CN113186261B

CN113186261B - Application of self-primer isothermal exponential amplification method based on single probe in detection of long-chain nucleic acid

Info

Publication number: CN113186261B
Application number: CN202110376763.6A
Authority: CN
Inventors: 陈俊; 黄婷; 刘碧蓉; 杨子中; 孙蒙旭; 陈金香; 谢宝平; 段文军
Original assignee: Southern Medical University
Current assignee: Southern Medical University
Priority date: 2021-04-08
Filing date: 2021-04-08
Publication date: 2024-06-11
Anticipated expiration: 2041-04-08
Also published as: CN113186261A

Abstract

The invention discloses an application of a self-primer isothermal exponential amplification method based on a single probe in detecting long-chain nucleic acid, wherein the method comprises the following steps: (1) designing a self-primer amplification template hairpin; (2) Reverse transcription of the RNA of the sample to be detected is carried out to obtain the DNA of the sample to be detected, the DNA of the sample to be detected is taken as a template, isothermal amplification is carried out with a hairpin of the self-primer amplification template, and the content of long-chain nucleic acid in the sample to be detected is calculated according to the fluorescence signal intensity of an amplified product; wherein the long-chain nucleic acid is a nucleic acid sequence with a base length of more than 1000. Compared with the traditional EXPAR, the detection method provided by the invention can realize high-sensitivity and high-specificity detection of long-chain nucleic acid without introducing a new primer probe, thereby greatly simplifying the complexity of the method and reducing the non-specific amplification.

Description

Application of self-primer isothermal exponential amplification method based on single probe in detection of long-chain nucleic acid

Technical Field

The invention belongs to the field of gene detection, and particularly relates to application of a self-primer isothermal exponential amplification method based on a single probe in detection of long-chain nucleic acid.

Background

Isothermal nucleic acid amplification techniques are a class of techniques that perform nucleic acid amplification under isothermal conditions. Compared with the PCR technology, the isothermal nucleic acid amplification does not need complicated temperature change steps, has the amplification efficiency equivalent to that of PCR, and can be widely used for detecting miRNA, DNA, mRNA, viral RNA and protein.

Isothermal nucleic acid amplification can be categorized into amplification without the involvement of biological enzymes and biological enzyme-based amplification reactions. Reactions without biological enzyme participation include hybridization chain reactions and catalytic hairpin self-assembly reactions, and although the reactions do not require the participation of biological enzymes, the cost is reduced to a certain extent, the amplification efficiency of the method is low and the reaction time is long. While isothermal amplification such as Rolling Circle Amplification (RCA), loop-mediated exponential amplification (LAMP) and isothermal exponential amplification (EXPAR) based on the participation of biological enzymes can realize high amplification efficiency and high amplification rate with the assistance of biological enzymes such as polymerase or nicking enzyme, the method has low specificity for the amplification reaction of a single probe triggered by a target, has poor amplification effect and efficiency for long-chain samples, and cannot be effectively popularized and used.

Therefore, the development of a self-primer isothermal exponential amplification method which can be based on a single probe and has higher specificity has great significance for long-chain nucleic acid detection.

Disclosure of Invention

The present invention aims to solve at least one of the technical problems in the prior art described above. Therefore, the invention provides a single-probe-based self-primer isothermal index amplification method for long-chain nucleic acid, which can solve the problem that the 3' end of the single-probe-based self-primer isothermal index amplification method cannot be directly used as a primer to trigger amplification when a traditional method is used for fragments with lengths of tens of bases in a middle conserved region of long-chain nucleic acid (such as mRNA and virus RNA), realizes amplification on the basis of no need of adding additional primer probes, reduces the problem of non-specific amplification caused by the introduction of additional primer probes, simplifies a detection method, and realizes high-sensitivity and high-specificity detection of long-chain nucleic acid.

In a first aspect of the present invention, there is provided a method for detecting long-chain nucleic acid, comprising the steps of:

(1) Designing a self-primer amplification template hairpin, wherein the length of a neck sequence of the self-primer amplification template hairpin is 11-15 nt;

(2) Reverse transcription is carried out on RNA of the sample to be detected as DNA of the sample to be detected, the DNA of the sample to be detected is taken as a template, isothermal amplification is carried out with a hairpin of the self-primer amplification template, and the content of long-chain nucleic acid in the sample to be detected is calculated according to the fluorescent signal intensity of an amplified product.

According to a first aspect of the invention, in some embodiments of the invention, the long-chain nucleic acid is a nucleic acid sequence having a base length of greater than 1000.

In some preferred embodiments of the invention, the long-chain nucleic acids are mRNA, lncRNA, RNA viral genome and RNA fragments having a base length greater than 1000.

In the detection process, when a fragment with the length of tens of bases in the middle conserved region of long-chain nucleic acid (such as mRNA and viral RNA) is faced, the problem that the 3' end cannot be directly used as a primer to trigger amplification exists, and the amplification can be realized only by adding an additional primer probe, so that the introduction of the additional primer probe easily leads to non-specific amplification, and the detection method tends to be complicated, which is unfavorable for the popularization of the method. While Rolling Circle Amplification (RCA), loop-mediated exponential amplification (LAMP) and isothermal exponential amplification (EXPAR) have the characteristics of high amplification efficiency and high amplification rate, the method has low specificity for the amplification reaction of a single probe triggered by a target object, has poor amplification effect and efficiency for long-chain samples, and cannot be effectively popularized and used.

Conventional isothermal exponential amplification is mainly used for short-chain nucleic acids (e.g., nucleic acid sequences with a general length of about 20 bases such as miRNA), and when the primer is complementarily paired with the 3 '-end sequence of the amplified template, the 3' -end sequence of the primer is amplified by extending along the template under the action of polymerase (see FIG. 1A). However, in the case of detecting long-chain nucleic acids (such as mRNA, lncRNA or viral RNA), the nucleic acid sequences of these targets are often in the length of several kilobases, and in order to detect these targets, a region with a length of several tens of bases in the conserved region is usually selected as the target recognition sequence, and when designing a template according to the idea of detecting short-chain nucleic acids, after the target recognition sequence of the target is combined with the amplified template probe, the 3 'of the target is in a suspended state and cannot extend along the template (see fig. 1B), so that an additional primer probe (primer probe) has to be designed as an auxiliary strand, and complementary hybridization is performed between the primer probe and the amplified template and the target recognition sequence to form a Y-shaped structure, and then the 3' end of the primer probe extends along the template to amplify the long-chain nucleic acid to detect the long-chain nucleic acid (fig. 1C), which clearly increases the probability of nonspecific amplification and tends to complicate the detection method.

The inventive concept (see fig. 2) of the present invention is mainly as follows: by designing a metastable hairpin amplification template (amplification template HP), the 5' end of the HP is the target recognition sequence (black part+green part), wherein a part of the sequence (green part) is complementary to a part of the base sequence near the 3' end, and the 3' end sequence (orange part) of the HP is complementary to the base of the loop part sequence. The loop portion sequence is designed as a nicking enzyme recognition sequence. Since the hairpin structure formed by the 5 '-end partial target sequence of the amplification template HP and the partial base sequence close to the 3' -end thereof are complementary is more stable, the amplification template HP can preferentially form the structure. Only when the target is present, the target reacts with the 5' -end sequence of the amplified template HP to form a Toehold strand, a double strand is formed, the hairpin is opened, at this time, the 3' -end sequence of the HP hybridizes with the loop sequence thereof to form a new hairpin, and the 3' -end of the new hairpin can extend and be amplified along the template under the action of polymerase.

According to a first aspect of the invention, in some embodiments of the invention, the isothermal amplification reaction system in step (2) is:

In some preferred embodiments of the invention, the 10 XNt.AiwI endonuclease buffer contains 50mM CH ₃ COOK,20mM Tris-acetate, 10mM Mg (CH ₃COO)₂, 100. Mu.g/mL Bovine Serum Albumin (BSA), pH 7.9;

In some preferred embodiments of the present invention, the Klenow fragment (3 '. Fwdarw.5' exo-) polymerase buffer contains 10mM Tris-HCl,50mM NaCl,10mM MgCl ₂, 1mM dithiothreitol, pH 7.9.

In some preferred embodiments of the present invention, the reaction system is formulated by: solution A and solution B are respectively prepared under the low temperature environment (0-4 ℃) or on ice, and the reaction system is obtained after the preparation is completed.

The system of solution A is:

Solution A component	Volume of dosage
		2.5MM dNTPs premix	2μL
1 Mu M self-primer amplification template HP	2μL
		Sample to be measured	2.μL
10 XNt AiwI endonuclease buffer	1μL
		10U/. Mu.L RNase inhibitor	1.6μL
DEPC water	0.4μL
		Totals to	10μL

The system of solution B is:

According to a first aspect of the invention, in some embodiments of the invention, the reaction procedure of isothermal amplification in step (2) is: amplifying for 60min at 36-38 ℃.

According to a first aspect of the invention, in some embodiments of the invention, the long-chain nucleic acid is a classical swine fever virus genome and/or an RNA fragment thereof.

In a second aspect of the present invention, there is provided a set of self-primer amplification template hairpin nucleotide sequences:

HP-11nt：5'-CGTCCACATAGCATCTCGAGGTGGGATAGATCCGCGTAGGTACTAACCC ACCTCGAGTATTCCTACGC-3'(SEQ ID NO.7)；

HP-12nt：5'-CGTCCACATAGCATCTCGAGGTGGGATAGATCCGCGTAGGTACTAACCC ACCTCGAGAATTCCTACGC-3'(SEQ ID NO.8)；

HP-13nt：5'-CGTCCACATAGCATCTCGAGGTGGGACGAGACGCGTAGGTACTAACCC ACCTCGAGATCCTACGC-3'(SEQ ID NO.9)；

HP-14nt：5'-CGTCCACATAGCATCTCGAGGTGGGATAGATCCGCGTAGGTACTAACCC ACCTCGAGATTTCCTACGC-3'(SEQ ID NO.10)；

HP-15nt：5'-CGTCCACATAGCATCTCGAGGTGGGATAGATCCGCGTAGGTACTAACCC ACCTCGAGATGCCCTACGC-3'(SEQ ID NO.11)。

According to a second aspect of the present invention, in some embodiments of the present invention, the self-primer amplification template hairpin is based on the base sequence (SEQ ID NO. 2) between 200 and 224 of the full-length sequence (SEQ ID NO. 1) of the classical swine fever virus RNA as the target recognition sequence, and the design principle is as follows: the self-primer amplification template hairpin is required to undergo a conformational transition of template HP only in the presence of the target.

In a third aspect of the present invention, there is provided a detection preparation comprising the hairpin of the self-primer amplification template according to the second aspect of the present invention.

According to a third aspect of the invention, in some embodiments of the invention, the detection agent comprises a sequence as shown in SEQ ID NO. 9.

In a fourth aspect, the invention provides the use of the detection preparation according to the third aspect of the invention in the preparation of a swine fever virus detection kit.

According to a fourth aspect of the invention, in some embodiments of the invention, the classical swine fever virus is a classical swine fever virus genome or an RNA fragment comprising the sequence shown in SEQ ID No. 2.

The beneficial effects of the invention are as follows:

1. Compared with the traditional EXPAR, the single-probe-based self-primer isothermal index amplification method can realize high-sensitivity high-specificity detection of the intermediate target recognition sequence of the long-chain nucleic acid by designing a metastable self-primer amplification template HP without additionally introducing a new primer probe, thereby greatly simplifying the complexity of the method and reducing the non-specific amplification.

2. The self-primer amplification template HP designed by taking the classical swine fever virus as an example has high sensitivity and high specificity, can effectively distinguish single base difference sequences, has short detection time and simple detection method, has the measured effective data within 15 percent of the traditional qPCR relative error value, and has extremely high application value.

Drawings

FIG. 1 is a schematic diagram of a conventional exponential amplification detection nucleic acid principle;

FIG. 2 is a schematic diagram of a single probe-based isothermal exponential amplification method of a self-primer according to an embodiment of the present invention;

FIG. 3 shows the feasibility verification result of the single probe-based self-primer isothermal exponential amplification method according to the embodiment of the invention, wherein A is a real-time fluorescent amplification curve graph under different conditions, and B is a denaturing polyacrylamide gel imaging graph;

FIG. 4 is a diagram showing the relationship of the neck length POI of the self-primer amplification template HP in the embodiment of the present invention;

FIG. 5 is a graph showing the relationship between Klenow fragment (3 '. Fwdarw.5' EXO-) polymerase content and amplification effect in the examples of the present invention;

FIG. 6 is a graph showing the relationship between the Nt.AiwI endonuclease content and the amplification effect in the examples of the present invention;

FIG. 7 is a graph showing the relationship between the HP-13nt content and the amplification effect in the examples of the present invention;

FIG. 8 is an amplification standard curve in an embodiment of the present invention, wherein A is an amplification curve of RNA to be detected with different concentrations, and B is a fitting curve of RNA to be detected with different concentrations to POI;

FIG. 9 shows the results of a specificity verification test in the example of the present invention, wherein A is the amplification curve of different mismatched probes, and B is the evaluation result of the interference degree of the method.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to the following specific embodiments. It should be understood that the detailed description is presented herein for purposes of illustration only and is not intended to limit the invention.

The experimental materials and reagents used, unless otherwise specified, are those conventionally available commercially.

Self-primer isothermal exponential amplification method based on single probe

The single probe-based self-primer isothermal exponential amplification method in this embodiment is directed to detection of long-chain nucleic acids, "long-chain nucleic acids" in this embodiment refers to nucleic acid sequences having a longer length, which are distinguished from short-chain RNAs (such as mirnas, etc.) having a base length of only 20 to 30, specifically long-chain nucleic acids having a base length of more than 1000, such as mRNA, lncRNA, full-length RNA or RNA fragments of viruses.

The self-primer isothermal exponential amplification method based on the single probe in the embodiment specifically comprises the following detection steps:

(1) Designing a self-primer amplification template hairpin (HAIRPIN RNA, HP):

And designing a series of self-primer amplification templates HP with different neck hybridization numbers according to the RNA of the target to be detected, so as to be used for the subsequent optimal combination screening.

(2) Method feasibility test:

And respectively verifying whether the amplification reaction can be continued and the amplification condition of the amplified product when the target RNA to be detected is absent or the template HP polymerase is amplified from the primer by electrophoresis and a fluorescence labeling method, and judging whether a designed reaction system is effective and whether the method is feasible by comparing experimental results.

