CN109868331B - Dual nested RT-PCR (reverse transcription-polymerase chain reaction) primers of universal porcine epidemic diarrhea virus and porcine coronavirus D, detection method and application - Google Patents
Dual nested RT-PCR (reverse transcription-polymerase chain reaction) primers of universal porcine epidemic diarrhea virus and porcine coronavirus D, detection method and application Download PDFInfo
- Publication number
- CN109868331B CN109868331B CN201910071663.5A CN201910071663A CN109868331B CN 109868331 B CN109868331 B CN 109868331B CN 201910071663 A CN201910071663 A CN 201910071663A CN 109868331 B CN109868331 B CN 109868331B
- Authority
- CN
- China
- Prior art keywords
- porcine
- pcr
- pdcov
- pedv
- epidemic diarrhea
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention provides a dual nested RT-PCR primer, a detection method and a kit for detecting porcine epidemic diarrhea virus and porcine delta coronavirus. The dual nested RT-PCR primers are four pairs of primers designed according to highly conserved N protein sequences of porcine epidemic diarrhea virus and porcine delta coronavirus genomes. The detection method comprises the following steps: extracting sample RNA; taking the obtained sample RNA as a template, and performing double nested RT-PCR reaction by using the primers; the reaction products were analyzed by agarose gel electrophoresis. The technical scheme provided by the invention can simultaneously detect the condition that a clinical sample is infected with the porcine epidemic diarrhea virus and the porcine delta coronavirus, is convenient and reliable, has strong specificity, high sensitivity and good anti-interference performance, and has lower cost, short detection period and strong practicability compared with the existing detection methods such as nucleic acid hybridization, gene chip and the like.
Description
Technical Field
The invention belongs to the technical field of molecular diagnosis, and particularly relates to a dual nested RT-PCR primer of a universal porcine epidemic diarrhea virus and a porcine delta coronavirus, a detection method and application
Background
Porcine Epidemic Diarrheia (PED) is an acute enteric infectious disease in pigs caused by Porcine Epidemic Diarrhea Virus (PEDV) and is characterized by watery Diarrhea, vomiting and dehydration. Commonly known as winter diarrhea. The etiology belongs to the genus coronavirus of the family coronavirus. Porcine Epidemic Diarrhea Virus (PEDV) and porcine delta coronavirus (PDCoV) are pathogenic coronavirus, which can cause pig vomiting, diarrhea dehydration and newborn piglet death.
PED belongs to the genus coronaviridae (Coronavirinae) of the family coronaviridae (coronavirus), the genome of which is an infectious single-stranded positive-strand RNA virus, has a total length of about 28000, and mainly includes 6 ORFs, and genes for a polyprotein 1ab (pp1ab) encoding replicase, a spike protein (S), an ORF protein, a small membrane protein (E), a membrane glycoprotein (M), and a nucleocapsid protein (N) in this order from 5 'to 3';
porcine delta coronavirus (PDCoV), also known as Porcine deltacoronaviruses, is a member of the delta-coronavirus genus of the family coronaviridae. Since 2010 winter, pig farms in various parts of China frequently develop diarrhea epidemic situations of new piglets, the epidemic strain of the porcine epidemic diarrhea virus is generally considered as a main pathogenic pathogen, and then another new coronavirus PDCoV is found to cause diarrhea of the piglets and widely exist in the pig farms in China. The prevalence of this disease was first reported in the us at the beginning of 2014, after which at least 19 states have reported this novel coronavirus. The novel porcine intestinal coronavirus can cause diarrhea and vomiting of piglets, the morbidity and mortality rate is up to 50-100%, and the mortality rate of growing pigs and adult pigs after infection is low. Has certain influence on the healthy development of the pig industry.
The composition and arrangement of the porcine delta-coronavirus genome is similar to that of other coronaviruses. The genome of which comprises at least 7 ORFs (open reading frames) encoding four structural proteins (nucleoprotein N, small envelope protein E, spike protein S and membrane glycoprotein M), two non-structural proteins (NS6 and NS7 proteins) and two polyprotein (1a and 1b proteins), respectively, coronavirus is the longest in the length of the gene sequence of known RNA viruses, but the sequence size of swine delta coronavirus is about 25.4kb, which is the smallest genome of all coronaviruses.
How to solve the technical problems on the basis of improving the sensitivity is a problem to be solved urgently at present.
Disclosure of Invention
In order to solve the technical defects, the invention provides a dual nested RT-PCR primer of a universal porcine epidemic diarrhea virus and a porcine delta coronavirus, a detection method and application thereof; the method has the characteristics of strong specificity and high sensitivity, is suitable for various levels of prevention and control units in laboratories and basic levels, veterinary stations, large, medium and small-sized farms and the like, and has important practical significance.
The first aspect of the invention provides a dual nested RT-PCR primer of universal porcine epidemic diarrhea virus and porcine delta coronavirus, wherein the primer designs four pairs of specific primers according to the base sequences in the N genes of the porcine epidemic diarrhea virus and the porcine delta coronavirus, and the specific primers are respectively outer side primer PEDV-O and inner side primer PEDV-I of the porcine epidemic diarrhea; the outer primer PDCoV-O and the inner primer PDCoV-I of the swine T-type coronavirus specifically comprise:
PEDV-O-F：GCAAACGGGTGCCATTATCTC
PEDV-O-R：GCTCACGAACAGCCACATTAC
PEDV-I-F：TTGGCATTTCTACTACCTCGGAACA
PEDV-I-R：GCCTGACGCATCAACACCTTT
PDCoV-O-F：CAGGTCCCAGAGGAAATCTTA
PDCoV-O-R：TTTGGTAGGTGGCTCATAGGT
PDCoV-I-F：TGCCAAACGCAACCC
PDCoV-I-R：CAGCCATACCCGTCTTCT
the second aspect of the invention provides a dual nested RT-PCR detection method of universal porcine epidemic diarrhea virus and porcine delta coronavirus, which comprises the following steps:
(1) extracting the RNA of the sample to be detected by using Trizol RNA extracting solution;
(2) and performing first round PCR amplification: taking the RNA extracted by S1 as a template, performing a first round of PCR amplification by using the outer primer, and performing agarose gel electrophoresis analysis on a PCR amplification product, wherein if a target band with the size of 996bp (namely porcine epidemic diarrhea virus) and/or 665bp (namely porcine delta coronavirus) is amplified, the target band is proved to be positive, otherwise, the target band is negative;
(3) and performing second round PCR amplification: and (3) diluting the first round negative PCR amplification product by 50 times to serve as a template, performing second round PCR amplification by using the inner primer, performing agarose gel electrophoresis analysis on the PCR amplification product, and if a target band with the size of 749bp (namely porcine epidemic diarrhea virus) and/or 344bp (namely porcine epidemic coronavirus) is amplified, verifying that the porcine epidemic diarrhea virus and/or the porcine epidemic coronavirus exists in the sample.
Further, in the step (2), the PCR reaction system is: 2X 1Step buffer 12.5. mu.l, PrimeScript 1Step Enzyme Mix 1. mu.l, primers 20. mu. mol/LPEDV-O-F and PEDV-O-F, PDCoV-O-F and 1. mu.l each of PDCoV-O-R, RNA template 1. mu.l, supplemented with RNase Free dH2O to 25. mu.l.
Further, in the step (2), the reaction conditions of the PCR are: reverse transcription at 50 deg.C for 30min, pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 54 deg.C for 30s, extension at 72 deg.C for 1min, 32 cycles, and extension at 72 deg.C for 8 min.
Further, in the step (3), the PCR reaction system is: mix 12.5. mu.l, primers 20. mu. mol/L PEDV-I-F, PEDV-I-R and PDCoV-I-F, PDCoV-I-R each 1. mu.l, template 1. mu.l, supplemented with RNase Free dH2O to 25. mu.l.
Further, in the step (3), the reaction conditions of the PCR are: pre-denaturation at 94 ℃ for 2min, denaturation at 98 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 50s, 32 cycles, and extension at 72 ℃ for 8 min.
The third aspect of the invention protects the application of the primer of the first aspect in a kit;
further, when used in a kit: the kit also comprises an amplification reagent, a positive control and a negative control, wherein the positive control is a recombinant plasmid containing gene fragments of 996bp of porcine epidemic diarrhea virus and 665bp of porcine delta coronavirus, and the negative control is RNase-free water.
The invention relates to a dual nested RT-PCR primer of universal porcine epidemic diarrhea virus and porcine delta coronavirus, a detection method and application thereof, and has the advantages that:
1. the dual nested RT-PCR detection primer provided by the invention is 4 pairs of specific primers designed aiming at base sequences in N genes of the porcine epidemic diarrhea virus and the porcine delta coronavirus respectively, and has specificity aiming at the porcine epidemic diarrhea virus and the porcine delta coronavirus;
2. the detection method provided by the invention can reach the lowest copy number of 10 aiming at the detection of the existing epidemic strains1The number order, the minimum copy number of PEDV is 1.2 multiplied by 101The minimum copy number of PDCoV is 1.3 multiplied by 101And the sensitivity is 2-3 orders of magnitude higher than that of the common PCR detection method. The Trizol RNA extracting solution is used for extracting the RNA of the sample to be detected, so that the cell structure can be quickly damaged, the completeness of the RNA can be ensured, and the reliability of the detection result is improved. The method is suitable for the serum, gastrointestinal tract and contents thereof, heart, kidney, lymph node and other samples of the pig to be detected, so that the detection method is suitable for any laboratory and basic level prevention and control unit, veterinary station, large, medium and small-sized farm and the like;
3. the method provided by the invention has the characteristics of strong specificity, high sensitivity, strong practicability and the like, overcomes the problems of low sensitivity, poor specificity and the like of common PCR detection, and has the advantages of low cost and short detection period.
Drawings
FIG. 1 is a gel electrophoresis diagram of the specific detection of the outside primers and the inside primers of the dual nested RT-PCR;
FIG. 2 is a gel electrophoresis of dual nested RT-PCR lateral primer specificity detection, wherein M is DL2000DNA Marker; 1 is a recombinant positive plasmid; 2-6 are Porcine Reproductive and Respiratory Syndrome (PRRSV), transmissible gastroenteritis virus (TGEV), porcine rotavirus (PoRV), porcine pseudorabies virus (PRV), Escherichia coli and Staphylococcus aureus, respectively; negative control (RNase-free water) 7.
FIG. 3 is a gel electrophoresis diagram of the dual nested RT-PCR inner primer specificity detection, M is DL2000DNA Marker; 1 is a recombinant positive plasmid; 2-6 are Porcine Reproductive and Respiratory Syndrome (PRRSV), transmissible gastroenteritis virus (TGEV), porcine rotavirus (PoRV), porcine pseudorabies virus (PRV), Escherichia coli and Staphylococcus aureus, respectively; negative control (RNase-free water) 7.
FIG. 4 is a gel electrophoresis of the sensitivity detection of the outside primers of the dual nested RT-PCR, M is DL2000DNA Marker; copy of PEDV template in 1-8The number is 1.2 × 107，1.2×106，1.2×105，1.2×104，1.2×103，1.2×102，1.2×1011.2; 1-8 PDCoV template copy number is 1.3 multiplied by 10 in sequence7，1.3×106，1.3×105，1.3×104，1.3×103，1.3×102，1.3×101，1.3。
FIG. 5 is a gel electrophoresis of the double nested RT-PCR inner primer sensitivity detection, M is DL2000DNA Marker; 1-8 respectively taking the first PCR product as a corresponding template; the copy number of the PEDV template in the 1-8 is 1.2 multiplied by 10 in sequence7，1.2×106，1.2×105，1.2×104，1.2×103，1.2×102，1.2×1011.2; 1-8 PDCoV template copy number is 1.3 multiplied by 10 in sequence7，1.3×106，1.3×105，1.3×104，1.3×103，1.3×102，1.3×101，1.3。
FIG. 6 is a gel electrophoresis diagram of the interference detection of the dual nested RT-PCR primers, wherein M is DL2000DNA Marker, 1 is the mixed genome amplified by the outer primer, and 2-6 is the negative control (RNase-free water).
FIG. 7 is the gel electrophoresis of the interference detection of the dual nested RT-PCR primers, wherein M is DL2000DNA Marker, 1 is the mixed genome amplified by the inner primer, and 2-6 is the negative control (RNase-free water).
Detailed Description
The present invention will be further described with reference to the following examples, which are not intended to limit the scope of the present invention, but are merely illustrative.
Example 1: establishment of dual nested RT-PCR detection method for porcine epidemic diarrhea virus and porcine delta coronavirus
(1) Design of dual nested RT-PCR primers for porcine epidemic diarrhea virus and porcine coronavirus D
Respectively designing four pairs of specific primers according to base sequences in N genes of the porcine epidemic diarrhea virus and the porcine delta coronavirus, wherein the sequences of the four pairs of primers are respectively as follows:
PEDV-O-F：GCAAACGGGTGCCATTATCTC
PEDV-O-R：GCTCACGAACAGCCACATTAC
PEDV-I-F：TTGGCATTTCTACTACCTCGGAACA
PEDV-I-R：GCCTGACGCATCAACACCTTT
PDCoV-O-F：CAGGTCCCAGAGGAAATCTTA
PDCoV-O-R：TTTGGTAGGTGGCTCATAGGT
PDCoV-I-F：TGCCAAACGCAACCC
PDCoV-I-R：CAGCCATACCCGTCTTCT
(2) sampling and RNA extraction
A: collecting samples: sample serum was collected, centrifuged at 3000r/min for 30 minutes, 200. mu.L of RNA was extracted using Trizol RNA extract, and the concentration was measured for future use.
B: tissue sample treatment: taking intestines and stomach and contents of a pig to be detected, extracting RNA by using Trizol RNA extracting solution, and measuring the concentration for later use.
(3) PCR amplification and electrophoresis detection
A: a first PCR amplification was performed with the outer detection primer PEDV-O, PDCoV-O. The PCR reaction system is as follows: 2X 1Step Buffer 12.5. mu.l, PrimeScript 1Step enzyme mix 1. mu.l, 20. mu. mol/L PEDV-O-F and PEDV-O-R, PDCoV-O-F and PDCoV-O-R each 1. mu.l, RNA template 1. mu.l, supplemented with RNase Free dH2O to 25 μ l; the PCR reaction program is: reverse transcription is carried out for 30min at 50 ℃, pre-denaturation is carried out for 2min at 94 ℃, denaturation is carried out for 30s at 94 ℃, annealing is carried out for 30s at 54 ℃, extension is carried out for 1min at 72 ℃, 32 cycles are carried out, extension is carried out for 8min at 72 ℃, a PCR product is subjected to electrophoresis detection by 1% agarose gel, and secondary amplification is carried out if no target band exists;
b: the second amplification was performed by 50-fold dilution of the first amplification product template with the inner detection primer PEDV-O, PDCoV-I. The optimal amplification conditions for the inner primer are as follows: mu.l of Mix12.5. mu.l, 1. mu.l each of 20. mu. mol/L PEDV-I-F, PEDV-I-R, PDCoV-I-F and PDCoV-I-R, template 1. mu.l, supplemented with RNase Free dH2O to 25 μ l; the PCR reaction program is: pre-denaturation at 94 ℃ for 2min, denaturation at 98 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 50s, 32 cycles, extension at 72 ℃ for 8min, and electrophoresis detection of PCR products by using 1% agarose gel.
(4) Analysis of results
Judging according to the double nested RT-PCR amplification result: after the first PCR amplification, the electrophoresis detects a target strip and reports the target strip as positive (detecting a 996bp strip is porcine epidemic diarrhea, 665bp is porcine delta coronavirus, or detecting double strips is positive simultaneously for the two viruses), and the sample has higher toxic quantity; after the second PCR amplification, the target strip detected by electrophoresis is also judged to be positive (the detected 739bp strip is porcine epidemic diarrhea, and the detected 344bp strip is porcine delta coronavirus, or the detected double strips are positive simultaneously for both viruses), but the toxic quantity of the sample is relatively low; after two PCR cycles, if no target band is detected, the sample is reported to contain no porcine epidemic diarrhea virus and no porcine delta coronavirus.
Example 2: construction of recombinant positive plasmid pMD18-T-N
(1) Cloning of the N gene to extract genome RNA of Porcine Epidemic Diarrhea Virus (PEDV) and porcine delta coronavirus (PDCoV), and amplifying partial conserved sequences of the N gene by using the genome RNA as a template and adopting double nested RT-PCR (reverse transcription-polymerase chain reaction) outer primers PEDV-O and PDCoV-O. The PCR reaction (25. mu.l) was: 2X 1Step Buffer 12.5. mu.l, PrimeScript 1Step Enzyme Mix 1. mu.l, 20. mu. mol/L primers PEDV-O-F and PEDV-O-R, 20. mu. mol/L PDCoV-O-F and PDCoV-O-R each 1. mu.l, 0.5. mu.l each of RNA template, supplemented with RNase Free dH2O to 25 μ l; the PCR reaction program is: reverse transcription is carried out for 30min at 50 ℃, pre-denaturation is carried out for 2min at 94 ℃, denaturation is carried out for 30s at 94 ℃, annealing is carried out for 30s at 54 ℃, extension is carried out for 1min at 72 ℃, 32 cycles are carried out, extension is carried out for 8min at 72 ℃, and inner side detection primer PEDV-O, PDCoV-I is used for carrying out secondary amplification on the template of the first amplification product by 50 times dilution. The optimal amplification conditions for the inner primer are as follows: mu.l of Mix 12.5. mu.l, 1. mu.l each of 20. mu. mol/L PEDV-I-F, PEDV-I-R, PDCoV-I-F and PDCoV-I-R, 1. mu.l of template, supplemented with RNase Free dH2O to 25 μ l; the PCR reaction program is: pre-denaturing at 94 deg.c for 2min, denaturing at 98 deg.c for 30s, annealing at 56 deg.c for 30s, extending at 72 deg.c for 50s, 32 cycles, extending at 72 deg.c for 8min, electrophoresis detecting the PCR products of the first and the second amplifications in 1% agarose gel, electrophoresis identifying the PCR products in 1% agarose gel to obtain one specific DNA band of about 996bp and 665bp and 1 specific DNA band of about 996bp and 1 specific DNA band739bp and 344bp specific DNA bands, which are consistent with the size of the target DNA fragment.
(2) Construction of pMD18-T-N Positive plasmid
The PCR product is recovered by a glue recovery kit of TaKaRa company, and then is connected with a pMD18-T cloning vector of the TaKaRa company, and the connecting system is as follows: pMD18-T vector 1. mu.l, PCR recovery products 1.5. mu.l each, Solution I5. mu.l, ddH201 mu l; connecting at constant temperature of 16 ℃ for 30min, transforming escherichia coli DH5 alpha competent cells, and coating the cells on an Amp resistant LB culture medium; the correct recombinants were selected by resistance by incubation at 37 ℃ overnight.
(3) Identification of pMD18-T-N positive recombinants
Colony PCR identification is carried out on the selected positive clones by using a primer PEDV-O, PDCoV-O, and the correct recombinant is identified and named as pMD 18-T-N.
(4) Extraction of recombinant plasmid pMD18-T-N
After the correct recombinants are identified by sequencing and enriched by LB broth, plasmids are extracted by a high-purity Plasmid Purification Kit of TaKaRa company, the concentration is measured, and the copy number is calculated.
Example 3: dual nested RT-PCR primer specificity detection
(1) And (3) specificity test: extracting Porcine Reproductive and Respiratory Syndrome (PRRSV), transmissible gastroenteritis virus (TGEV), porcine rotavirus (PoRV), porcine pseudorabies virus (PRV), escherichia coli and staphylococcus aureus genomes as templates, performing specificity detection on four pairs of primers PEDV-O, PEDV-I, PDCoV-O and PDCoV-I used by the dual nested RT-PCR, and checking the specificity of the four pairs of primers, wherein the results are shown in figures 2 and 3, and the four pairs of primers have good specificity and higher amplification efficiency.
(2) And (3) sensitivity test: the positive plasmid obtained in example 2 was diluted 10-fold to single digit copy number, each diluted plasmid was selected as a template for the first PCR amplification with primer PEDV-O, PDCoV-O, the PCR product was detected with 1% agarose gel, the results are shown in FIG. 3, the electrophoresis results of the first PCR amplification show that the outside primer can detect gene copy number of 10 orders of magnitude2And amplifyingThe specificity is good. The amplification product is used as a template of a corresponding gradient, the second PCR amplification is carried out by using a primer PEDV-I, PDCoV-I, the amplification product is detected by using 1% agarose gel, the result is shown in figures 4 and 5, and the lowest 10 can be detected after the amplification is carried out twice by double nested RT-PCR1An order of magnitude gene copy number.
(3) Interference test: the genome used in the specificity test and the genome are mixed in equal amount, primers PEDV-O, PEDV-I, PDCoV-O and PDCoV-I are used for PCR amplification respectively, the anti-interference performance of the primers is checked, whether a target band can be amplified from a mixed genome template is detected, the result is shown in figures 6 and 7, four pairs of primers can amplify a specific band from the mixed template, and the anti-interference performance of the primers is better.
(4) And (3) a coincidence rate test: in order to verify the sensitivity of the dual nested primers to the detection of porcine epidemic diarrhea viruses and porcine delta-coronavirus in various regions, genomes of strains such as CV777, AJ1102, ZJ08, SC, CHN-HB 2014 and the like are extracted, copy numbers are calculated after concentration determination, the copy numbers are diluted in a gradient mode to single-digit copy numbers, and after two rounds of nested RT-PCR amplification, 10 can be detected from various genomes1The gene copy number of the order of magnitude proves that the method is feasible.
After two rounds of double nested RT-PCR amplification, 10 genes can be detected from various genomes1The gene copy number of the order of magnitude proves that the method is feasible.
Example 4: dual nested RT-PCR reliability test
1. Collecting clinical samples: collecting 10 parts of stomach, intestinal tract and contents of the dead piglet from a large-scale pig farm in Hubei in 2018 and 11 months, centrifuging for 15 minutes at 3000r/min, collecting sample serum, and extracting RNA by using Trizol RNA extracting solution.
2. PCR amplification and electrophoresis detection: two rounds of PCR amplification were performed as in step (3) of example 1. And (3) carrying out electrophoresis detection on the amplified products, detecting 10 positive products by 10 serum samples, and showing that 9 positive products are porcine epidemic diarrhea viruses and 1 positive product is porcine delta coronavirus by a sequencing result, wherein the sequencing result proves that the detection result of the method has reliability.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Claims (8)
1. The dual nested RT-PCR primer of the universal porcine epidemic diarrhea virus and the porcine delta coronavirus is characterized in that: the primers are designed into four pairs of specific primers according to base sequences in N genes of the porcine epidemic diarrhea virus and the porcine delta coronavirus, namely an outer primer PEDV-O and an inner primer PEDV-I of the porcine epidemic diarrhea; the outer primer PDCoV-O and the inner primer PDCoV-I of the swine T-type coronavirus specifically comprise:
PEDV-O-F：GCAAACGGGTGCCATTATCTC
PEDV-O-R：GCTCACGAACAGCCACATTAC
PEDV-I-F：TTGGCATTTCTACTACCTCGGAACA
PEDV-I-R：GCCTGACGCATCAACACCTTT
PDCoV-O-F：CAGGTCCCAGAGGAAATCTTA
PDCoV-O-R：TTTGGTAGGTGGCTCATAGGT
PDCoV-I-F：TGCCAAACGCAACCC
PDCoV-I-R：CAGCCATACCCGTCTTCT。
2. the dual nested RT-PCR detection method for the universal porcine epidemic diarrhea virus and the T-type coronavirus is characterized by comprising the following steps of:
(1) extracting the RNA of the sample to be detected by using TrizolRNA extracting solution;
(2) and performing first round PCR amplification: performing a first round of PCR amplification by using the RNA extracted in S1 as a template and the outer primer of claim 1, and performing agarose gel electrophoresis analysis on the PCR amplification product, wherein if a target band with the size of 996bp and/or 665bp is amplified, the target band is positive, and if not, the target band is negative;
(3) and performing second round PCR amplification: taking the first round negative PCR amplification product diluted by 50 times as a template, carrying out second round PCR amplification by using the inner primer of claim 1, carrying out agarose gel electrophoresis analysis on the PCR amplification product, and if a target band with the size of 749bp and/or 344bp is amplified, verifying that the porcine epidemic diarrhea virus and/or the porcine delta coronavirus exists in the sample;
this method is not used for diagnosis and treatment of disease.
3. The method of claim 2, further comprising: in the step (2), the PCR reaction system is as follows: 2X 1Step Buffer 12.5. mu.l, PrimeScript 1Step Enzyme Mix 1. mu.l, primers 20. mu. mol/L PEDV-O-F and PEDV-O-R, PDCoV-O-F and 1. mu.l each of PDCoV-O-R, RNA template 1. mu.l, supplemented with RNase Free dH2O to 25. mu.l.
4. The method of claim 2, further comprising: in the step (2), the reaction conditions of PCR are as follows: reverse transcription at 50 deg.C for 30min, pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 54 deg.C for 30s, extension at 72 deg.C for 1min, 32 cycles, and extension at 72 deg.C for 8 min.
5. The method of claim 2, further comprising: in the step (3), the PCR reaction system is as follows: mix 12.5. mu.l, primers 20. mu. mol/L PEDV-I-F, PEDV-I-R and PDCoV-I-F, PDCoV-I-R each 1. mu.l, template 1. mu.l, supplemented with RNase Free dH2O to 25. mu.l.
6. The method of claim 2, further comprising: in the step (3), the reaction conditions of PCR are as follows: pre-denaturation at 94 ℃ for 2min, denaturation at 98 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 50s, 32 cycles, and extension at 72 ℃ for 8 min.
7. The use of the universal porcine epidemic diarrhea virus and porcine epidemic coronavirus dual nested RT-PCR primers of claim 1 in the preparation of a kit.
8. The use of claim 7, wherein the kit further comprises an amplification reagent, a positive control and a negative control, the positive control is a recombinant plasmid containing gene fragments of 996bp of porcine epidemic diarrhea virus and 665bp of porcine delta coronavirus, and the negative control is RNase-free water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910071663.5A CN109868331B (en) | 2019-01-25 | 2019-01-25 | Dual nested RT-PCR (reverse transcription-polymerase chain reaction) primers of universal porcine epidemic diarrhea virus and porcine coronavirus D, detection method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910071663.5A CN109868331B (en) | 2019-01-25 | 2019-01-25 | Dual nested RT-PCR (reverse transcription-polymerase chain reaction) primers of universal porcine epidemic diarrhea virus and porcine coronavirus D, detection method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109868331A CN109868331A (en) | 2019-06-11 |
| CN109868331B true CN109868331B (en) | 2021-06-22 |
Family
ID=66918006
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910071663.5A Active CN109868331B (en) | 2019-01-25 | 2019-01-25 | Dual nested RT-PCR (reverse transcription-polymerase chain reaction) primers of universal porcine epidemic diarrhea virus and porcine coronavirus D, detection method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109868331B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109735661A (en) * | 2019-03-07 | 2019-05-10 | 长江大学 | A kind of universal Porcine epidemic diarrhea virus nested PCR detection method |
| CN110283938B (en) * | 2019-06-20 | 2023-08-08 | 华南农业大学 | Dual RT-RAA detection primer set of PEDV and PDCoV, kit and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105543416A (en) * | 2016-01-28 | 2016-05-04 | 北京佰鸥创投生物科技有限公司 | Double microdroplet digital PCR (Polymerase Chain Reaction) absolute quantitative detection kit for porcine epidemic diarrhea virus and transmissible gastroenteritis virus |
| CN108715906A (en) * | 2018-06-04 | 2018-10-30 | 广西大学 | Five kinds of pig enterovirus multiple RT-PCR quick detection kits and its application |
| CN108950083A (en) * | 2018-08-24 | 2018-12-07 | 河南农业大学 | The multiplex RT-PCR method of GETV, PEDV, TGEV, PDCoV and PoRV are detected simultaneously |
-
2019
- 2019-01-25 CN CN201910071663.5A patent/CN109868331B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105543416A (en) * | 2016-01-28 | 2016-05-04 | 北京佰鸥创投生物科技有限公司 | Double microdroplet digital PCR (Polymerase Chain Reaction) absolute quantitative detection kit for porcine epidemic diarrhea virus and transmissible gastroenteritis virus |
| CN108715906A (en) * | 2018-06-04 | 2018-10-30 | 广西大学 | Five kinds of pig enterovirus multiple RT-PCR quick detection kits and its application |
| CN108950083A (en) * | 2018-08-24 | 2018-12-07 | 河南农业大学 | The multiplex RT-PCR method of GETV, PEDV, TGEV, PDCoV and PoRV are detected simultaneously |
Non-Patent Citations (2)
| Title |
|---|
| Epidemic strain YC2014 of porcine epidemic diarrhea virus could provide piglets against homologous challenge;Huixing Lin et al.;《Virology Journal》;20160422;1-7 * |
| PEDV/TGEV/PDCoV快速检测方法的建立及PEDV COE基因和ORF3基因遗传变异研究;陈小芬;《中国优秀硕士论文全文数据库 农业科技辑》;20170315;D050-496 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109868331A (en) | 2019-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hu et al. | Development of a one-step RT-PCR assay for detection of pancoronaviruses (α-, β-, γ-, and δ-coronaviruses) using newly designed degenerate primers for porcine and avianfecal samples | |
| WO2018059195A1 (en) | Hrm detection primer, kit, and method for quickly identifying classical strain and variant strain of porcine epidemic diarrhea virus | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN111996191A (en) | Primer group and kit for simultaneously identifying African swine fever wild strain and gene deletion strain based on multiple qPCR technology | |
| CN110951916A (en) | Primer and kit for detecting SADS-CoV based on real-time fluorescent reverse transcription recombinase polymerase nucleic acid amplification technology | |
| CN107988340B (en) | PCR amplification primer for rapidly detecting mycoplasma ovipneumoniae and application thereof | |
| CN106435023B (en) | Taqman real-time fluorescence PCR kit for detecting porcine umbilical cord blood porcine transmissible gastroenteritis virus and application thereof | |
| CN109868331B (en) | Dual nested RT-PCR (reverse transcription-polymerase chain reaction) primers of universal porcine epidemic diarrhea virus and porcine coronavirus D, detection method and application | |
| CN110904270A (en) | Multiplex RT-PCR detection method for porcine delta coronavirus, porcine epidemic diarrhea virus and porcine sapelovirus and application | |
| CN113528708A (en) | Triple PCR detection method for simultaneously detecting three feline diarrhea viruses and application thereof | |
| CN108342510B (en) | Multiple RT-PCR kit for BTV-11 type, 17 type, 20 type, 23 type and 24 type genotype typing identification and detection method thereof | |
| CN110305975B (en) | RPA kit for rapidly detecting mycoplasma synoviae and application thereof | |
| CN113584227A (en) | Nested PCR detection primer group and method for identifying African swine fever gene deletion strain | |
| CN112662821A (en) | Fluorescent probe primer combination, kit and application of porcine epidemic diarrhea virus M gene | |
| CN111471802A (en) | Porcine delta coronavirus rapid detection primer, kit and application thereof | |
| CN107236827B (en) | Kit and method for detecting transmissible gastroenteritis virus of swine | |
| CN115896348A (en) | Primer and probe for dual TaqMan fluorescent quantitative PCR (polymerase chain reaction) of canine distemper virus and canine coronavirus and application of primer and probe | |
| LU504681B1 (en) | A Universal Nested RT-PCR Detection Method for Porcine Deltacoronavirus | |
| CN108384889B (en) | Multiple RT-PCR kit for genotyping and identifying bluetongue virus and detection method thereof | |
| CN109517929B (en) | Primer group and kit for porcine circovirus detection and type2 typing | |
| CN111440902A (en) | Porcine epidemic diarrhea virus detection primer, kit and application thereof | |
| CN112877479A (en) | Primer for rapidly detecting exogenous viruses in porcine pseudorabies live vaccine and application of primer in kit | |
| LU504684B1 (en) | A Universal Nested PCR Detection Method for Porcine Epidemic Diarrhea Virus | |
| LU504683B1 (en) | A Universal Nested PCR Primer Set for Porcine Circovirus 2 and Application Thereof | |
| CN110607404B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer for porcine enterovirus G and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |