CN109868331A - The dual RT-Nested PCR primer and detection method of universal Porcine epidemic diarrhea virus and pig fourth type coronavirus and application - Google Patents
The dual RT-Nested PCR primer and detection method of universal Porcine epidemic diarrhea virus and pig fourth type coronavirus and application Download PDFInfo
- Publication number
- CN109868331A CN109868331A CN201910071663.5A CN201910071663A CN109868331A CN 109868331 A CN109868331 A CN 109868331A CN 201910071663 A CN201910071663 A CN 201910071663A CN 109868331 A CN109868331 A CN 109868331A
- Authority
- CN
- China
- Prior art keywords
- pig
- pdcov
- primer
- pedv
- epidemic diarrhea
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides dual Chao Shi RT-PCR primer, detection method and the kits of detection Porcine epidemic diarrhea virus and pig fourth type coronavirus.The dual Chao Shi RT-PCR primer is four pairs of primers of the highly conserved N protein sequence design according to Porcine epidemic diarrhea virus and pig fourth type coronavirus gene group.The detection method includes: extraction sample rna；Using gained sample rna as template, dual RT-Nested PCR reaction is carried out using the primer；Reaction product carries out agarose gel electrophoresis analysis.Technical solution provided by the invention can detect the case where clinical sample infection Porcine epidemic diarrhea virus and pig fourth type coronavirus simultaneously, convenient and reliable, high specificity, high sensitivity, good in anti-interference performance, and cost is relatively low compared with the detection methods such as existing nucleic acid hybridization, genetic chip, detection cycle is short, practical.
Description
Technical field
The invention belongs to molecular diagnostic techniques field, specifically a kind of universal Porcine epidemic diarrhea virus and pig fourth
The dual RT-Nested PCR primer and detection method of type coronavirus and application
Background technique
Pig epidemic diarrhea (Porcine Epidemic Diarrhea, PED) is by Porcine epidemic diarrhea virus (PEDV)
A kind of acute infectious intestinal disease of caused pig, characterized by watery diarrhoea, vomiting and dehydration.Being commonly called as winter has loose bowels disease.Its cause of disease category
In the coronal viral disease category of coronaviridae.Porcine epidemic diarrhea virus (PEDV) is pathogenic with pig fourth type coronavirus (PDCoV)
Property coronavirus, pig vomiting, diarrheal dehydration and newborn piglet can be caused dead.
PED belongs to coronaviridae (Coronavirinae) coronavirus genus (coronavirus), and genome is tool
The single strand plus RNA virus of infectious, overall length are 28000 or so, mainly include 6 ORF, and it is multiple to be followed successively by coding from 5 ' -3 '
Polyprotein 1ab (pp1ab), spike protein (S), orf protein, small membrane gene (E), membrane glycoprotein (M) and the nucleocapsid of enzyme processed
The gene of albumen (N)；
Pig fourth type coronavirus (Porcine deltacoronavirus, PDCoV) is also known as pig Delta coronavirus, is
The member of coronaviridae (Coronavirinae) δ-coronavirus genus.2010 since winter has set in, and China, pig farm, various regions takes place frequently newly
Newborn's diarrhea of pigs epidemic situation, it is considered that Porcine epidemic diarrhea virus prevalence strain is principal causative cause of disease, and discovery is another later
New hair coronavirus PDCoV may also lead to grice diarrhoea and be widely present on China pig farm.The U.S. reports pig for the first time at the beginning of 2014
The prevalence of group's disease, hereafter there is the report of the novel coronavirus at least 19 states.Novel pig enteric coronavirus virosis can draw
Sucking pig diarrhea and vomiting are played, morbidity and mortality are up to 50%-100%, and the death rate is low after grower pigs and Adult Pig infection.It is right
The sound development of pig breeding industry exerts a certain influence.
The composition of pig fourth type coronavirus gene group and arrangement are similar with other coronavirus.Its genome includes at least 7
A ORFs (open reading frame) is separately encoded four kinds of structural proteins (nucleoprotein N, small envelope protein E, spike protein S and film sugar egg
White M), two kinds of non-structural proteins (NS6 and NS7 albumen) and two kinds of polyprotein (1a and 1b albumen) coronavirus be known
It is longest in the gene order length of RNA virus, but the sequence size of pig fourth type coronavirus is about 25.4kb, is all hats
Genome is the smallest in shape virus.
And above-mentioned technical problem how is solved on the basis of improving its sensibility, it is current urgent problem to be solved.
Summary of the invention
In order to solve above-mentioned technological deficiency, the present invention provides a kind of universal Porcine epidemic diarrhea virus and pig fourth type is coronal
The dual RT-Nested PCR primer and detection method of virus and application；Have the characteristics that high specificity, high sensitivity in this method,
Suitable for any laboratory and base prevention and control unit at different levels, veterinary station and large, medium and small farm etc., have important practical significance.
First aspect present invention provides the dual nest of a kind of universal Porcine epidemic diarrhea virus and pig fourth type coronavirus
Formula RT-PCR primer, the primer are designed according to base sequence in Porcine epidemic diarrhea virus and pig fourth type coronavirus N gene
Four pairs of specific primers, respectively the Outside primer PEDV-O and inner primer PEDV-I of pig epidemic diarrhea；Pig fourth type is coronal
The Outside primer PDCoV-O and inner primer PDCoV-I of virus, specifically:
PEDV-O-F:GCAAACGGGTGCCATTATCTC
PEDV-O-R:GCTCACGAACAGCCACATTAC
PEDV-I-F:TTGGCATTTCTACTACCTCGGAACA
PEDV-I-R:GCCTGACGCATCAACACCTTT
PDCoV-O-F:CAGGTCCCAGAGGAAATCTTA
PDCoV-O-R:TTTGGTAGGTGGCTCATAGGT
PDCoV-I-F:TGCCAAACGCAACCC
PDCoV-I-R:CAGCCATACCCGTCTTCT
Second aspect of the present invention provides the dual nido RT- of universal Porcine epidemic diarrhea virus and pig fourth type coronavirus
PCR detection method includes the following steps:
(1), sample to be tested RNA is extracted using Trizol RNA extracting solution；
(2), first round PCR amplification: the RNA extracted using S1 carries out first round PCR expansion as template, using above-mentioned Outside primer
Increase, agarose gel electrophoresis analysis is carried out to pcr amplification product, if amplifying 996bp (as Porcine epidemic diarrhea virus)
And/or the purpose band of 665bp (as pig fourth type coronavirus) size then proves the positive, is otherwise feminine gender；
(3), the second wheel PCR amplification: with 50 times of the dilution of the pcr amplification product of the first round feminine gender for template, using above-mentioned interior
Side primer carries out the second wheel PCR amplification, agarose gel electrophoresis analysis is carried out to pcr amplification product, if amplifying 749bp
The purpose band of (i.e. Porcine epidemic diarrhea virus) and/or 344bp (i.e. pig fourth type coronavirus) size, then prove the sample
In there are Porcine epidemic diarrhea virus and/or pig fourth type coronavirus.
Further, in the step (2), PCR reaction system are as follows: 2 × 1Step Buffer12.5 μ l,
PrimeScript 1Step Enzyme Mix 1 μ l, primer 20 μm of ol/LPEDV-O-F and PEDV-O-F, PDCoV-O-F and
Each 1 μ l of 1 μ l, RNA template of PDCoV-O-R, adds RNase Free dH2O to 25 μ l.
Further, in the step (2), the reaction condition of PCR are as follows: 50 DEG C of reverse transcription 30min, 94 DEG C of initial denaturations
2min, 94 DEG C of denaturation 30s, 54 DEG C of annealing 30s, 72 DEG C of extension 1min, 32 recycle, 72 DEG C of extension 8min.
Further, in the step (3), PCR reaction system are as follows: 12.5 μ l of Mix, 0 μm of ol/L PEDV-I- of primer 2
F, PEDV-I-R and each 1 μ l of PDCoV-I-F, PDCoV-I-R, 1 μ l of template add RNase Free dH2O to 25 μ l.
Further, in the step (3), the reaction condition of PCR are as follows: 94 DEG C of initial denaturation 2min, 98 DEG C of denaturation 30s, 56
DEG C annealing 30s, 72 DEG C of extensions 50s, 32 recycle, 72 DEG C of extension 8min.
Third aspect present invention protects application of the primer in kit described in first aspect；
Further, when being applied in kit: it further include amplifing reagent, positive control and negative control in kit,
The positive control is the recombination matter containing Porcine epidemic diarrhea virus 996bp and pig fourth type coronavirus 665bp genetic fragment
Grain, the negative control are RNase-free water.
A kind of dual RT-Nested PCR primer of universal Porcine epidemic diarrhea virus and pig fourth type coronavirus of the present invention
And detection method and application, its advantage is that:
1, dual RT-Nested PCR detection primer provided by the present invention is respectively for Porcine epidemic diarrhea virus and pig
4 pairs of specific primers that base sequence in the N gene of fourth type coronavirus is designed have and are directed to Porcine epidemic diarrhea virus
With the specificity of pig fourth type coronavirus；
2, detection method provided by the invention can reach 10 for the minimum copy number of existing popular strain detection1A quantity
Grade, the minimum copy number of PEDV are 1.2 × 101, the minimum copy number of PDCoV is 1.3 × 101, than regular-PCR detection method sensitivity
The high 2-3 order of magnitude.Using using Trizol RNA extracting solution to extract sample to be tested RNA, cell knot can be not only destroyed rapidly
Structure, moreover it is possible to guarantee that RNA's is complete, improve the reliability of testing result.And this method is suitable for serum, the stomach and intestine of pig to be checked
Road and its content, the samples such as heart, kidney, lymph node, therefore the detection method are suitable for any laboratory and base is at different levels
Prevention and control unit, veterinary station and large, medium and small farm etc.；
3, method provided by the invention has the characteristics that high specificity, high sensitivity, practical, overcomes regular-PCR
The problems such as detection sensitivity is low, poor specificity, and cost is relatively low, detection cycle is short.
Detailed description of the invention
Fig. 1 is the gel electrophoresis figure of dual RT-Nested PCR Outside primer and inner primer specific detection；
Fig. 2 is the gel electrophoresis figure of dual RT-Nested PCR Outside primer specific detection, and wherein M is DL2000DNA
Marker；1 is recombination positive plasmid；2-6 is respectively porcine reproductive and respiratory syndrome (PRRSV), transmissible gastro-enteritis virus
(TGEV), porcine rotavirus (PoRV), porcine pseudorabies virus (PRV), Escherichia coli and staphylococcus aureus；7 be negative right
According to (RNase-free water).
Fig. 3 is the gel electrophoresis figure of dual RT-Nested PCR inner primer specific detection, M DL2000DNA
Marker；1 is recombination positive plasmid；2-6 is respectively porcine reproductive and respiratory syndrome (PRRSV), transmissible gastro-enteritis virus
(TGEV), porcine rotavirus (PoRV), porcine pseudorabies virus (PRV), Escherichia coli and staphylococcus aureus；7 be negative right
According to (RNase-free water).
Fig. 4 is the gel electrophoresis figure of dual RT-Nested PCR Outside primer sensitivity Detection, M DL2000DNA
Marker；PEDV template copy numbers are followed successively by 1.2 × 10 in 1-87, 1.2 × 106, 1.2 × 105, 1.2 × 104, 1.2 × 103,
1.2×102, 1.2 × 101, 1.2；PDCoV template copy numbers are followed successively by 1.3 × 10 in 1-87, 1.3 × 106, 1.3 × 105, 1.3
×104, 1.3 × 103, 1.3 × 102, 1.3 × 101, 1.3.
Fig. 5 is the gel electrophoresis figure of dual RT-Nested PCR inner primer sensitivity Detection, M DL2000DNA
Marker；1-8 is respectively using first time PCR product as corresponding template；PEDV template copy numbers are followed successively by 1.2 × 10 in 1-87, 1.2
×106, 1.2 × 105, 1.2 × 104, 1.2 × 103, 1.2 × 102, 1.2 × 101, 1.2；PDCoV template copy numbers are successively in 1-8
It is 1.3 × 107, 1.3 × 106, 1.3 × 105, 1.3 × 104, 1.3 × 103, 1.3 × 102, 1.3 × 101, 1.3.
Fig. 6 is the gel electrophoresis figure of dual RT-Nested PCR primer interference detection, and M is DL2000DNA Marker, and 1 is
Outside primer expands mixed genome, and 2-6 is negative control (RNase-free water).
Fig. 7 is the gel electrophoresis figure of dual RT-Nested PCR primer interference detection, and M is DL2000DNA Marker, and 1 is
Inner primer expands mixed genome, and 2-6 is negative control (RNase-free water).
Specific embodiment
Below in conjunction with embodiment, the present invention will be further described, but is not to limit the scope of the invention, and only makees
It illustrates.
Embodiment 1: the foundation of Porcine epidemic diarrhea virus and the dual RT-Nested PCR detection method of pig fourth type coronavirus
(1) design of Porcine epidemic diarrhea virus and the dual RT-Nested PCR primer of pig fourth type coronavirus
Four pairs of specificity are designed according to base sequence in Porcine epidemic diarrhea virus and pig fourth type coronavirus N gene respectively
The sequence of primer, four pairs of primers is respectively as follows:
PEDV-O-F:GCAAACGGGTGCCATTATCTC
PEDV-O-R:GCTCACGAACAGCCACATTAC
PEDV-I-F:TTGGCATTTCTACTACCTCGGAACA
PEDV-I-R:GCCTGACGCATCAACACCTTT
PDCoV-O-F:CAGGTCCCAGAGGAAATCTTA
PDCoV-O-R:TTTGGTAGGTGGCTCATAGGT
PDCoV-I-F:TGCCAAACGCAACCC
PDCoV-I-R:CAGCCATACCCGTCTTCT
(2) sampling is extracted with RNA
A: sample collection: collecting sample serum, and 3000r/min is centrifuged 30 minutes, and 200 μ L is taken to extract using Trizol RNA
Liquid extracts RNA, and measurement concentration is spare.
B: it tissue sample processing: is extracted after taking the stomach and its content of pig to be detected using Trizol RNA extracting solution
RNA, measurement concentration are spare.
(3) PCR amplification and electrophoresis detection
A: first time PCR amplification is carried out with outside detection primer PEDV-O, PDCoV-O.PCR reaction system are as follows: 2 ×
12.5 μ l, PrimeScript 1Step EnzymeMix of 1Step Buffer 1 μ l, the PEDV-O-F and PEDV- of 20 μm of ol/L
Each 1 μ l of 1 μ l, RNA template of O-R, PDCoV-O-F and PDCoV-O-R, adds RNase Free dH2O to 25 μ l；PCR reaction interval
Sequence are as follows: 50 DEG C of reverse transcription 30min, 94 DEG C of initial denaturation 2min, 94 DEG C of denaturation 30s, 54 DEG C of annealing 30s, 72 DEG C of extension 1min, 32
Circulation, 72 DEG C of extension 8min, PCR product carry out electrophoresis detection with 1% Ago-Gel, second are carried out if without purpose band
Secondary amplification；
B: 50 times are diluted to first time amplified production template with inside detection primer PEDV-O, PDCoV-I and is carried out second
Amplification.The best amplification condition of inner primer is as follows: Mix12.5 μ l, the PEDV-I-F and PEDV-I-R, PDCoV- of 20 μm of ol/L
Each 1 μ l of I-F and PDCoV-I-R, 1 μ l of template, adds RNase Free dH2O to 25 μ l；PCR response procedures are as follows: 94 DEG C of pre- changes
Property 2min, 98 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 50s, 32 circulations, 72 DEG C of extension 8min, PCR product is with 1%
Ago-Gel carry out electrophoresis detection.
(4) interpretation of result
Determined according to dual RT-Nested PCR amplification: detecting target stripe then in first time PCR amplification rear electrophoresis
It is reported as the positive and (detects that 996bp band is pig epidemic diarrhea, 665bp is pig fourth type coronavirus；Or it detects double
Band is while two kinds of viruses are the positive), and sample band poison amount is higher；Second of PCR amplification rear electrophoresis detects target
Band is also judged as that the positive (detects that 739bp band is pig epidemic diarrhea, 344bp is pig fourth type coronavirus；Or
Detect that double bands are while two kinds of viruses are the positive), but sample band poison amount is relatively low；It is detected after two-wheeled PCR equal
No purpose band is then reported as sample without Porcine epidemic diarrhea virus and pig fourth type coronavirus.
Embodiment 2: recombination positive plasmid pMD18-T-N building
(1) clone of N gene extracts the gene of Porcine epidemic diarrhea virus (PEDV) and pig fourth type coronavirus (PDCoV)
Group RNA expands N gene using dual RT-Nested PCR Outside primer PEDV-O and PDCoV-O using the geneome RNA as template
Part conserved sequence.PCR reaction system (25 μ l) are as follows: 2 × 1Step Buffer, 12.5 μ l, PrimeScript 1Step
The PDCoV-O-F and PDCoV-O- of Enzyme Mix 1 μ l, the primer PEDV-O-F and PEDV-O-R of 20 μm of ol/L, 20 μm of ol/L
Each each 0.5 μ l of 1 μ l, RNA template of R, adds RNase Free dH2O to 25 μ l；PCR response procedures are as follows: 50 DEG C of reverse transcriptions
30min, 94 DEG C of initial denaturation 2min, 94 DEG C of denaturation 30s, 54 DEG C of annealing 30s, 72 DEG C of extension 1min, 32 circulations, 72 DEG C extend
8min, and 50 times are diluted to first time amplified production template with inside detection primer PEDV-O, PDCoV-I and carries out second of expansion
Increase.The best amplification condition of inner primer is as follows: Mix 12.5 μ l, the PEDV-I-F and PEDV-I-R, PDCoV- of 20 μm of ol/L
Each 1 μ l of I-F and PDCoV-I-R, 1 μ l of template, adds RNase Free dH2O to 25 μ l；PCR response procedures are as follows: 94 DEG C of pre- changes
Property 2min, 98 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 50s, 32 circulation, 72 DEG C of extensions 8min, will for the first time amplification
Electrophoresis detection is carried out with 1% Ago-Gel with the PCR product of second of amplification, PCR product is in 1% Ago-Gel
Electroresis appraisal is carried out, as a result as shown in Figure 1, obtaining the specific DNA band and 1 treaty of treaty a 996bp and 665bp
The specific DNA band of 739bp and 344bp, is consistent with target DNA fragments size.
(2) pMD18-T-N positive plasmid constructs
The above-mentioned PCR product plastic recovery kit of TaKaRa company is recycled, then with the pMD18-T of TaKaRa company
Cloning vector is attached, linked system are as follows: 1 each 1.5 μ l, Solution I of μ l, PCR recovery product of pMD18-T vector
5 μ l, ddH20 1μl；Bacillus coli DH 5 alpha competent cell, the LB training of coating Amp resistance are converted after 16 DEG C of constant temperature connection 30min
It supports on base；37 DEG C of overnight incubations go out correct recon by resistance screening.
(3) pMD18-T-N positive recombinant is identified
Bacterium colony PCR identification is carried out to the positive colony selected with primer PEDV-O, PDCoV-O, identifies correct recon
It is named as pMD18-T-N.
(4) extraction of recombinant plasmid pMD18-T-N
Sequencing is identified uses the high purity plasmid of TaKaRa company is small to mention after correct recon carries out increasing bacterium with LB meat soup
Kit MiniBEST Plasmid Purification Kit extracts plasmid and measures concentration, calculates copy number.
Embodiment 3: dual RT-Nested PCR primer specificity detection
(1) specific test: extract porcine reproductive and respiratory syndrome (PRRSV), transmissible gastro-enteritis virus (TGEV),
Porcine rotavirus (PoRV), porcine pseudorabies virus (PRV), Escherichia coli and staphylococcus aureus gene group work as template, to double
Four couples of primers PEDV-O and PEDV-I, PDCoV-O used in nest type RT-PCR and PDCoV-I carry out specific detection, inspection
The specificity of four pairs of primers is tested, as a result as shown in Figure 2,3, four pairs of primers all have good specificity and higher amplification effect
Rate.
(2) sensitivity tests: 10 times of doubling dilutions to units is carried out to the positive plasmid obtained of embodiment 2 and is copied
Number chooses each dilution plasmid as template and carries out first time PCR amplification with primer PEDV-O, PDCoV-O, and PCR product is with 1%
Agarose gel detection, as a result as shown in figure 3, first time PCR amplification electrophoresis result shows that gene copy can be detected in Outside primer
Several orders of magnitude is 102, and specific amplification is good.Template primer PEDV-I, the PDCoV-I of amplified production as corresponding gradient
Second of PCR amplification is done, amplified production is detected with 1% agarose gel, as a result as shown in Figure 4,5, by dual nido RT-
PCR can be detected after expanding twice minimum 101The gene copy number of a order of magnitude.
(3) it interference test: takes equivalent to mix with the genome genome used in specific test, uses primer
Can PEDV-O and PEDV-I, PDCoV-O and PDCoV-I carry out PCR amplification respectively, examine the anti-interference of primer, from mixing
Purpose band is amplified in genomic templates, as a result as shown in Figure 6,7, four pairs of primers can amplify specifically from hybrid template
Property band, display primer anti-interference it is preferable.
(4) coincidence rate is tested: coronal to each department Porcine epidemic diarrhea virus and pig fourth type to verify dual nested primer
The sensibility of viral diagnosis is extracted the genome of the strains such as CV777, AJ1102, ZJ08, SC, CHN-HB 2014, measures dense
Copy number is calculated after degree, gradient dilution to units copy number, after the amplification of two-wheeled RT-Nested PCR, all kinds of genomes are equal
It can detect 101The gene copy number of a order of magnitude, it was demonstrated that the method for the present invention is practical.
After the dual RT-Nested PCR amplification of two-wheeled, all kinds of genomes can detect 101The gene of a order of magnitude is copied
Shellfish number, it was demonstrated that the method for the present invention is practical.
Embodiment 4: dual RT-Nested PCR reliability test
1, clinical sample acquire: in November, 2018 from Hubei large-scale pig farm acquisition die of illness small pig stomach and enteron aisle and its
10 parts of content, 3000r/min is centrifuged 15 minutes, collects sample serum, extracts RNA using Trizol RNA extracting solution.
2, PCR amplification and electrophoresis detection: the step of pressing embodiment 1 (3) carries out two-wheeled PCR amplification.To the product after amplification
Electrophoresis detection is carried out, 10 parts of serum samples detect 10 parts of positives altogether, and sequencing result shows that 9 parts of positive products are pig epidemic
Diarrhea virus has 1 part for pig fourth type coronavirus, and sequencing result proves that the result of this method detection has reliability.
The foregoing is merely presently preferred embodiments of the present invention, is not intended to limit the invention, it is all in spirit of the invention and
Within principle, any modification, equivalent replacement, improvement and so on be should all be included in the protection scope of the present invention.
Claims (8)
1. the dual RT-Nested PCR primer of universal Porcine epidemic diarrhea virus and pig fourth type coronavirus, it is characterised in that:
The primer designs four pairs of specificity according to base sequence in Porcine epidemic diarrhea virus and pig fourth type coronavirus N gene and draws
Object, respectively the Outside primer PEDV-O and inner primer PEDV-I of pig epidemic diarrhea；Draw on the outside of pig fourth type coronavirus
Object PDCoV-O and inner primer PDCoV-I, specifically:
PEDV-O-F:GCAAACGGGTGCCATTATCTC
PEDV-O-R:GCTCACGAACAGCCACATTAC
PEDV-I-F:TTGGCATTTCTACTACCTCGGAACA
PEDV-I-R:GCCTGACGCATCAACACCTTT
PDCoV-O-F:CAGGTCCCAGAGGAAATCTTA
PDCoV-O-R:TTTGGTAGGTGGCTCATAGGT
PDCoV-I-F:TGCCAAACGCAACCC
PDCoV-I-R:CAGCCATACCCGTCTTCT
2. the dual RT-Nested PCR detection method of universal Porcine epidemic diarrhea virus and fourth type coronavirus, feature exist
In, comprising the following steps:
(1), sample to be tested RNA is extracted using Trizol RNA extracting solution；
(2), first round PCR amplification: the RNA extracted using S1 carries out the first round as template, using Outside primer described in claim 1
PCR amplification carries out agarose gel electrophoresis analysis to pcr amplification product, if amplifying the mesh of 996bp and/or 665bp size
Band then prove the positive, be otherwise feminine gender；
(3), the second wheel PCR amplification: 50 times are diluted for template with the pcr amplification product of first round feminine gender, utilizes claim 1 institute
It states inner primer and carries out the second wheel PCR amplification, agarose gel electrophoresis analysis is carried out to pcr amplification product, if amplified
The purpose band of 749bp and/or 344bp size then proves that there are Porcine epidemic diarrhea virus and/or pig fourth types in the sample
Coronavirus.
3. method according to claim 2, it is characterised in that: in the step (2), PCR reaction system are as follows: 2 × 1Step
12.5 μ l, PrimeScript 1Step Enzyme Mix of Buffer 1 μ l, primer 20 μm of ol/L PEDV-O-F and PEDV-O-
F, each 1 μ l of 1 μ l, RNA template of PDCoV-O-F and PDCoV-O-R, adds RNase Free dH2O to 25 μ l.
4. method according to claim 2, it is characterised in that: in the step (2), the reaction condition of PCR are as follows: 50 DEG C of reversions
30min is recorded, 94 DEG C of initial denaturation 2min, 94 DEG C of denaturation 30s, 54 DEG C of annealing 30s, 72 DEG C of extension 1min, 32 circulations, 72 DEG C extend
8min。
5. method according to claim 2, it is characterised in that: in the step (3), PCR reaction system are as follows: 12.5 μ of Mix
L, primer 20 μm of ol/L PEDV-I-F, PEDV-I-R and each 1 μ l of PDCoV-I-F, PDCoV-I-R, 1 μ l of template add RNase
Free dH2O to 25 μ l.
6. method according to claim 2, it is characterised in that: in the step (3), the reaction condition of PCR are as follows: 94 DEG C of pre- changes
Property 2min, 98 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 50s, 32 circulation, 72 DEG C of extension 8min.
7. the dual RT-Nested PCR primer of universal Porcine epidemic diarrhea virus described in claim 1 and pig fourth type coronavirus
Application in kit.
8. kit according to claim 7 further includes amplifing reagent, positive control and negative control, the positive control
For the recombinant plasmid containing Porcine epidemic diarrhea virus 996bp and pig fourth type coronavirus 665bp genetic fragment, the feminine gender is right
According to for RNase-free water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910071663.5A CN109868331B (en) | 2019-01-25 | 2019-01-25 | Dual nested RT-PCR (reverse transcription-polymerase chain reaction) primers of universal porcine epidemic diarrhea virus and porcine coronavirus D, detection method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910071663.5A CN109868331B (en) | 2019-01-25 | 2019-01-25 | Dual nested RT-PCR (reverse transcription-polymerase chain reaction) primers of universal porcine epidemic diarrhea virus and porcine coronavirus D, detection method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109868331A true CN109868331A (en) | 2019-06-11 |
| CN109868331B CN109868331B (en) | 2021-06-22 |
Family
ID=66918006
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910071663.5A Active CN109868331B (en) | 2019-01-25 | 2019-01-25 | Dual nested RT-PCR (reverse transcription-polymerase chain reaction) primers of universal porcine epidemic diarrhea virus and porcine coronavirus D, detection method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109868331B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109735661A (en) * | 2019-03-07 | 2019-05-10 | 长江大学 | A kind of universal Porcine epidemic diarrhea virus nested PCR detection method |
| CN110283938A (en) * | 2019-06-20 | 2019-09-27 | 华南农业大学 | A kind of dual RT-RAA detection primer group, kit and the application of PEDV and PDCoV |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105543416A (en) * | 2016-01-28 | 2016-05-04 | 北京佰鸥创投生物科技有限公司 | Double microdroplet digital PCR (Polymerase Chain Reaction) absolute quantitative detection kit for porcine epidemic diarrhea virus and transmissible gastroenteritis virus |
| CN108715906A (en) * | 2018-06-04 | 2018-10-30 | 广西大学 | Five kinds of pig enterovirus multiple RT-PCR quick detection kits and its application |
| CN108950083A (en) * | 2018-08-24 | 2018-12-07 | 河南农业大学 | The multiplex RT-PCR method of GETV, PEDV, TGEV, PDCoV and PoRV are detected simultaneously |
-
2019
- 2019-01-25 CN CN201910071663.5A patent/CN109868331B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105543416A (en) * | 2016-01-28 | 2016-05-04 | 北京佰鸥创投生物科技有限公司 | Double microdroplet digital PCR (Polymerase Chain Reaction) absolute quantitative detection kit for porcine epidemic diarrhea virus and transmissible gastroenteritis virus |
| CN108715906A (en) * | 2018-06-04 | 2018-10-30 | 广西大学 | Five kinds of pig enterovirus multiple RT-PCR quick detection kits and its application |
| CN108950083A (en) * | 2018-08-24 | 2018-12-07 | 河南农业大学 | The multiplex RT-PCR method of GETV, PEDV, TGEV, PDCoV and PoRV are detected simultaneously |
Non-Patent Citations (2)
| Title |
|---|
| HUIXING LIN ET AL.: "Epidemic strain YC2014 of porcine epidemic diarrhea virus could provide piglets against homologous challenge", 《VIROLOGY JOURNAL》 * |
| 陈小芬: "PEDV/TGEV/PDCoV快速检测方法的建立及PEDV COE基因和ORF3基因遗传变异研究", 《中国优秀硕士论文全文数据库 农业科技辑》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109735661A (en) * | 2019-03-07 | 2019-05-10 | 长江大学 | A kind of universal Porcine epidemic diarrhea virus nested PCR detection method |
| CN110283938A (en) * | 2019-06-20 | 2019-09-27 | 华南农业大学 | A kind of dual RT-RAA detection primer group, kit and the application of PEDV and PDCoV |
| CN110283938B (en) * | 2019-06-20 | 2023-08-08 | 华南农业大学 | Dual RT-RAA detection primer set of PEDV and PDCoV, kit and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109868331B (en) | 2021-06-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Boniotti et al. | Porcine epidemic diarrhea virus and discovery of a recombinant swine enteric coronavirus, Italy | |
| CN105154589B (en) | A kind of multi-fluorescence immunoassay method of quick differentiation PEDV, TGEV, PoRV | |
| Baxi et al. | A one-step multiplex real-time RT-PCR for detection and typing of bovine viral diarrhea viruses | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| WO2018059195A1 (en) | Hrm detection primer, kit, and method for quickly identifying classical strain and variant strain of porcine epidemic diarrhea virus | |
| CN105483291B (en) | Pig Delta coronavirus, Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus multiple RT-PCR detection primer | |
| CN109536642A (en) | A kind of universal pig fourth type coronavirus RT-Nested PCR detection method | |
| CN110951916A (en) | Primer and kit for detecting SADS-CoV based on real-time fluorescent reverse transcription recombinase polymerase nucleic acid amplification technology | |
| CN107385111A (en) | The real-time fluorescence quantitative PCR detection primer and its kit of a kind of goose astrovirus | |
| CN106435023B (en) | Taqman real-time fluorescence PCR kit for detecting porcine umbilical cord blood porcine transmissible gastroenteritis virus and application thereof | |
| CN107557494A (en) | Differentiate the primer of detection diarrhea of pigs coronavirus and multiple RT PCR methods | |
| CN109609688A (en) | Goose astrovirus, goose's paramyxovirus, goose parvovirus multiple PCR detection primer pair and detection method and application | |
| WO2017219597A1 (en) | Pcr detection kit for rapidly identifying salmonella of specific serotypes | |
| CN108504778A (en) | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application | |
| Batten et al. | Infection kinetics of Epizootic Haemorrhagic Disease virus serotype 6 in Holstein-Friesian cattle | |
| CN109868331A (en) | The dual RT-Nested PCR primer and detection method of universal Porcine epidemic diarrhea virus and pig fourth type coronavirus and application | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN108342510B (en) | Multiple RT-PCR kit for BTV-11 type, 17 type, 20 type, 23 type and 24 type genotype typing identification and detection method thereof | |
| Jeong et al. | Genetic diversity of porcine sapoviruses | |
| CN110643741A (en) | Palimam serogroup virus group specificity and serotype specificity RT-PCR detection primer and kit | |
| CN107699635A (en) | Porcine epidemic diarrhea virus fluorescence RPA detection methods | |
| Park et al. | Molecular detection and characterization of unclassified bovine enteric caliciviruses in South Korea | |
| Barry et al. | High genetic diversity in RdRp gene of Brazilian porcine sapovirus strains | |
| CN105695635A (en) | Multiplex RT-PCR (reverse transcription-polymerase chain reaction) detection kit for porcine epidemic diarrhea virus | |
| CN109735661A (en) | A kind of universal Porcine epidemic diarrhea virus nested PCR detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |