine rotavirus (PRoVA), swine fever virus (CSFV), the RNA reverse transcription product of Latex agglutination test (JEV) and pig parvoviral (PPV), pseudorabies virus (PRV), porcine circovirus 2 type (PCV-2), the thin circovirus virus of pig (TTV) DNA be template, expand by the method set up, to verify the specificity of the method。
1.8 sensitivity testss
Extract the RNA of PEDV variation strain, classical strains, attenuated vaccine strain cell toxicant virus liquid respectively, measure its concentration with uv analyzer and the RNA of different strains is adjusted to same concentrations, then 9 dilution factors are become with the continuous 10 times of doubling dilutions of RNA-FreeWater, take each dilution factor and carry out RT-PCR reaction as template by above-mentioned system and optimum reaction conditions, to determine the sensitivity of the method。
1.9 repeatability and stability tests
Differentiate that detection method is respectively to PEDV Porcine epidemic diarrhea virus variation strain, classical strains and attenuated vaccine strain mixture with the multiple RT-PCR set up, and simple variation strain, classical strains and attenuated vaccine strain, each 5 parts of duplicate detection of PEDV positive pathological material of disease and negative pathological material of disease 3 times, to verify repeatability and the stability of this method。
The detection of 1.10 clinical samples
Utilize the multiple RT-PCR that this research sets up differentiate detection method to from Nanning, Liuzhou, Guilin, Guigang, Yulin, Deng Di pig farm, Chongzuo occur the piglet fecal specimens (91 parts) of diarrhoea to detect, and these sample conventional RT-PCRs are detected, PEDV variation strain, classical strains, attenuated vaccine strain proportion in statistics current diarrhoea case。
2 results
The optimization of 2.1PCR amplification condition
For obtaining this reaction the best expanding effect and most hypersensitivity, the condition of multiplexed PCR amplification is groped and has adjusted, gradient ground changes denaturation temperature and time, annealing temperature and time, the conditions such as extension time and period, the best amplification condition finally determining multiplex PCR is 95 DEG C, 3min；94 DEG C of 40s, 50.4 DEG C of 45s, 72 DEG C of 50s, 40 circulations；Last 72 DEG C extend 8min。Electrophoresis result display (see figure 1), the multiplex RT-PCR method set up amplifies Porcine epidemic diarrhea virus variation strain, classical strains and attenuated vaccine strain mixture and obtains the fragment of 3 entries, respectively 826bp, 234bp and 185bp；Amplify Porcine epidemic diarrhea virus variation strain and obtain the fragment of 2 entries, respectively fragment 826bp and 234bp；Amplify Porcine epidemic diarrhea virus classical strains and obtain the fragment of 1 entry, for 234bp；Amplify pig epidemic diarrhea virus attenuated vaccine strain and obtain the fragment of 1 entry, for 185bp；All it is consistent with intended purpose bin number and clip size。Therefore, may determine that whether examined diarrheic stools sample exists Porcine epidemic diarrhea virus by this detection, and judge which kind of type strain Porcine epidemic diarrhea virus belongs to by purpose bin number and clip size。
2.2 sensitivity testss
The RNA extract of the PEDV virus liquid of 3 kinds of different strains, identical concentration it is adjusted to after concentration measures, again by identical 3 kinds of RNA mixed in equal amounts of concentration, the concentration of every kind of strain RNA is 2.3ng/ μ L, then taking RNA-FreeWater10 times of doubling dilution thing is template, expand with set up multiplex RT-PCR method, and with ddH2O makes negative control。It is shown that the method can detect that least concentration is 2.3 × 10 simultaneously-4The RNA(of the Porcine epidemic diarrhea virus of 3 kinds of strains of ng/ μ L is shown in Fig. 3)。
2.3 specific tests
Result of the test display (see figure 4), the RT-PCR method that this research is set up can detect virus variation strain specifically, classical strains, attenuated vaccine strain mixture and simple Porcine epidemic diarrhea virus variation strain, classical strains, attenuated vaccine strain, and to transmissible gastro-enteritis virus, A group's porcine rotavirus, pig ridge virus, pseudorabies virus, swine fever virus, porcine reproductive and respiratory syndrome virus, pig parvoviral, pig circular ring virus, Latex agglutination test, the testing result of the thin circovirus virus of pig is all without band, show that the method set up has good specificity。
2.4 replica tests
The multiple RT-PCR set up with this research differentiates that detection method is to PEDV Porcine epidemic diarrhea virus variation strain, classical strains and attenuated vaccine strain mixture, and simple variation strain, classical strains and attenuated vaccine strain, each 5 parts of duplicate detection of PEDV positive pathological material of disease and negative pathological material of disease 3 times, result is so 3 testing results of sample are all consistent, it was shown that the method is reliable and stable reproducible。
The detection of 2.5 clinical samples
To the 91 parts of fecal specimens gathered, the Differential Diagnosis RT-PCR method set up with this research carries out PEDV detection。Result shows, wherein 57 parts of samples are that PEDV variation strain is positive, and having 3 parts of samples is that PEDV classical strains is positive, and having 4 parts of samples in addition is that PEDV attenuated vaccine strain is positive；PEDV positive totally 64 parts。PEDV variation strain accounts for the 89.06%(57/64 of total PEDV strain), classical strains accounts for the 4.69%(3/64 of total PEDV strain), attenuated vaccine strain accounts for the 6.25%(4/64 of total PEDV strain), variation strain is the advantage strain of current porcine epizootic diarrhea。
<110>Veterinary Institute of Guangxi Zhuang Autonomous Region
<120>multiple RT-PCR detection kit of a kind of Porcine epidemic diarrhea virus
<160>4
<210>1
<211>17
<212>DNA
<213>artificial sequence
<400>1
gcgcgttttgctgtcat
<210>2
<211>21
<212>DNA
<213>artificial sequence
<400>2
gtcaccaccttctaaaatcac
<210>3
<211>18
<212>DNA
<213>artificial sequence
<400>3
gaaaaccagggtgtcaat
<210>4
<211>20
<212>DNA
<213>artificial sequence
<400>4
cagcaagaatgacagaggtg
Claims (7)
1. the multiple RT-PCR detection kit of a Porcine epidemic diarrhea virus, it is characterised in that described test kit includes following primer sequence:
ORF3-F5 '-gcgcgttttgctgtcat-3 ' (SEQID1),
ORF3-R5 '-gtcaccaccttctaaaatcac-3 ' (SEQID2)；
S-P15 '-gaaaaccagggtgtcaat-3 ' (SEQID3),
S-P25 '-cagcaagaatgacagaggtg-3 ' (SEQID4)。
2. the multiple RT-PCR detection kit of Porcine epidemic diarrhea virus according to claim 1, it is characterised in that described primer ORF3-F, ORF3-R expands the ORF3 genetic fragment of PEDV。
3. the multiple RT-PCR detection kit of Porcine epidemic diarrhea virus according to claim 1, it is characterised in that described test kit includes following components: RT-PCR reaction buffer, reverse transcription, polymerase。
4. the multiple RT-PCR detection kit of Porcine epidemic diarrhea virus according to claim 3, it is characterized in that, described RT-PCR reaction buffer includes RNA template 14 μ L, 5 × PrimeScriptTM buffer 4 μ L, RTEnzymeMix1.0 μ L, reverse transcription primer Oligo18T1.0 μ L。
5. the multiple RT-PCR detection kit of Porcine epidemic diarrhea virus according to claim 3, it is characterised in that described RT-PCR reaction condition is: 95 DEG C of denaturation 3min；94 DEG C of degeneration 40s, 52 DEG C of renaturation 40s, 72 DEG C extend 50s, 40 circulations；Last 72 DEG C extend 8min。
6. the multiple RT-PCR detection kit of Porcine epidemic diarrhea virus according to claim 1 is in the application of detection Porcine epidemic diarrhea virus variation strain, classical strains and attenuated vaccine strain。
7. the application of the multiple RT-PCR detection kit of Porcine epidemic diarrhea virus according to claim 6, it is characterized in that, described primer ORF3-F, ORF3-R expands variation strain and classical strains expection purpose clip size is 234bp, and attenuated vaccine strain expection purpose clip size is 185bp。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610194077.6A CN105695635A (en) | 2016-03-31 | 2016-03-31 | Multiplex RT-PCR (reverse transcription-polymerase chain reaction) detection kit for porcine epidemic diarrhea virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610194077.6A CN105695635A (en) | 2016-03-31 | 2016-03-31 | Multiplex RT-PCR (reverse transcription-polymerase chain reaction) detection kit for porcine epidemic diarrhea virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105695635A true CN105695635A (en) | 2016-06-22 |
Family
ID=56218068
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610194077.6A Pending CN105695635A (en) | 2016-03-31 | 2016-03-31 | Multiplex RT-PCR (reverse transcription-polymerase chain reaction) detection kit for porcine epidemic diarrhea virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105695635A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222299A (en) * | 2016-08-02 | 2016-12-14 | 四川农业大学 | A kind of PCR kit for fluorescence quantitative detecting Porcine epidemic diarrhea virus and application thereof |
| CN106834538A (en) * | 2017-01-11 | 2017-06-13 | 山东省滨州畜牧兽医研究院 | One kind differentiates Porcine epidemic diarrhea virus vaccine low virulent strain and/or popular strain one-step method RT PCR diagnostic kits |
| CN108676922A (en) * | 2018-07-18 | 2018-10-19 | 河北农业大学 | Primer and probe for detecting Porcine epidemic diarrhea virus street strain and TaqMan real time fluorescence quantifying PCR methods |
| CN109825649A (en) * | 2019-04-09 | 2019-05-31 | 广西大学 | Porcine epidemic diarrhea virus G1/G2 type RT-PCR diagnostic primers group and its diagnostic kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060474A (en) * | 2013-01-07 | 2013-04-24 | 江苏省农业科学院 | Primers for detecting variants on porcine epidemic diarrhea virus and detection kit thereof |
| CN104152578A (en) * | 2013-06-03 | 2014-11-19 | 中国农业科学院上海兽医研究所 | RT-PCR kit for identification and diagnosis of porcine epidemic diarrhea virus and application of RT-PCR kit |
-
2016
- 2016-03-31 CN CN201610194077.6A patent/CN105695635A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060474A (en) * | 2013-01-07 | 2013-04-24 | 江苏省农业科学院 | Primers for detecting variants on porcine epidemic diarrhea virus and detection kit thereof |
| CN104152578A (en) * | 2013-06-03 | 2014-11-19 | 中国农业科学院上海兽医研究所 | RT-PCR kit for identification and diagnosis of porcine epidemic diarrhea virus and application of RT-PCR kit |
Non-Patent Citations (1)
| Title |
|---|
| 訾玉华等: "新发猪流行性腹泻病毒分子变异分析", 《上海农业学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222299A (en) * | 2016-08-02 | 2016-12-14 | 四川农业大学 | A kind of PCR kit for fluorescence quantitative detecting Porcine epidemic diarrhea virus and application thereof |
| CN106834538A (en) * | 2017-01-11 | 2017-06-13 | 山东省滨州畜牧兽医研究院 | One kind differentiates Porcine epidemic diarrhea virus vaccine low virulent strain and/or popular strain one-step method RT PCR diagnostic kits |
| CN108676922A (en) * | 2018-07-18 | 2018-10-19 | 河北农业大学 | Primer and probe for detecting Porcine epidemic diarrhea virus street strain and TaqMan real time fluorescence quantifying PCR methods |
| CN109825649A (en) * | 2019-04-09 | 2019-05-31 | 广西大学 | Porcine epidemic diarrhea virus G1/G2 type RT-PCR diagnostic primers group and its diagnostic kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lin et al. | Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains | |
| Longjam et al. | A brief review on diagnosis of foot-and-mouth disease of livestock: conventional to molecular tools | |
| Pantin-Jackwood et al. | Molecular characterization and typing of chicken and turkey astroviruses circulating in the United States: implications for diagnostics | |
| Egli et al. | Quantitative TaqMan® RT-PCR for the detection and differentiation of European and North American strains of porcine reproductive and respiratory syndrome virus | |
| Wang et al. | Porcine enteric caliciviruses: genetic and antigenic relatedness to human caliciviruses, diagnosis and epidemiology | |
| Li et al. | High prevalence of rat hepatitis E virus in wild rats in China | |
| CN105567871A (en) | RT-RPA (reverse transcription recombinase polymerase amplification) detection kit for fast detecting high-pathogenicity porcine reproductive and respiratory syndrome virus and application thereof | |
| Jackwood et al. | Molecular epidemiology of infectious bursal disease viruses: distribution and genetic analysis of newly emerging viruses in the United States | |
| CN106811551A (en) | The primer pair of the type aviadenovirus of fluorescence quantitative PCR detection FAdV 4, probe, kit and method | |
| CN104328218A (en) | Nucleic acids of liquid-phase gene chip for synchronously detecting five porcine viruses and detection method thereof | |
| CN103866050B (en) | Porcine epidemic diarrhea virus fluorescent quantitative PCR detection method and primer thereof | |
| CN105695635A (en) | Multiplex RT-PCR (reverse transcription-polymerase chain reaction) detection kit for porcine epidemic diarrhea virus | |
| CN109609695A (en) | Detect the RPA-LED visualizing agent box of Porcine epidemic diarrhea virus | |
| CN105886667A (en) | Detection kit for porcine epidemic diarrhea virus and detection method thereof | |
| CN106676197A (en) | Dual fluorescence RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection method for PDCoV (porcine Delta coronavirus) and PEDV (porcine epidemic diarrhea virus) and application thereof | |
| CN108441579A (en) | The real-time fluorescent RT-PCR method for detecting and kit of Porcine epidemic diarrhea virus | |
| Pratelli | The evolutionary processes of canine coronaviruses | |
| Chauhan et al. | Isolation of bluetongue virus serotype 1 from aborted goat fetuses | |
| CN102140551A (en) | General real-time fluorescent RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) method and kit for detecting porcine reproductive and respiratory syndrome virus | |
| CN104498623B (en) | Primers for differential diagnosis of porcine epidemic diarrhea virus virulent strain and attenuated strain and detection kit thereof | |
| Qiu et al. | Simultaneous detection of classical PRRSV, highly pathogenic PRRSV and NADC30-like PRRSV by TaqMan probe real-time PCR | |
| CN103667531A (en) | FQ-PCR detection method for swine epidemic diarrhea virus (PEDV) and primer pair used therein | |
| CN106435032B (en) | Duplex RT-PCR primer, kit and method for simultaneously amplifying North American type and European type porcine reproductive and respiratory syndrome viruses | |
| CN106435020B (en) | For detecting the universal kit of different genotype infectious bronchitis virus | |
| CN109868331A (en) | The dual RT-Nested PCR primer and detection method of universal Porcine epidemic diarrhea virus and pig fourth type coronavirus and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160622 |
|
| RJ01 | Rejection of invention patent application after publication |