If the amplification reaction cannot be generated by adopting both the electrophoresis and the fluorescence labeling method, the design failure of the reaction system is indicated, and the design is needed to be redesigned until the electrophoresis and the fluorescence labeling method can show the successful amplification.

(3) Screening of optimal self-primer amplification template HP:

And (3) respectively adding target RNA to be detected into the self-primer amplification template HP obtained by designing in the step (1) in a low-temperature environment (0-4 ℃) or on ice, respectively supplementing the substances required by the amplification reaction to form a complete reaction system (the reaction can be carried out on a PCR reaction plate), carrying out real-time PCR amplification reaction, and calculating the POI (time corresponding to the maximum slope of the amplification curve) value of each amplification curve. A reaction system without target RNA to be detected (equal ddH ₂ O or buffer solution is added instead) is used as a blank control group. And selecting a self-primer amplification template HP with the maximum difference value between the POI value of the amplification curve of the target RNA to be detected and the POI value of the blank group amplification curve of the blank group as an optimal reaction HP for practical detection.

(4) And (3) optimizing reaction conditions:

And (3) selecting the optimal reaction HP screened in the step (3) as an amplification template, and optimizing the condition of the target RNA to be detected by a single factor rotation method.

① Optimizing the addition amount of the template HP polymerase amplified from the primer:

In order to explore the optimal addition amount of the self-primer amplified template HP polymerase in a reaction system and the influence of the optimal addition amount on an actual detection result, under the condition of not changing the content of other reagents in the reaction system (quantifying other reagents), the self-primer amplified template HP polymerase with different content gradients is respectively added for testing, fluorescent quantitative PCR curves of target RNA to be detected of the self-primer amplified template HP polymerase with different content gradients and a blank control are observed, the POI difference value of the amplification curves of the target RNA to be detected and the blank control is calculated, and the content of the self-primer amplified template HP polymerase with the maximum POI difference value is selected as the optimal content of the self-primer amplified template HP polymerase.

② Optimizing the addition amount of endonuclease:

In order to explore the optimal addition amount of endonuclease in a reaction system and the influence of the optimal addition amount on the actual detection result, under the condition of not changing the content of other reagents in the reaction system (quantifying other reagents), respectively adding the endonucleases with different content gradients for testing, observing fluorescent quantitative PCR curves of target RNA to be tested and blank control of the endonucleases with different content gradients, calculating the POI difference value of the amplification curves of the target RNA to be tested and the blank control, and selecting the endonuclease with the largest POI difference value as the optimal endonuclease content.

③ Optimizing the addition amount of the self-primer amplification template HP:

In order to explore the optimal adding amount of the self-primer amplified template HP in a reaction system and the influence of the optimal adding amount on an actual detection result, under the condition of not changing the content of other reagents in the reaction system (quantifying other reagents), the self-primer amplified template HP with different content gradients is respectively added for testing, fluorescent quantitative PCR curves of target RNAs to be detected of the self-primer amplified template HP with different content gradients and blank controls are observed, the POI difference value of the amplification curves of the target RNAs to be detected and the blank controls is calculated, and the content of the self-primer amplified template HP with the largest POI difference value is selected as the optimal content of the self-primer amplified template HP.

(5) Drawing a standard curve:

Preparing target RNA solutions to be detected with different concentration gradients, and detecting in the optimal reaction system obtained in the step (4), wherein the specific steps are as follows: preparing a solution A and a solution B in a low-temperature environment (0-4 ℃) or on ice, wherein the solution A contains an endonuclease buffer solution, a self-primer amplification template HP, dNTP, RNase inhibitor and a sample standard to be detected, and the solution B contains a self-primer amplification template HP polymerase, a polymerase buffer solution, endonuclease and SYBR Green I fluorescent dye. And (3) after uniformly mixing the solution A and the solution B, immediately amplifying on a PCR instrument to obtain an amplification curve, calculating a POI value, and counting to obtain a target RNA concentration standard curve to be detected.

(6) Specificity determination:

According to the step (5), the standard sample to be detected is replaced by a test solution with different determined concentration of one or more bases in the nucleic acid sequence, the same reaction system is adopted for detection, whether an amplification curve is generated or not is observed, if not, the specific requirement is met, the self-primer amplification template HP is redesigned, and the steps (1) to (5) are repeated.

(7) And detecting an actual sample by using an optimal reaction system, and obtaining the concentration of the target to be detected in the sample through a standard curve according to the detection value.

The reaction principle in this example can be seen in FIG. 2. A hairpin probe HP in a metastable state is designed, a hanging extension sequence (orange region) with a certain base length is designed at the 3' end of the HP, the extension sequence is complementary with a partial region with 6 base length of the HP loop part, and a nicking enzyme recognition sequence (yellow) is designed at the same time on the HP loop part. And selecting a part of fragments of a conserved sequence of target long-chain RNA as a target recognition sequence, wherein when no target RNA exists, HP is in a metastable state, 3' of the HP is still suspended, and amplification reaction cannot occur. When the target RNA is present, the RNA undergoes a Toehold strand displacement reaction with the hairpin 5 '-end sequence, the HP is opened, at this time, the 3' -end sequence of the HP forms a new hairpin structure on the HP (step ① in FIG. 2), the 3 '-end thereof forms a double-strand hybridization structure, the 3' -end thereof extends along the template under the action of the polymerase and displaces the target RNA (step ② in FIG. 2), and the displaced target RNA can react with the new HP again, thereby initiating new amplification. The double strand extending along the template creates a nick under recognition by the nicking enzyme (step ③ in FIG. 2) under which the polymerase can continue to extend along the template and displace the amplified product strand (DNAamplicons strand) and repeat the step of cleaving the extension (step ④-⑤ in FIG. 2) and the released DNA amplified strand undergoes further Toehold strand displacement with the 5' stretch of the new HP (step ⑥ in FIG. 2) and initiates the new extension reaction (step ⑦ in FIG. 2) and generates the DNA amplified strand (step ⑧-⑩ in FIG. 2). The continuous circulation finally realizes the exponential growth of the DNA amplification chain along with the time.

Effect of practical application

This example shows the practical effect of the single probe-based self-primer isothermal exponential amplification method of the above example, taking Classical Swine Fever Virus (CSFV) as an example.

(1) Experimental materials:

The identification number of the database of the swine fever virus in this embodiment is: NCBI numbering: nc_002657.1. The total length of the classical swine fever virus RNA is 12301 bases, and the sequence of the classical swine fever virus RNA is shown as SEQ ID NO. 1.

The base sequence between 200 th and 224 th positions of the sequence shown in SEQ ID NO.1 is selected as a target recognition sequence, and the specific sequence is as follows:

5'-CCCACCUCGAGAUGCUAUGUGGACG-3'(SEQ ID NO.2)。

A series of mismatched probe sequences were designed based on the sequence shown in SEQ ID No.2 for detection of the specificity of the single probe based self-primer isothermal exponential amplification method in the above examples.

The mismatched probe sequences are specifically:

Mismatch free probe sequence: 5'-GAGCAGAAGCCCACCUCGAGAUGCUAUGUGGACGAGGGCA UGC-3' (SEQ ID NO. 3);

Mismatch G probe sequence: 5'-GAGCAGAAGCCCGCCUCGAGAUGCUAUGUGGACGAGGGCA UGC-3' (SEQ ID NO. 4);

Mismatch C probe sequence: 5'-GAGCAGAAGCCCACCUCGAGAUCCUAUGUGGACGAGGGCA UGC-3' (SEQ ID NO. 5);

Mismatch a probe sequence: 5'-GAGCAGAAGCCCACCUCGAGAUGCUAUGUGAACGAGGGCA UGC-3' (SEQ ID NO. 6);

Wherein the underlined part of the mismatched probe sequence is the part that corresponds to the sequence shown in SEQ ID NO. 2.

(2) Design of self-primer amplification template HP:

Designing a self-primer amplification template HP according to a sequence shown in SEQ ID NO.1, wherein the design principle is as follows: the primer template undergoes a configuration change only in the presence of the target.

The designed self-primer amplified template HP sequence is as follows:

The designed self-primer amplified template HP sequence is denatured for 5min at 95 ℃, naturally cooled at room temperature to form a hairpin structure, and then placed at-20 ℃ for standby.

(3) Method feasibility test:

The reaction system (as shown in Table 1) was formulated in a low temperature environment (0-4 ℃) or on ice and then amplified exponentially in real time at 37 ℃. The amplification curve was monitored using StepOne Plus real-time fluorescent quantitative PCR instrument.

TABLE 1 amplification reaction System

Wherein, the Nt.AiwI endonuclease buffer is purchased from NEB, the composition is 50mM CH ₃ COOK,20mM Tris-acetic acid, 10mM Mg (CH ₃COO)₂, 100 μg/mL BSA), the pH is 7.9.RNase inhibitor is purchased from Shanghai, klenow fragment (3 '. Fwdarw.5' exo-) polymerase is purchased from NEB.Klenow fragment (3 '. Fwdarw.5' exo-) polymerase buffer is purchased from NEB, the composition is 10mM Tris-HCl,50mM NaCl,10mM MgCl ₂, 1mM dithiothreitol, and the pH is 7.9.

The control group was set as the sample deletion group to be tested (no sample to be tested was added to the reaction system), the polymerase deletion group (no Klenow fragment (3 '. Fwdarw.5' exo-) polymerase was added to the reaction system), and the HP deletion group (no self-primer amplification template HP was added to the reaction system), respectively.

The results are shown in FIG. 3.

As shown in the figure, curve A is an amplification curve without a deficiency according to the reaction system shown in Table 1, curve B is an amplification curve lacking the sample to be tested, curve C is an amplification curve lacking the polymerase, and curve D is an amplification curve lacking the self-primer amplification template HP. The amplification curve of the A group experiment appears obviously earlier than that of the other three groups, but after the sample to be detected is absent, obvious amplification appears in about 80 minutes, and no amplification is generated when polymerase or self-primer amplification template HP does not exist. The above data indicate that exponential amplification based on the sample to be tested is viable.

Further, the amplification products obtained in the 4 groups of experiments were subjected to denaturing PAGE gel experiments to verify that the results are shown in FIG. 4.

As shown in fig. 4, in the presence of the sample to be tested, a distinct amplified band (band 4) appears, whereas in the absence of the sample to be tested, only a weak background amplification (band 2) appears. In the absence of self-primer amplification template HP (lane 1) or polymerase (lane 3), no amplification was seen.

(4) And (3) optimizing reaction conditions:

① Screening of optimal self-primer amplification template HP:

According to the method shown in step (3), the amplification effects of the self-primer amplified template HP sequences HP-11nt, HP-12nt, HP-13nt, HP-14nt and HP-15nt were tested, respectively, using the reaction system shown in Table 1.

The results are shown in FIG. 5.

As shown in FIG. 5, the neck length of the self-primer amplification template HP has an effect on the POI, wherein the difference between the amplification curve POI and the blank set POI is maximum when the neck length is 13 bases (namely HP-13 nt), and the detection effect is optimal, so that HP-13nt is selected as the optimal self-primer amplification template HP.

② Optimization of the addition amount of KF (3 '. Fwdarw.5' exo-) polymerase:

according to the method shown in step (3), the amplification effects of Klenow fragment (3 '. Fwdarw.5' exo-) polymerase at concentrations of 0.05U/. Mu.L, 0.1U/. Mu.L, 0.15U/. Mu.L, and 0.2U/. Mu.L under the same volume conditions were tested using the reaction system shown in Table 1, respectively.

The results are shown in FIG. 6.

As shown in FIG. 6, the amount of Klenow fragment (3 '. Fwdarw.5' EXO-) polymerase added has an effect on POI, wherein the difference between the amplification curve POI and the blank set POI value is the largest and the background value is the smallest when the concentration of Klenow fragment (3 '. Fwdarw.5' EXO-) polymerase is 0.1U/. Mu.L, and therefore, the optimum concentration addition amount of KF (3 '. Fwdarw.5' exo-) polymerase is selected as 0.1U/. Mu.L.

③ Optimizing the addition amount of the AiwI endonuclease:

According to the method shown in the step (3), the amplification effect of Nt.AiwI endonuclease at the concentrations of 0.1U/. Mu.L, 0.2U/. Mu.L, 0.3U/. Mu.L and 0.4U/. Mu.L under the same volume condition was tested by using the reaction system shown in Table 1.

The results are shown in FIG. 7.

As shown in FIG. 7, the addition amount of Nt.AiwI endonuclease has an effect on POI, wherein the difference between the amplification curve POI and the blank set POI value is the largest when the concentration of Nt.AiwI endonuclease is 0.2U/. Mu.L, and the background effect is the smallest, so that the optimal concentration addition amount of Nt.AiwI endonuclease is selected as 0.2U/. Mu.L.

④ The addition amount of HP-13nt is optimized:

According to the method shown in step (3), the amplification effects of HP-13nt at concentrations of 50nM, 100nM, 150nM and 200nM were tested under the same volume condition using the reaction system shown in Table 1.

The results are shown in FIG. 8.

As shown in FIG. 8, the amount of HP-13nt added had an effect on POI, wherein the amplification curve POI and the blank group POI were the greatest in difference and the background was the smallest when the concentration of HP-13nt was 100nM, and therefore, the optimal concentration of Nt.AiwI endonuclease was selected as the 100nM added.

(5) Drawing a standard curve:

According to the method shown in the step (3), the optimized reaction system (Table 2) is adopted, and the sequence shown in SEQ ID NO.2 is used as a standard (the concentration is 100aM to 1nM, specifically, the concentration is diluted from 1nM to 100aM in a 10-fold dilution gradient, and 8 groups are used for detection).

TABLE 2 optimized amplification reaction System

/>

The composition of the Nt.AiwI endonuclease buffer was 50mM CH ₃ COOK,20mM Tris-acetate, 10mM Mg (CH ₃COO)₂, 100. Mu.g/ml BSA, pH 7.9.

Klenow fragment (3 '. Fwdarw.5' exo-) polymerase buffer contained 10mM Tris-HCl,50mM NaCl,10mM MgCl ₂, 1mM dithiothreitol, pH 7.9.

The results are shown in FIG. 9.

As shown in FIG. 8, standards at different concentrations produced quite different amplification curves with a minimum detection value of 100aM. By sorting the amplification curve, an amplification standard equation (FIG. 9B), i.e., between 100aM and 1nM, is obtained, which is:

POI＝9.2x-71.2；

R＝0.9991。

(6) Specificity determination:

And (3) respectively taking SEQ ID NO. 3-6 with the same concentration and the same volume as the sample to be detected according to the optimal reaction system shown in the step (5), and respectively detecting the amplification conditions of the sample to be detected.

The results are shown in FIG. 9.

As shown in fig. 9, the amplification curves of the samples to be tested have significant differences, and the differences of the samples to be tested are further compared with the amplification curve results by the interference degree evaluation method, so that the optimal reaction system in the embodiment can be shown to be capable of distinguishing the sequence with single base mismatch well, and the effective detection sensitivity can reach single base, and has high selectivity.

(7) Actual sample detection effect:

5 validated virus samples, numbered 1-5 (CSFV 1-5), were selected and tested using the optimal reaction system described in step (5) above, with the results shown in Table 3.

TABLE 3 actual detection of different virus samples

As shown in Table 3, the single probe-based self-primer isothermal index amplification method in the above embodiment has good actual detection effect by comparison with Rt-qPCR, and the measured effective data is within 15% of the conventional qPCR relative error value, which indicates that the single probe-based self-primer isothermal index amplification method has high accuracy.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

SEQUENCE LISTING

<110> University of medical science in south China

<120> Use of single probe-based self-primer isothermal exponential amplification method for detection of long-chain nucleic acids

<130>

<140> 202110376763.6

<141> 2021-04-08

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 12301

<212> RNA

<213> classical swine fever viru

<400> 1

guauacgagg uuaguucauu cucguaugca ugauuggaca aaucaaaauu ucaauuuggu 60

ucagggccuc ccuccagcga cggccgaacu gggcuagcca ugcccacagu aggacuagca 120

aacggaggga cuagccguag uggcgagcuc ccuggguggu cuaaguccug aguacaggac 180

agucgucagu aguucgacgu gagcagaagc ccaccucgag augcuaugug gacgagggca 240

ugcccaagac acaccuuaac ccuagcgggg gucgcuaggg ugaaaucaca ccacgugaug 300

ggaguacgac cugauagggc gcugcagagg cccacuauua ggcuaguaua aaaaucucug 360

cuguacaugg cacauggagu ugaaucauuu ugaacuuuua uacaaaacaa acaaacaaaa 420

accaauggga guggaggaac cgguauacga ugccacgggg aggccauugu uuggagaccc 480

gagugaggua cacccacaau caacacugaa gcuaccacau gauaggggga gagguaacau 540

caaaacaaca cugaagaacc uaccuaggaa aggcgacugc aggaguggca accaucuagg 600

cccgguuagu gggauauaug uaaagcccgg cccugucuuu uaucaggacu acaugggccc 660

ggucuaccau agagccccuc uagaguuuuu uaacgaagcg caguuuugcg aggugaccaa 720

aaggauaggu agggugacag guagugacgg aaagcuuuac cauauauaug ugugcaucga 780

ugguugcaua cugcugaagc uagccaagag ggacgagcca agaacccuga aguggauuag 840

aaauuucacc gacuguccau uguggguuac caguugcucu gaugauggcg caaguggaag 900

uaaagagaag aagccagaua ggaucaacaa aggcaaauua aaaauagccc caaaagagca 960

ugagaaggac agcagaacua agccaccuga cgcuacgauu guaguggaag gaguaaaaua 1020

ccagguuaaa aagaagggua aaguuaaagg aaagaguacc caagacggcc uguaccacaa 1080

caagaauaaa ccaccagaau cuaggaagaa auuagaaaaa gcccuauugg caugggcggu 1140

aauagcaauu auguuguacc aaccaguuga agccgaaaau auaacucaau ggaaccugag 1200

ugacaacggc acuaauggua uccagcaugc uauguaccuu agagggguua gcaggagcuu 1260

gcaugggauc uggccggaaa aaauaugcaa aggagucccc accuaccugg ccacagacac 1320

ggaacugaaa gaaauacagg gaaugaugga ugccagcgag gggacaaacu auacgugcug 1380

uaaguuacag agacaugaau ggaacaaaca uggauggugu aacugguaca auauagaccc 1440

cuggauacag uugaugaaua gaacccaagc aaacuuggca gaaggcccuc cggccaagga 1500

gugcgcugug acuugcaggu acgauaaaga ugcugacauc aacgugguca cccaggccag 1560

aaacaggcca acaacccuga ccgguugcaa gaaaggaaaa aauuuuucuu uugcggguac 1620

aguuauagag ggcccaugua auuucaaugu uuccguggag gauaucuugu auggggauca 1680

ugagugcggc aguuugcuuc aggacacggc ucuguaccua guggauggaa ugaccaacac 1740

uauagagaau gccagacagg gagcagcgag gguaacaucu uggcucggga ggcaacucag 1800

cacugccggg aagagguugg aggguagaag caaaaccugg uuuggugccu augcccuauc 1860

gccuuacugu aauguaacaa gcaaaauagg guacauaugg uacacuaaca acugcacccc 1920

ggcuugccuc cccaaaaaua caaagauaau aggccccgga aaauuugaca cuaacgcgga 1980

agacggaaag auucuccaug agaugggggg ucaccuauca gaauuucugc ugcucucucu 2040

gguuguucug ucugacuucg ccccugaaac agccagcgcg uuauaccuca uuuugcacua 2100

caugauuccu caaucccaug aagaaccuga aggcugcgac acaaaccagc ugaaucuaac 2160

aguggaacuc aggacugaag acguaauacc gucaucaguc uggaauguug gcaaauaugu 2220

guguguuaga ccagacuggu ggccauauga aaccaaggug gcuuuguuau uugaagaggc 2280

aggacagguc guaaaauuag ccuuacgagc gcugagggau uuaaccaggg ucuggaauag 2340

cgcaucaacc acggcauucc ucaucugcuu gauaaaagua uuaagaggac agaucgugca 2400

aggugugaua uggcugcuac uaguaacugg ggcacaaggc cggcuagccu gcaaggaaga 2460

uuacagguac gcaauaucau cgaccaauga gauagggcua cucggggccg aaggucucac 2520

caccaccugg aaagaauaca accacgauuu gcaacugaau gacgggaccg uuaaggccau 2580

uugcguggca gguuccuuua aagucauagc acuuaaugug gucaguagga gguauuuggc 2640

aucauugcau aaggaggcuu cacucacuuc cgugacauuu gagcuccugu ucgacgggac 2700

caacccauca acugaggaaa ugggagauga cuucggguuc gggcugugcc cguucgauac 2760

gaguccuguu gucaagggaa aguacaauac aaccuuguug aacgguagug cuuucuaucu 2820

ugucugccca auagggugga cgggugucau agagugcaca gcagugagcc caacaacucu 2880

gagaacagaa gugguaaaga ccuucaggag agacaagccc uuuccgcaca gaauggauug 2940

ugcgaccacc acaguggaaa auggagauuu auucuacugu aaguuggggg gcaacuggac 3000

augugugaaa ggugaaccag uggucuacac gggggggcua guaaaacaau gcagauggug 3060

uggcuucgac uucaaugagc ccgacggacu cccgcacuac cccauaggua agugcaucuu 3120

gguaaaugag acagguuaca gaauaguaga uucaacggac uguaacagag auggcguugu 3180

aaucagcaca gaugggaguc augagugcuu gaucgguaac acaacuguca aggugcaugc 3240

aucagaugaa agacugggcc cuaugccaug cagacccaaa gagauugucu cuagugcagg 3300

accuguaagg aaaacuuccu guacauucaa cuacgcaaaa acuuugaaga acaaguacua 3360

ugagcccagg gacagcuacu uccagcaaua uaugcuuaag ggcgaguauc aguacugguu 3420

ugaccuggac gugacugacc gccacucaga uuacuucgca gaauuugucg ucuugguagu 3480

gguagcacug uuaggaggaa gauauguccu guggcuaaua gugaccuaca uaguucuaac 3540

agaacaacuc gccgcugguu uaccauuggg ccagggugag guaguguuga uagggaacuu 3600

aauuacccac acagacauug aggucguagu auauuucuua cuacucuauu uggucaugag 3660

ggaugagccu auaaagaaau ggauacugcu gcuguuccau gcuaugacua acaauccagu 3720

caagaccaua acaguggcau ugcuuauggu uagugggguu gccaagggug gaaagauaga 3780

cggcgguugg cagcggcugc cagagaccag cuuugacauc caacucgcgc ugacaguuau 3840

aguagucgcu gugauguuac uggcaaagag agauccaacu acuguccccu ugguuauaac 3900

aguggcaacc cugagaacgg cuaagaugac uaauggacuu agcacggaua uagccauagc 3960

uacaguguca acagcguugc uaaccuggac cuacauuagu gacuauuaua gauacaagac 4020

uuggcuacag uaccuuauua gcacagugac agguaucuuc uuaauaaggg uacugaaggg 4080

aauaggugag uuggauuuac acacuccaac cuugccaucu uacagacccc ucuucuucau 4140

ucucguguac cucauuucca cugcaguggu aacaagaugg aaucuggaca uagccggauu 4200

gcuguugcag ugugucccaa cccuuuugau gguuuuuacg augugggcag acauucucac 4260

ccugauccuc auacugccca cuuacgagcu aacaaaacua uauuaccuca aggaagugaa 4320

gacuggggca gaaaagggcu gguuauggaa gaccaacuuc aagaggguaa acgacauaua 4380

cgaaguugac caaucuggug aagggguuua ccuuuucccg ucaaaacaaa agacaaguuc 4440

aauaacaggu accauguugc cauugaucaa agccauacuc aucagcugca ucaguaauaa 4500

guggcaguuc auauaucuau uguacuugau auuugaagug ucuuacuacc uccacaagaa 4560

gaucauagau gaaauagcag gagggaccaa cuucaucuca agacuuguag ccgcuuugau 4620

cgaagccaau ugggccuuug acaacgaaga aguuaggggu uuaaagaagu ucuuccuguu 4680

gucuaguagg guuaaagaac ugaucaucaa acacaaagug aggaaugaag uaauggucca 4740

cugguuuggu gacgaagagg uuuaugggau gccaaaguug guuggcuuag ucaaggcagc 4800

aacauugagu aaaaauaaac auuguauuuu gugcaccguc ugugaagaca gagaguggag 4860

aggagaaacc ugcccaaaau gcgggcguuu ugggccacca augaccugug guaugacccu 4920

agccgacuuu gaagaaaaac auuauaagag gaucuuuuuu agagaggauc aaucagaagg 4980

gccgguuaga gaggaguacg caggguaucu gcaauauaga gccagagggc aauuauuccu 5040

gaggaaucuc ccggugcuag caacaaaagu caagaugcuc cuggucggaa aucuugggac 5100

ggagguggga gacuuggaac accuuggcug gguccuuagg gggccugccg uuugcaagaa 5160

gguuaccgaa caugagaaau gcaccacauc cauaauggac aaauugacug cuuuuuucgg 5220

uguuaugcca aggggcacca caccuagagc cccugugaga uuccccaccu cucucuuaaa 5280

gauaagaagg ggguuggaaa cuggcugggc guacacacac caagguggca uuaguucagu 5340

ggaccauguc acuuguggga aagacuugcu gguaugugac acuaugggcc ggacaagggu 5400

cguuugccaa ucaaauaaua agaugacaga ugagucugag uauggaguua aaacugacuc 5460

cggaugcccg gaaggagcua gguguuaugu guucaaccca gaggcaguua acauaucagg 5520

gacuaaagga gccauggucc acuuacaaaa aacuggagga gaauucaccu gugugacagc 5580

aucaggaacu ccggccuucu uugaucucaa gaaccucaaa ggcuggucag ggcuaccgau 5640

auuugaggca ucaaguggaa ggguagucgg cagggucaag gucgggaaga augaggacuc 5700

uaaaccaacc aagcuuauga guggaauaca aacagucucc aaaaguacca cagacuugac 5760

agaaauggua aagaaaauaa cgaccaugaa caggggagaa uucagacaaa uaacccuugc 5820

uacaggugcc ggaaaaacca cggaacuccc uaggucaguc auagaagaga uagggaggca 5880

uaagagaguc uuggucuuga ucccucugag ggcggcagca gagucaguau accaauauau 5940

gagacaaaaa cauccaagca ucgcauuuaa ccugaggaua ggggagauga aggaagggga 6000

cauggccaca gggauaaccu augcuucaua cgguuacuuc ugucagaugc cacaaccuaa 6060

guugcgagcc gcgaugguug aguacuccuu cauauuucuu gacgaguacc acugugccac 6120

cccagaacaa uuggccauca ugggaaagau ccacagauuu ucagagaacc ugcggguagu 6180

agccaugacc gcaacaccag caggcacagu aacaaccaca gggcagaaac acccuauaga 6240

agaauucaua gccccagaag ugaugaaagg ggaagacuua ggcucagagu acuuggacau 6300

ugcuggacua aagauaccag uagaggagau gaagagcaac augcugguuu uugugcccac 6360

uaggaacaug gcgguggaga cagcaaagaa auugaaagcu aaggguuaca acucaggcua 6420

cuauuauagu ggagaggauc caucuaaccu gaggguggua acgucgcagu ccccguacgu 6480

ggugguggca accaacgcga uagaaucagg uguuacucuc ccggacuugg augugguugu 6540

cgauacaggg cuuaagugug aaaagagaau acggcuguca ccuaagaugc ccuucauagu 6600

gacgggccug aagagaaugg cugucacgau uggggaacaa gcccagagaa gggggagagu 6660

ugggagagua aagccuggga gauacuacag gagucaagaa acucccguug guucuaaaga 6720

uuaccauuau gaucuacugc aagcacagag guacgguauu gaagauggga uaaacaucac 6780

caaauccuuu agagagauga acuaugauug gagccuuuau gaggaggaca gucugaugau 6840

uacacaauug gaaauccuca auaauuuguu gauaucagaa gaacuaccga uggcaguaaa 6900

aaauauaaug gccaggacug accacccaga accaauucag cuggcguaca acagcuacga 6960

aacacaagug ccagugcuau ucccaaaaau aaagaaugga gaggugacug auaguuacga 7020

uaacuauacc uuccucaacg caagaaaauu gggggaugau guacccccuu acguguaugc 7080

cacagaggau gaggacuuag cgguagagcu acugggcuua gacuggccag acccuggaaa 7140

ccaaggaacc guagaggcug gcagagcacu aaaacaagua guuggucuau caacagcuga 7200

gaaugcccug uuaguagccu uauucggcua uguaggauau caggcacuuu caaagaggca 7260

uauaccagua gucacagaua uauauucaau ugaagaucac agguuggaag acaccacaca 7320

ccuacaguac gccccaaaug cuaucaagac ggaggggaag gagacagaau ugaaggagcu 7380

agcccagggg gaugugcaga gaugugugga agcuaugacc aauuaugcaa gagaggguau 7440

ccaauucaug aagucucagg cacugaaggu gaaagaaacc cccacuuaca aagagacaau 7500

gaacacugug acugacuaug uaaagaaauu cauggaggcg cuggcagaca guaaagaaga 7560

caucuuaaga uauggguugu gggggacgca cacagccuua uauaagagca ucagugccag 7620

gcuugggagu gagacugcgu ucgcuacccu ggucgugaag uggcuggcau uuggggggga 7680

aucaauagca gaccauguca aacaagcggc cacagacuug gucgucuacu auaucaucaa 7740

cagaccucag uucccaggag acacagagac acaacaggaa ggaaggaaau uuguggccag 7800

ccuacugguc ucagcucuag cuacuuacac auacaaaagc uggaauuaca auaaucuguc 7860

caagauaguu gaaccggcuu uggccacucu gcccuaugcc gccacagcuc ucaaacuauu 7920

cgcccccacu cgauuggaga gcguugucau auugaguacc gcaaucuaca agaccuaccu 7980

aucaaucagg cgcggaaaaa gcgaugguuu gcuaggcaca gggguuagug cggcuaugga 8040

gaucauguca caaaauccag uauccguggg cauagcaguc augcuagggg uaggggccgu 8100

ggcagcccac aaugcaaucg aggccaguga gcagaagaga acacuacuca ugaaaguuuu 8160

uguaaagaac uucuuggacc aagcagccac ugaugaauua gucaaggaga guccugagaa 8220

aauaauaaug gcuuuguuug aagcagugca gacagucggu aacccucuua gacuaguaua 8280

ccaccuuuau ggaguuuucu auaaggggug ggaggcaaaa gaguuggccc aaaggacagc 8340

cgguaggaac cuuuucacuu ugauaauguu cgaggcugug gaacuacugg gaguagauag 8400

ugaaggaaag auccgccagc uaucaaguaa uuacauacua gagcuccugu auaaguuccg 8460

ugacaguauc aagucuagcg ugagggagau ggcaaucagc ugggccccug ccccuuucag 8520

cugugauugg acaccgacgg augacagaau agggcucccc caagacaauu uccuccaagu 8580

ggagacgaaa ugccccugug guuacaagau gaaggcaguu aagaauugug cuggagagcu 8640

gagacucuug gaggaggaag gcucauuucu cugcagaaau aaauucggga gagguucacg 8700

gaacuacagg gugacaaaau acuaugauga caaucuauca gaaauaaagc cagugauaag 8760

aauggaaggg cauguggaac ucuacuacaa gggagccacc aucaaacugg acuucaacaa 8820

caguaaaaca auacuggcaa ccgauaaaug ggagauugau cacuccacuc uggucagggu 8880

gcucaagagg cacacagggg cuggauauca uggggcauac cugggcgaga aaccgaacua 8940

caaacaucug auagagaggg acugugcaac caucaccaaa gauaagguuu guuuucucaa 9000

aaugaagaga gggugugcau uuacuuauga cuuaucccuu cacaaccuua cccgacugau 9060

ugaauuggua cacaagaaua acuuggaaga caaagagauu ccugcuguua cgguuacaac 9120

cuggcuggcu uacacguuug uaaaugaaga uauagggacc auaaaaccag ccuucgggga 9180

gaaaguaaca ccggagaugc aggaggaaau aaccuugcag ccugcuguag ugguggauac 9240

aacugacgug accgugacug ugguagggga agccccuacu augacuacag gggagacucc 9300

gacagcguuc accagcucag guucagaccc gaaaggccaa caaguuuuaa aacugggggu 9360

aggugaaggc caauaccccg ggacuaaucc acagagggca agccugcacg aagccauaca 9420

aggugcagau gagagacccu cggugcugau auuagggucu gauaaagcca ccucuaauag 9480

agugaaaacu gcaaagaaug uaaagguaua cagaggcagg gacccacuag aagugagaga 9540

uaugaugagg aggggaaaga uccuggucau agcccugucu aggguugaua augcucuauu 9600

gaaauuuguu gacuacaaag gcaccuuucu aacuagagag acccuagagg cauuaaguuu 9660

ggguaggccu aaaaagaaaa acauaaccaa ggcagaagcg cagugguugc ugugccucga 9720

agaccaaaug gaagagcuac ccgauugguu cgcagccggg gaacccauuu uucuagaggc 9780

uaacauuaaa caugacaggu accaucuggu gggggauaua gcuaauauca aggaaaaagc 9840

caaacaguug ggagcuacag acuccacaaa gauaucuaag gagguuggug caaaagugua 9900

uucuaugaaa cugaguaauu gggugaugca agaagaaaau aaacagggca accugacccc 9960

cuuguuugaa gagcuccugc aacagugucc acccggaggc cagaacaaaa cugcacauau 10020

ggucucugcu uaccaacuag cucaagggaa cuggaugcca accagcugcc auguuuuuau 10080

ggggaccaua ucugccagga ggaccaagac ccauccauau gaagcauacg ucaaguuaag 10140

ggaguuggua gaggaacaca agaugaaaac auuguguccu ggaucaagcc uggguaagca 10200

caacgaaugg auaauuggua aaaucaaaua ccagggaaac cugaggacca aacacauguu 10260

gaaccccggc aagguggcag agcaacugug cagagaggga cacagacaca auguguauaa 10320

caagacaaua ggcucaguaa ugacagcuac ugguaucagg uuggagaagu ugcccguggu 10380

uagggcccag acagacacaa ccaacuucca ccaagcaaua agggauaaga uagacaagga 10440

agagaaccua caaaccccgg guuuacauaa gaaacuaaug gaaguuuuca augcauugaa 10500

acgacccgag uuagaguccu ccuacgaugc cguggaaugg gaggaacugg agagaggaau 10560

aaacaggaag ggugcugcug guuucuuuga acgcaaaaau auaggggaaa uauuggauuc 10620

agagaaaaac aaagucgaag agauuauuga caaucugaaa aaaggcagaa acaucaaaua 10680

cuaugaaacc gcgaucccaa agaaugagaa gagggacguc aaugaugacu ggacugcugg 10740

ugacuucgug gaagagaaga aacccagagu cauacaauac ccugaagcaa aaacaaggcu 10800

ggccaucacc aaggugaugu auaagugggu gaagcagaag ccaguaguua uacccgggua 10860

ugaagggaag acaccucuau uccaaauuuu ugacaaagua aagaaggaau gggaucaauu 10920

ccaaaaucca guggcaguga guuuugacac uaaggcgugg gacacccagg uaaccacaaa 10980

agauuuggag uugauaaagg acauacaaaa guacuauuuc aagaagaaau ggcauaaauu 11040

uauugacacc cugaccaugc acaugucaga aguacccgua aucagugcug auggggaagu 11100

auacauaagg aaagggcaaa gaggcagugg acaaccugac acaagcgcag gcaauagcau 11160

gcuaaaugug uuaacaauga uuuacgccuu cugcgaggcc acgggaguac ccuacaagag 11220

cuucgacagg guggcaaaaa uucaugugug uggggaugau gguuuccuga ucacagaaag 11280

agcucucggu gagaaauucg cgaguaaggg aguccagauc cuauaugaag cugggaagcc 11340

ccagaagauc acugaagggg acaagaugaa aguggccuac caauuugaug auauugaguu 11400

uugcucccau acaccaauac aaguaaggug gucagauaac acuucuaguu acaugccggg 11460

gagaaauaca accacaaucc uggcuaaaau ggccacaagg uuagauucca guggugagag 11520

ggguaccaua gcauaugaga aagcaguagc auucagcuuc cugcugaugu acuccuggaa 11580

cccacuaauc agaaggaucu gcuuacuggu gcuaucaacu gaacugcaag ugaaaccagg 11640

gaagucaacc acuuacuacu augaagggga cccgauaucu gccuacaagg aagucaucgg 11700

ccacaaucuu uuugaucuua agagaacaag cuucgagaag cuggccaagu uaaaucucag 11760

caugucagua cucggagccu ggacuagaca caccaguaaa agacuacuac aagacugugu 11820

caaugugggu guuaaagagg gcaacuggcu aguuaaugca gauagacuag uaaguagcaa 11880

gacuggaaau agguacauac ccggagaggg ccacacccug caagggagac auuaugaaga 11940

acugguguug gcaagaaaac agaucaacaa cuuucaaggg accgacaggu acaaucuagg 12000

cccaauaguc aauauggugu uaaggaggcu gagagucaug augaugaccc ugauagggag 12060

agggguauga gcgcggguaa cccgggaucu ggacccgcca guagaacccu guuguagaua 12120

acacuaauuu uuuuuuauuu auuuagauau uacuauuuau uuauuuauuu auuuauugaa 12180

ugaguaagaa cugguacaaa cuaccucaag uuaccacacu acacucauuu uuaacagcac 12240

uuuagcugga aggaaaauuc cugacgucca caguuggacu aagguaauuu ccuaacggcc 12300

c 12301

<210> 2

<211> 25

<212> RNA

<213> classical swine fever viru

<400> 2

cccaccucga gaugcuaugu ggacg 25

<210> 3

<211> 43

<212> RNA

<213> Artificial sequence

<400> 3

gagcagaagc ccaccucgag augcuaugug gacgagggca ugc 43

<210> 4

<211> 43

<212> RNA

<213> Artificial sequence

<400> 4

gagcagaagc ccgccucgag augcuaugug gacgagggca ugc 43

<210> 5

<211> 43

<212> RNA

<213> Artificial sequence

<400> 5

gagcagaagc ccaccucgag auccuaugug gacgagggca ugc 43

<210> 6

<211> 43

<212> RNA

<213> Artificial sequence

<400> 6

gagcagaagc ccaccucgag augcuaugug aacgagggca ugc 43

<210> 7

<211> 68

<212> DNA

<213> Artificial sequence

<400> 7

cgtccacata gcatctcgag gtgggataga tccgcgtagg tactaaccca cctcgagtat 60

tcctacgc 68

<210> 8

<211> 68

<212> DNA

<213> Artificial sequence

<400> 8

cgtccacata gcatctcgag gtgggataga tccgcgtagg tactaaccca cctcgagaat 60

tcctacgc 68

<210> 9

<211> 65

<212> DNA

<213> Artificial sequence

<400> 9

cgtccacata gcatctcgag gtgggacgag acgcgtaggt actaacccac ctcgagatcc 60

tacgc 65

<210> 10

<211> 68

<212> DNA

<213> Artificial sequence

<400> 10

cgtccacata gcatctcgag gtgggataga tccgcgtagg tactaaccca cctcgagatt 60

tcctacgc 68

<210> 11

<211> 68

<212> DNA

<213> Artificial sequence

<400> 11

cgtccacata gcatctcgag gtgggataga tccgcgtagg tactaaccca cctcgagatg 60

ccctacgc 68

Claims

1. A method for detecting long-chain nucleic acid for non-disease diagnosis purposes, comprising the steps of:

(2) Reverse transcription of the RNA of the sample to be detected is carried out to obtain the DNA of the sample to be detected, the DNA of the sample to be detected is taken as a template, isothermal amplification is carried out with a hairpin of the self-primer amplification template, and the content of long-chain nucleic acid in the sample to be detected is calculated according to the fluorescence signal intensity of an amplified product;

Wherein the long-chain nucleic acid is a nucleic acid sequence with a base length of more than 1000;

the hairpin nucleotide sequence of the self-primer amplification template is as follows:

HP-11nt:5'-CGTCCACATAGCATCTCGAGGTGGGATAGATCCGCGTAGGTACTAACCCACCTCGAGTATTCCTACGC-3' (SEQ ID NO. 7); or (b)

HP-12nt:5'-CGTCCACATAGCATCTCGAGGTGGGATAGATCCGCGTAGGTACTAACCCACCTCGAGTATTCCTACGC-3' (SEQ ID NO. 8); or (b)

HP-13nt:5'-CGTCCACATAGCATCTCGAGGTGGGACGAGACGCGTAGGTACTAACCCACCTCGAGATCCTACGC-3' (SEQ ID NO. 9); or (b)

HP-14nt:5'-CGTCCACATAGCATCTCGAGGTGGGATAGATCCGCGTAGGTACTAACCCACCTCGAGATTTCCTACGC-3' (SEQ ID NO. 10); or (b)

HP-15nt：5'-CGTCCACATAGCATCTCGAGGTGGGATAGATCCGCGTAGGTACTAACCCACCTCGAGATGCCCTACGC-3'(SEQ ID NO.11)；

The isothermal amplification reaction procedure in step (2) is: amplifying for 60min at 36-38 ℃.

2. The method according to claim 1, wherein the long-chain nucleic acid is an RNA fragment having a base length of more than 1000.

3. The detection method according to claim 1 or 2, wherein the isothermal amplification reaction system in step (2) is:

Wherein the 10 XNt.AiwI endonuclease buffer contains 50mM CH ₃ COOK,20mM Tris-acetate, 10mM Mg (CH ₃COO)₂, 100. Mu.g/mL BSA, pH 7.9;

The Klenow fragment (3 '. Fwdarw.5' exo-) polymerase buffer contains 10mM Tris-HCl,50mM NaCl,10mM MgCl ₂, 1mM dithiothreitol and has a pH of 7.9.

4. The method according to claim 3, wherein the long-chain nucleic acid is a classical swine fever virus genome and/or an RNA fragment thereof.

5. A set of hairpin self-primer amplified template for detecting long-chain nucleic acid, wherein the hairpin self-primer amplified template has a nucleotide sequence of:

HP-12nt:5'-CGTCCACATAGCATCTCGAGGTGGGATAGATCCGCGTAGGTACTAACCCACCTCGAGAATTCCTACGC-3' (SEQ ID NO. 8); or (b)

HP-15nt：5'-CGTCCACATAGCATCTCGAGGTGGGATAGATCCGCGTAGGTACTAACCCACCTCGAGATGCCCTACGC-3'(SEQ ID NO.11)。

6. A detection preparation, which is characterized in that the detection preparation contains the self-primer amplification template hairpin according to claim 5.

7. The detection formulation of claim 6, wherein the hairpin sequence of the self-primer amplification template is shown in SEQ ID NO. 9.

8. Use of the detection formulation of claim 6 or 7 in the preparation of a swine fever virus detection kit.

9. The use according to claim 8, wherein the swine fever virus comprises an RNA fragment of the sequence shown in SEQ ID No. 2.