CN116904667A - Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus - Google Patents

Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus Download PDF

Info

Publication number
CN116904667A
CN116904667A CN202311144718.3A CN202311144718A CN116904667A CN 116904667 A CN116904667 A CN 116904667A CN 202311144718 A CN202311144718 A CN 202311144718A CN 116904667 A CN116904667 A CN 116904667A
Authority
CN
China
Prior art keywords
probe
primer
kit
strains
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202311144718.3A
Other languages
Chinese (zh)
Other versions
CN116904667B (en
Inventor
刘志成
勾红潮
沈海燕
张春红
乌日尼乐
聂晶晶
瞿云芝
张建峰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Animal Health of Guangdong Academy of Agricultural Sciences
Original Assignee
Institute of Animal Health of Guangdong Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Animal Health of Guangdong Academy of Agricultural Sciences filed Critical Institute of Animal Health of Guangdong Academy of Agricultural Sciences
Priority to CN202311144718.3A priority Critical patent/CN116904667B/en
Publication of CN116904667A publication Critical patent/CN116904667A/en
Application granted granted Critical
Publication of CN116904667B publication Critical patent/CN116904667B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of biology, and discloses a primer group and a probe, which comprise nucleotide sequences shown in SEQ ID NO:1-6, and a primer set consisting of FIP, BIP, F, B3, loopF and LoopB as shown in SEQ ID NO:7-8, the primer group can amplify wild strains and vaccine strains of porcine epidemic diarrhea virus, and develop fluorescent primers for the ORF3 gene conserved region of the wild strains for carrying out characteristic reaction of fluorescence, thereby realizing high-specificity and high-sensitivity rapid quantitative detection of the wild strains and vaccine strains of porcine epidemic diarrhea virus. Meanwhile, the invention also provides a kit and a method for detecting the wild strain and the vaccine strain of the porcine epidemic diarrhea virus.

Description

Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a primer group, a probe, a kit and a method for detecting wild strains and vaccine strains of porcine epidemic diarrhea viruses.
Background
Porcine epidemic diarrhea virus (Porcine Epidemic Diarrhea Virus, PEDV) is a porcine enterovirus that can cause diarrhea, vomiting, dehydration and even death in pigs. At present, PED is mainly controlled by vaccine immunization, and the use of PEDV CV777 attenuated vaccine interferes with clinical detection results, so that accurate diagnosis technology is needed to carry out differential detection and diagnosis on vaccine strains and wild strains.
At present, amplification technologies such as RT-PCR and qRT-PCR are mainly used for distinguishing PEDV wild strains from vaccine strains, but the technologies such as RT-PCR have the defects of long time, large workload, easy pollution and the like in actual operation. Therefore, the rapid, high-specificity and high-sensitivity differential diagnosis and detection method for the PEDV wild strain and the vaccine strain has important application prospect.
A loop-mediated isothermal amplification (LAMP-mediated isothermal amplification) is an isothermal nucleic acid amplification method, and is characterized in that a plurality of specific primers are designed for a plurality of regions of a target gene, and the isothermal amplification is carried out for about 15-60 minutes at 60-65 ℃ under the action of a strand displacement DNA polymerase (Bst2.0 WarmStart) for about 10 minutes 9 ～10 10 The double nucleic acid amplification has the characteristics of simple operation, strong specificity, easy detection of products and the like. LAMP primer set is generally composed of inner primers FIP (F1c+F2) and BIP (B1c+B2), outer primers F3 and B3 and loop primer LoopF/LoopB. The loop primer is designed between F1c and F2Or the primer between B1c and B2 plays a role in greatly improving the isothermal amplification efficiency on the premise of starting the LAMP normal extension reaction. LAMP has the characteristics of simple operation, quick reaction time and sensitive detection, does not need a precious fluorescent quantitative instrument, can react only by a simple heating device, and has good clinical application prospect.
Aiming at the loop-mediated isothermal amplification method, the prior art is as follows:
prior art 1: CN112553377a discloses a double fluorescent LAMP for distinguishing Marek's Disease Virus (MDV) vaccine strain from virulent strain detection primer set, comprising primer 1 to primer 8, wherein primer 7 and primer 8 are 2 Taqman probes, which make amplification reaction have very high specificity, can combine with different sites of MDV meq gene for distinguishing vaccine strain and virulent strain, and emit fluorescence of different colors under fluorescence of different wavelengths after reaction, thereby realizing rapid sensitive and specific identification of MDV vaccine strain and virulent strain.
The method mainly detects virulent strains through a primer 7, and detects vaccine strains through a primer 8.
Prior art 2: CN107034314a discloses a LAMP primer set, a kit and a method for identifying MEV wild strain and MEVB strain. The LAMP primer group comprises an outer primer pair consisting of F3 and B3 and an inner primer pair consisting of FIP and BIP. The kit comprises the LAMP primer group, a reaction mixture and DNA polymerase.
The method mainly carries out fluorescent recognition through specific amplified wild strains.
The development difficulty of the prior art 1 is high, and the number of specific fluorescent primers aiming at genes needs to be increased; the prior art 2 has large limitation, can not distinguish whether the vaccine strain is contained and the wild strain is not contained, and in fact, in the production process, the wild strain is not only needed to be identified, but also whether an identified object is immunized or infected with the wild strain should be identified.
Therefore, the technical problem solved by the scheme is as follows: how to identify wild strains and vaccine strains of porcine epidemic diarrhea virus by using 1 fluorescent probe specific to genes and one nonspecific quenching probe.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a primer group and a probe; the primer group can amplify both wild strains and vaccine strains, and a fluorescent probe is developed for ORF3 gene regions with differences between the wild strains and the vaccine strains and is used for carrying out characteristic reaction of fluorescence, so that high-specificity and high-sensitivity rapid quantitative detection of the wild strains and the vaccine strains of the porcine epidemic diarrhea viruses is realized.
Meanwhile, the invention also provides a kit and a method for detecting the wild strain and the vaccine strain of the porcine epidemic diarrhea virus.
In order to achieve the aim of the invention, the invention adopts the following technical scheme: a primer set and a probe, comprising nucleotide sequences as set forth in SEQ ID NOs: 1-6, and a primer set consisting of FIP, BIP, F, B3, loopF and LoopB as shown in SEQ ID NO:7-8 and a quenching probe, a Quencher.
In the primer group and the probe, the 5 'end of the fluorescent probe carries a fluorescent group FAM, and the 3' end does not carry a fluorescent group; the 5 '-end of the quenching probe Quencher carries a quenching group BHQ1, and the 3' -end does not carry a fluorescent group.
Compared with CN112553377A, 2 probes (fluorescent probe and quenching probe) are adopted, and each probe of CN112553377A needs to be modified at the 5 'end and the 3' end, so that the reagent complexity and development difficulty of the whole kit of CN112553377A are obviously increased. The scheme realizes luminescence by competing the target gene and the quenching probe for the fluorescent probe, and the realization difficulty is lower.
Meanwhile, the invention also provides a kit which comprises the primer group, the probe and the indicator which develops color in an acidic state.
In the above-mentioned kit, the detection system using the kit comprises: isothermal Amplification Buffer (10×) 2.5 μl, bst DNA polymerase 1 μ L, warmStarRTx 0.5 μ L, dNTPs 4 μ L, mgSO 4 1.5 mu L, FIP primer and BIP primer 4 mu L, F primer and B3 primer 0.5 mu L, loopF primer 2 mu L, loopB primer 2 mu L, fluorescent probe0.35. Mu.L of quenching probe Quencher 1. Mu. L, RNA template 1. Mu.L of ddH containing the indicator 2 O 4.65μL。
In the above kit, the indicator is cresol red.
Meanwhile, the invention also provides a method for detecting the wild strain and the vaccine strain of the porcine epidemic diarrhea virus, and the detection is carried out by adopting the kit.
In the method for detecting the wild strain and the vaccine strain of the porcine epidemic diarrhea virus, the kit is adopted for detection;
if the cresol red color is developed in the detection system, the detection system contains wild strains and/or vaccine strains of porcine epidemic diarrhea virus;
if the detection system develops color under fluorescence, the detection system is indicated to contain wild strains;
if the cresol red in the detection system develops color and does not develop color under fluorescence, the detection system does not contain wild strains and only contains vaccine strains.
Compared with the prior art, the invention has the following beneficial effects:
the invention designs a fluorescent group modified loop primer probe and a quenching probe complementary with the fluorescent group modified loop primer probe, and generates a fluorescent signal when the fluorescent group modified loop primer probe is specifically and complementarily combined; the method can realize the differentiated detection and the real-time observation of the PEDV wild strain and the vaccine strain through a fluorescent quantitative amplification instrument and a portable integrated reaction device.
As the nucleic acid is amplified along with the reaction, hydrogen ions are generated in the process, the pH value of a reaction system is reduced, and the reaction result of the PEDV wild strain and the vaccine strain is judged through the color change of the solution.
When the sample contains the nucleic acid of the PEDV wild strain, the probe can specifically combine with the template to generate a fluorescent signal, otherwise, when the probe does not specifically combine with the template, no fluorescent signal is generated, so that the method realizes the rapid and visual detection of the PEDV wild strain and the vaccine strain.
The kit provided by the invention has the advantages that the reaction is rapid, the reaction can be completed within 60min, and the reaction can be completed within 30min at the highest speed. The book is provided withThe kit provided by the invention has good specificity and has negative reaction to transmissible gastroenteritis virus (TGEV), porcine Reproductive and Respiratory Syndrome Virus (PRRSV), porcine delta coronavirus (PDCoV) and porcine rotavirus (PoRV); good sensitivity, and can be detected at least 2.2X10 3 RNA templates of PEDV wild strains and vaccine strains with the concentration of cobies/mu L are 10-100 times higher than the sensitivity of the common RT-PCR method, and the sensitivity is equivalent to that of fluorescent quantitative PCR.
The probe method real-time fluorescent quantitative RT-LAMP kit for real-time quantitative detection of the PEDV wild strain and the vaccine strain can rapidly and sensitively detect the PEDV wild strain and the vaccine strain. The kit is simple to operate, quick in reaction, easy to observe reaction results, good in specificity, capable of realizing real-time quantitative detection of the PEDV wild strain and the vaccine strain, very suitable for export quarantine, food sanitation and field detection of livestock farms, and easy to popularize and apply in a large range.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a dNTP optimization result diagram, wherein: dNTPs with different final concentrations are set, a:1.6mM; b:1.2mM; c:1mM; d:1.4mM; e:1.8mM; f:2.0mM;
fig. 2 is a graph of temperature optimization results, wherein: setting different reaction temperatures, a:65 ℃; b:59 ℃; c:60.8 ℃; d:63.9 ℃; e:64.6 ℃; f:62.5 ℃; g:58 ℃;
FIG. 3 is Mg 2+ Optimizing a result graph, wherein: mgSO with different final concentrations 4 ，a：6mM；b：8mM；c：10mM；d：12mM；e：4mM；f：14mM；
FIG. 4 is a graph of probe optimization results, wherein: probe probes at different final concentrations, a: 0.12. Mu.M; b:0.2 μm; c: 0.3. Mu.M; d: 0.4. Mu.M; e: 0.6. Mu.M; f: a negative control;
FIG. 5 is a graph of the results of a specificity test amplification curve, wherein a: wild strain of porcine epidemic diarrhea virus; b: porcine epidemic diarrhea virus vaccine strain; c: transmissible gastroenteritis virus (TGEV); d: porcine Reproductive and Respiratory Syndrome Virus (PRRSV); e: porcine rotavirus (PoRV); f: porcine delta coronavirus (PDCoV); g: a negative control;
FIG. 6 is a diagram showing the results of a portable integrated reaction apparatus for a specificity test, wherein a: wild strain of porcine epidemic diarrhea virus; b: porcine epidemic diarrhea virus vaccine strain; c: transmissible gastroenteritis virus (TGEV); d: porcine Reproductive and Respiratory Syndrome Virus (PRRSV); e: porcine rotavirus (PoRV); f: porcine delta coronavirus (PDCoV); g: a negative control;
FIG. 7 is a graph showing amplification curve results of a wild strain sensitivity test, wherein: the standard RNA of PEDV was diluted 10-fold and tested for the following copy number, a: 2.2X10 9 copies/µL；b；2.2×10 8 copies/µL；c：2.2×10 7 copies/µL；d：2.2×10 6 copies/µL；e：2.2×10 5 copies/µL；f：2.2×10 4 copies/µL；g：2.2×10 3 copies/µL；h：2.2×10 2 copies/µL；
FIG. 8 is a logarithmic versus CT standard curve;
FIG. 9 is a graph showing the results of a portable integrated reaction device for wild strain sensitivity test, wherein: the standard RNA of PEDV was diluted 10-fold and tested for the following copy number, a: 2.2X10 9 copies/µL；b；2.2×10 8 copies/µL；c：2.2×10 7 copies/µL；d：2.2×10 6 copies/µL；e：2.2×10 5 copies/µL；f：2.2×10 4 copies/µL；g：2.2×10 3 copies/µL；h：2.2×10 2 copies/µL；
FIG. 10 is a graph showing the results of a portable integrated reaction device for vaccine strain susceptibility testing, wherein: the standard RNA of PEDV was diluted 10-fold and tested for the following copy number, a: 2.2X10 9 copies/µL；b；2.2×10 8 copies/µL；c：2.2×10 7 copies/µL；d：2.2×10 6 copies/µL；e：2.2×10 5 copies/µL；f：2.2×10 4 copies/µL；g：2.2×10 3 copies/µL；h：2.2×10 2 copies/µL；
FIG. 11 is a graph showing the amplification curve of wild strain sensitivity test by qRT-PCR method, wherein: the standard RNA of PEDV was diluted 10-fold and tested for the following copy number, a: 2.2X10 9 copies/µL；b；2.2×10 8 copies/µL；c：2.2×10 7 copies/µL；d：2.2×10 6 copies/µL；e：2.2×10 5 copies/µL；f：2.2×10 4 copies/µL；g：2.2×10 3 copies/µL；h：2.2×10 2 copies/µL；
FIG. 12 is a graph showing the results of amplification curves of wild strain sensitivity tests by RT-PCR method, wherein: the standard RNA of PEDV was diluted 10-fold, and detected by the following copy numbers, wild strain a: 2.2X10 3 copies/µL；b；2.2×10 4 copies/µL；c：2.2×10 5 copies/µL；d：2.2×10 6 copies/µL；e：2.2×10 7 copies/µL；f：2.2×10 8 The copies/[ mu ] L; g: a Marker; vaccine strain h: 2.2X10 8 copies/μL；i：2.2×10 7 copies/μL；g：2.2×10 6 copies/μL；k：2.2×10 5 copies/μL；l：2.2×10 4 copies/μL；m：2.2×10 3 copies/μL；
FIG. 13 is a schematic representation of the position of the primer of the present invention on the ORF3 gene difference region of PEDV.
Detailed Description
The technical scheme of the invention is further described by the following specific embodiments. It will be apparent to those skilled in the art that the examples are merely to aid in understanding the invention and are not to be construed as a specific limitation thereof.
The specific experimental procedures or conditions are not noted in the examples and may be followed by the operations or conditions of conventional experimental procedures described in the literature in this field. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.
(1) The primer is synthesized by Shanghai biological engineering technology service limited company; bst2.0 WarmStart DNA polymerase, warmStartRTx reverse transcriptase available from New England; RNase H2 enzyme was purchased from IDT company; fluorescent quantitative PCR instrument (Roche company, cat# LightCycler 96 SW 1.1); a CFX96 Touch fluorescence quantitative PCR instrument (Bio-Rad Co., ltd., cat# Bio-Rad CFX96 Touch) was stored for this laboratory.
(2) Wild strains of porcine epidemic diarrhea virus, vaccine strains of porcine epidemic diarrhea virus, porcine rotavirus (PoRV), transmissible gastroenteritis virus (TGEV), porcine Reproductive and Respiratory Syndrome Virus (PRRSV) and porcine delta coronavirus (PDCoV) were maintained in the Guangdong national institute of animal health.
Example 1
1. Primer design
According to the primer design principle, the primer and the probe are designed by applying PrimerExplorer V5 software aiming at the sequence of the ORF3 gene wild strain and vaccine strain difference region of PEDV, the GC content of the primer is ensured to be 40% -60% according to experience, and the Tm value of each primer is about 55 ℃.
Through preliminary screening, a set of primers and probes with better theoretical values are obtained. The primer and the probe are synthesized by Shanghai Bioengineering technical service Co., ltd, and the synthesized primer and probe are diluted to 10 mu M concentration by sterilizing triple distilled water and stored at-20 ℃.
The primer set includes a pair of inner primers (FIP and BIP), 1 pair of outer primers (F3 and B3), 1 pair of loop primers (LoopF and LoopB), one fluorescent Probe primer and one quenching fluorescent Probe Quencher primer, see Table 1.
The primer positions are shown in FIG. 3, wherein FIP consists of F1c and F2, BIP consists of B1c and B2, wherein F1c is the complementary sequence of F1, and B1c, B2c and B3c are the complementary sequences of B1, B2 and B3.
TABLE 1 primer names and sequences
Primer name Sequence [ (]5’→3’）
FIP（SEQ ID NO:1） CAAAACGCGCTGCCAACATAGTTTTTATCTACTTCTTTGCACTGT
BIP（SEQ ID NO:2） CCTATATAATATATAGGACTAAACAAAGCCTGCCAAT
F3（SEQ ID NO:3） TGACGGGTTTTCTTTTCAC
B3（SEQ ID NO:4） TTTTTATAGCGCCAGGAGTA
LoopF（SEQ ID NO:5） CGCCTCAAAGAAGACGCTTTAA
LoopB（SEQ ID NO:6） TAGTTGCATCTAAAAATGCACCACA
Probe probe (SEQ ID NO: 7) FAM-CTCAGCCATCCGTTCAGTCCGTCAGGTCAGCGCCTCAAAGAAGACGCTTTAA
Quenching probe Quencher (SEQ ID NO: 8) BHQ1-CTGACCTGACGGACTGAACGGATGGCTGAG
2. Extraction of viral genomic RNA
A small amount of RNA extraction kit of Axygen company is adopted, and the total RNA template of each experimental group virus sample is extracted according to the specification of the kit and used for subsequent experiments.
3. Establishment of LAMP detection method
1. Optimization of the reaction System
Sequentially to dNTPs and MgSO 4 And optimizing the concentration ratio of the probe, and analyzing the obtained result on a fluorescence quantitative PCR instrument.
By setting different final concentrations of dNTPs:1mM,1.2mM,1.4mM,1.6mM,1.8mM,2mM, with water replacing the nucleic acid template to set up a blank (see FIG. 1); mgSO with different final concentrations 4 : 4mM, 6mM, 8mM, 10mM, 12mM, 14mM, while a blank control was set with water instead of the nucleic acid template (see FIG. 3). The detection condition is that the temperature is kept at 65 ℃ for 60min. The results are shown in FIGS. 1-3, and based on the experimental results obtained, an optimized detection system was finally determined, as shown in Table 2.
TABLE 2 amplification reaction System
Reagent(s) Usage amount (mu L) Concentration of use Final concentration
10× Isothermal Amplification Buffer 2.5 10× 1×
MgSO 4 1.5 100 mM 6mM
dNTP 4 10mM 2mM
FIP+BIP 4 10 μM 1.6μM
LoopF 2 10 μM 0.6μM
LoopB 2 10 μM 0.6μM
F3+B3 0.5 10 μM 0.2μM
Probe (Probe) 0.35 10 μM 0.12μM
Quenching probe (Quencher) 1 10 μM 0.4μM
BstDNA polymerase 1 8000U/L 320U/mL
WarmStart®aRTx 0.5 15000U/L 600U/mL
RNA 1
H 2 O 4.65 Cresol red containing indicator The concentration of the cresol red indicator in water is 16mM
Total 25
2. Optimization of reaction temperature
In order to obtain the optimal reaction temperature, the amplification reaction was placed at 58 ℃, 59 ℃, 60.8 ℃, 62.5 ℃, 63.9 ℃, 64.6 ℃ and 65 ℃ for 60min, respectively, while a blank was set by replacing the nucleic acid template with water. The optimum reaction temperature was determined from a number of replicates. The results are shown in FIG. 2, which illustrates that the optimal reaction temperature is 65 ℃.
4. Establishment of amplification detection method
1. Synthesis of probes
FAM modification is performed on the 5 'of the Probe fluorescent Probe by Shanghai Biotechnology service Co., ltd, BHQ1 modification is performed on the 5' of the Quencher quenching Probe, and synthesis is performed.
2. Optimization of probe concentration
In order to reduce the non-specificity of the Probe and ensure the detection effect, probe probes with different final concentrations are added into an amplification reaction system: 0.12. Mu.M, 0.2. Mu.M, 0.3. Mu.M, 0.4. Mu.M and 0.6. Mu.M, and then detected in a fluorescent quantitative PCR apparatus to screen for optimal Probe concentration. The amplification reaction conditions were constant at 65℃for 60min.
As a result, as shown in FIG. 4, the optimal probe concentration was finally determined to be 0.12. Mu.M.
5. Specificity and sensitivity analysis of amplification detection system
1. Specificity analysis
The genomic RNA of the wild strain of PEDV (sequence has been uploaded to GenBank, specific number: OP 191700.1), the vaccine strain of PEDV (attenuated CV777 strain), TGEV, PDCoV, PRRSV and PRoV was used as templates for the specific analysis of the detection system, while a blank control was set by replacing the nucleic acid template with water. The reaction system was prepared in accordance with the above-mentioned table 2, and the reaction conditions were the optimized conditions determined in the above-mentioned "establishment of LAMP detection method", and detection was performed using a fluorescent quantitative PCR instrument and a portable integrated reaction device.
The results of the fluorescent quantitative PCR apparatus are shown in FIG. 5: the primer amplification reaction products using the genomic RNA of the PEDV wild strain as a template show a specific curve (see a in FIG. 5), the PEDV vaccine strain, TGEV, PDCoV, PRRSV and the PRoV template show no specific curves (see b, c, d, e and f in FIG. 5), and a blank control no specific curve (see g in FIG. 5), and the amplification curve results show that the specificity of the detection system is good, and the PEDV wild strain can be specifically detected.
The results of the portable integrated reaction device are shown in fig. 6: when the portable integrated reaction device is observed under white light, primer amplification reaction products taking PEDV wild strains and vaccine strain genome RNA as templates are developed, TGEV, PRRSV, PDCoV and a PRoV template are not developed, and blank control is not developed. Only the reaction products of the PEDV wild strain genomic RNA as a template produced fluorescence when fluorescence was detected using the portable integrated reaction device, while the reaction products of the PEDV vaccine strain, TGEV, PRRSV, PRoV, PDCoV and the blank as templates did not produce fluorescence.
The specificity analysis result shows that the specificity of the detection system is good, and the detection system not only can specifically detect the PEDV, but also can identify the PEDV wild strain and the vaccine strain.
2. Sensitivity analysis
The full-length pGEM-T easy-ORF3 plasmid containing the PEDV ORF3 gene (pGEM-T easy-ORF3 plasmid is prepared by inserting a fragment of the ORF3 region of GenBank as OP191700.1 into pGEM-T easy vector) as a template, performing PCR amplification with T-start-F and PEDV-ORF3-R primers (primer sequence of T-start-F ATGTTTCTTGGACTTTTTCAATA, PEDV-ORF3-R GCGGCCGCTATGGCCTTTTGAC), purifying the PCR product containing the RNA polymerase promoter, and further performing transcription using mMESAGEmMACHINE kit as a template for in vitro transcription according to the operation instructions. After transcription, unbound nucleotides and most of proteins were removed by lithium chloride precipitation, RNA was recovered by purification, concentration of RNA template was determined to be 18.1 ng/. Mu.L by UV spectrophotometry, 10-fold gradient dilution was performed on transcribed RNA template with sterilized pure water, and 2. Mu.L of each diluted sample was subjected to LAMP amplification assay (see systems and primers shown in Table 2), ordinary RT-PCR assay (see Table 3) and fluorescent quantitative PCR assay (see Table 4).
TABLE 3 ordinary RT-PCR reaction System
The procedure for general RT-PCR was as follows: reverse transcription is carried out at 50 ℃ for 30 min; pre-denaturation at 94℃for 3 min;94 ℃ for 30s, 62 ℃ for 30s and 72 ℃ for 1min as one cycle, and 35 cycles are operated; finally, extending for 5min at 72 ℃; preserving at 4 ℃. (the Kit used for ordinary RT-PCR is Nuo Wei Zan HiScript II One Step RT-PCR Kit (cat. No.: P611-011)).
The fluorescent quantitative Real-time PCR primer is as follows:
qRT-PCR PEDV-ORF3-F：５’-ATTGCCCACTTTTATATTATTGTGG-３’
qRT-PCR PEDV-ORF3-R：５’-TGCCGCCCACGTATAGCTAGATACA-３’
qRT-PCR was performed using qRT-PCR PEDV-ORF3-F and qRT-PCR PEDV-ORF3-R as primers, and the reaction system is shown in Table 4:
TABLE 4 reaction system for fluorescent quantitative Real-time PCR
The reaction procedure for fluorescent quantitative Real-time PCR was as follows: reverse transcription at 50℃for 3 min; pre-denaturation at 95 ℃ for 30s;95 ℃ for 10 seconds, 60 ℃ 30s is one cycle, and 40 cycles are run; preserving at 4 ℃. (kit used for fluorescent quantitative Real-time PCR method is Nuo Weizan HiScript II One Step qRT-PCR SYBR Green Kit (cat. No. Q221-01)).
The sensitivity of the probe method Real-time fluorescent quantitative RT-LAMP detection method, the sensitivity of the common RT-PCR detection method and the sensitivity of the fluorescent quantitative Real-time PCR detection method are respectively compared. The results show that the sensitivity of the probe method real-time fluorescence quantitative RT-LAMP detection method is 10-100 times that of the common RT-PCR method (figures 7 and 12); compared with the fluorescent quantitative Real-time PCR detection method, the sensitivity of the probe method Real-time fluorescent quantitative RT-LAMP detection method is consistent (FIG. 7 and FIG. 11), and the sensitivity can be detected at least 2.2X10 3 copies/µL。
FIG. 8 is a standard curve of logarithmic versus CT value for RT-LAMP sensitivity test, with the abscissa being the logarithmic of copy number and the ordinate being time in minutes.
In a word, the probe method Real-time fluorescent quantitative RT-LAMP detection method provided by the invention has equal sensitivity to the fluorescent quantitative Real-time PCR detection method, but compared with the fluorescent quantitative Real-time PCR detection method, the probe method Real-time fluorescent quantitative RT-LAMP detection method has the advantages of simpler operation (isothermal reaction at 65 ℃) and shorter reaction time (only 30 min). In addition, the combination of the probe method and the real-time fluorescent quantitative RT-LAMP detection method realizes the detection of the PEDV and the distinction between the PEDV wild strain and the vaccine strain, and reduces the occurrence of nonspecific reaction.
The scheme has the following more valuable parts:
compared with the prior art 1 and the prior art 2, the invention can distinguish whether the wild strain and/or the vaccine strain is contained, whether the wild strain is contained, whether the vaccine strain is contained and whether the wild strain is not contained by only adding the pH chromogenic reagent to 1 group of fluorescent probes; especially, the latter two cases have practical significance, whether the detection object is infected or not can be judged by containing wild strains, whether the detection object is infected or not contains vaccine strains or not and whether the detection object is immune or not can be judged by not containing the wild strains, and accurate suggestions are provided for accurately judging the etiology of pig diarrhea in a farm or whether vaccine supplementing is needed.
The method can be realized through portable equipment, and real-time judgment is provided for judging whether the wild strain exists or not and whether the immunity is effective or not on the spot; in general, in the course of field testing by a portable device, it is considered that if a wild strain is present, it is an indication that the subject is not immunized. FIG. 9 is a graph showing the results of a portable integrated reaction device for wild strain sensitivity test; FIG. 10 is a graph showing the results of a portable integrated reaction device for wild strain sensitivity test; as can be seen from fig. 9 and 10, more accurate results can be obtained with the portable integrated reaction device.
Meanwhile, the method can also be used for subsequent research, and in the screening process, the sample determined to contain the wild strain can be continuously sent for detection, so as to judge whether the sample is immunized or not, and further judge whether the immune failure condition exists or not.
The invention can complete the operation by purely visual observation, combines the characteristics of both daylight color development and fluorescence color development, combines the characteristics of amplified pH change, and realizes the accurate judgment of samples.
The applicant states that the process of the invention is illustrated by the above examples, but the invention is not limited to, i.e. does not mean that the invention must be carried out in dependence on the above process steps. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of selected raw materials, addition of auxiliary components, selection of specific modes, etc. fall within the scope of the present invention and the scope of disclosure.

Claims (7)

1. A primer set and a probe, which are characterized by comprising nucleotide sequences shown in SEQ ID NO:1-6, and a primer set consisting of FIP, BIP, F, B3, loopF and LoopB as shown in SEQ ID NO:7-8 and a quenching probe, a Quencher.
2. The primer set and probe of claim 1, wherein the 5 'end of the fluorescent probe carries a fluorescent group FAM and the 5' end of the quenching probe, the Quencher, carries a quenching group BHQ1.
3. A kit comprising the primer set according to claim 1 or 2, a probe, and an indicator which develops color in an acidic state.
4. A kit according to claim 3, wherein the detection system comprising the kit comprises: isothermal Amplification Buffer (10×) 2.5 μl, bst DNA polymerase 1 μ L, warmStarRTx 0.5 μ L, dNTPs 4 μ L, mgSO 4 1.5 mu L, FIP primer and BIP primer 4 mu L, F primer and B3 primer 0.5 mu L, loopF primer 2 mu L, loopB primer 2 mu L, fluorescent probe 0.35 mu L, quenching probe Quencher 1 mu L, RNA template 1 mu L, ddH containing the indicator 2 O 4.65μL。
5. The kit of claim 3 or 4, wherein the indicator is cresol red.
6. A method for detecting wild strains and vaccine strains of porcine epidemic diarrhea virus, which is characterized by adopting the kit as claimed in claim 3 or 4.
7. The method for detecting wild strains and vaccine strains of porcine epidemic diarrhea virus according to claim 6, wherein the detection is performed using the kit according to claim 4;
if the cresol red color is developed in the detection system, the detection system contains wild strains and/or vaccine strains of porcine epidemic diarrhea virus;
if the detection system develops color under fluorescence, the detection system is indicated to contain wild strains;
if the cresol red in the detection system develops color and does not develop color under fluorescence, the detection system does not contain wild strains and only contains vaccine strains.
CN202311144718.3A 2023-09-06 2023-09-06 Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus Active CN116904667B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311144718.3A CN116904667B (en) 2023-09-06 2023-09-06 Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311144718.3A CN116904667B (en) 2023-09-06 2023-09-06 Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus

Publications (2)

Publication Number Publication Date
CN116904667A true CN116904667A (en) 2023-10-20
CN116904667B CN116904667B (en) 2023-12-19

Family

ID=88363266

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311144718.3A Active CN116904667B (en) 2023-09-06 2023-09-06 Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus

Country Status (1)

Country Link
CN (1) CN116904667B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108950087A (en) * 2018-08-30 2018-12-07 中国农业科学院兰州兽医研究所 The primer pair and probe and corresponding reagent box identified for pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR
CN110982936A (en) * 2019-12-13 2020-04-10 华南农业大学 Primer and kit for detecting PEDV by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology
CN112501359A (en) * 2021-02-07 2021-03-16 吴江近岸蛋白质科技有限公司 Primer group and kit for detecting novel coronavirus COVID-19
KR20230101589A (en) * 2021-12-29 2023-07-06 경북대학교 산학협력단 Compositions for detecting porcine epidemic diarrhea virus and method for detecting porcine epidemic diarrhea virus using the same

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108950087A (en) * 2018-08-30 2018-12-07 中国农业科学院兰州兽医研究所 The primer pair and probe and corresponding reagent box identified for pig prevalence diarrhea virus vaccines strain and street strain QRT-PCR
CN110982936A (en) * 2019-12-13 2020-04-10 华南农业大学 Primer and kit for detecting PEDV by combining centrifugal microfluidic chip with loop-mediated isothermal amplification technology
CN112501359A (en) * 2021-02-07 2021-03-16 吴江近岸蛋白质科技有限公司 Primer group and kit for detecting novel coronavirus COVID-19
KR20230101589A (en) * 2021-12-29 2023-07-06 경북대학교 산학협력단 Compositions for detecting porcine epidemic diarrhea virus and method for detecting porcine epidemic diarrhea virus using the same

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
JAE-KYEOM KIM ET AL.: "A simple colorimetric detection of porcine epidemic diarrhea virus by reverse transcription loop-mediated isothermal amplification assay using hydroxynaphthol blue metal indicator", J VIROL METHODS., vol. 298, pages 1 - 8 *
JIAN-TAO CUI ET AL.: "Characteristics of the spike and ORF3 genes of porcine epidemic diarrhea virus in Henan and Shanxi provinces of China", ARCH VIROL., vol. 165, no. 10, pages 2323 - 2333, XP037243886, DOI: 10.1007/s00705-020-04744-x *
李辉腾等: "荧光环介导恒温扩增技术检测嗜肺军团菌方法的建立", 国际检验医学杂志, vol. 38, no. 22, pages 3137 *
邵建宏等: "荧光RT-LAMP法检测猪流行性腹泻病毒方法的建立", 广东畜牧兽医科技, vol. 44, no. 2, pages 42 - 45 *
龙飞翔: "猪流行性腹泻病毒鉴别检测方法的建立及应用研究", 中国优秀硕士学位论文全文数据库 农业科技辑, pages 050 - 510 *

Also Published As

Publication number Publication date
CN116904667B (en) 2023-12-19

Similar Documents

Publication Publication Date Title
CN110760620A (en) Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method
CN107190104B (en) Five-porcine diarrhea virus multiplex real-time fluorescent quantitative PCR rapid diagnosis kit and application
CN112063764A (en) Multiplex real-time fluorescent RT-PCR primer probe composition and kit for novel coronavirus nucleic acid detection
CN110735006A (en) African swine fever TaqMan real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer and kit
CN115466800A (en) Multiplex fluorescence quantitative PCR kit for detecting monkeypox virus and subtype thereof
CN112538550A (en) RT-RPA and CRISPR/Cas-based DHAV-1 and DHAV-3 detection system and application
CN113652505A (en) Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof
CN111778359A (en) System for detecting novel coronavirus SARS-CoV-2 and use method thereof
CN112501358B (en) Primer probe combination and kit for detecting 9 children digestive tract pathogens
CN113373267B (en) Multiplex fluorescence quantitative RT-PCR kit for detecting blood-borne infectious viruses
CN113046452B (en) Composition for detecting Boeck hollandia farci and application thereof
CN111471800B (en) Kit for detecting novel coronavirus and amplification primer composition thereof
CN112575118B (en) Method for simultaneously detecting various diarrhea viruses by using melting curve
CN112662809A (en) Nucleic acid composition for detecting novel coronavirus COVID-19 and application thereof
CN116904667B (en) Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus
CN116814859A (en) Primer probe composition, kit and method for identifying African swine fever virus genes I and II
CN115820927A (en) Monkey pox virus fluorescence PCR detection kit and primer probe combination thereof
CN114959081A (en) Primer and probe for detecting mycoplasma gallisepticum by LAMP-Taqman and application of primer and probe
CN114480726A (en) Primer probe set, kit and detection method for African swine fever virus nucleic acid detection
CN113684318A (en) Fluorescent PCR (polymerase chain reaction) detection kit for M protein gene of porcine reproductive and respiratory syndrome virus
CN113801966B (en) Fluorescent quantitative PCR method and kit for detecting novel coronavirus subgenomic
NL2030190B1 (en) Primer sets, probe, kit and application for detecting porcine delta coronavirus
CN113186261B (en) Application of self-primer isothermal exponential amplification method based on single probe in detection of long-chain nucleic acid
CN113981149A (en) Porcine delta coronavirus detection primer group, probe, kit and application
CN117385103A (en) Reagent composition for detecting GII.2 norovirus, method and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant