NL2030190B1 - Primer sets, probe, kit and application for detecting porcine delta coronavirus - Google Patents

Abstract

Disclosed is a porcine delta coronavirus detection primer sets, probe, kit and application, and 5 belongs to the field of biotechnology. The detection primer sets and probe comprise primer sets consisting of FIP, BIP, F3, B3 and LoopF with nucleotide sequences as shown in SEQ ID NO: 1- 5 respectively, and a probe as shown in SEQ ID NO: 6. According to the invention, RNA bases which can be combined with the target gene are designed at the corresponding sites of the probe, and when they are specifically and complementarily combined, the RNase H2 enzyme is activated 10 to be cleaved, and the reporter fluorescent group and the quenching fluorescent group are separated to generate fluorescent signals; no fluorescence signal is generated when no specific binding occurs; In this reaction mechanism, the designed primer sets and probe can realize rapid and quantitative detection of porcine delta coronavirus with high specificity and sensitivity.

Description

Primer sets, probe, kit and application for detecting porcine delta coronavirus

TECHNICAL FIELD

The invention relates to the field of biotechnology, in particular toa kind of detection primer sets, probe, kit and application of porcine delta coronavirus.

BACKGROUND

Porcine Delta coronavirus (PDCoV) is a new type of porcine enterovirus, which can cause acute diarrhea, vomiting, dehydration and even death of newborn piglets. In February 2014,

PDCoV virus appeared in American pig farms and spread rapidly in the United States. Soon after, PDCoV was found in Korean pigs, and later in Chinese mainland and Thailand. At present, the worldwide prevalence of the disease is on the rise, causing huge economic losses to pig breeding. Clinical symptoms of PDCoV are not easily distinguished from TGEV and

PEDV, so it is necessary to rely on accurate diagnostic techniques to detect and differentiate them.

At present, there are two main detection methods for PDCoV: pathogen detection and serum antibody detection. Among them, pathogen detection techniques mainly include routine

RT-PCR, nested -PCR, real-time PCR and immunohistochemical analysis. Serum antibody detection techniques are mainly indirect immune ELISA. The diagnostic accuracy of serum antibody detection technology is relatively high, but its sensitivity and specificity can't meet the needs of virus detection. In practice, PCR-based technology will have some disadvantages such as long time consumption, heavy workload and easy pollution. Therefore, the invention of a rapid, specific and sensitive detection method for PDCoV has an important application prospect.

Loop-mediated isothermal amplification (LAMP) is a new type of nucleic acid amplification method, which is characterized by designing multiple specific primers for multiple regions of the target gene, under the action of strand displacement DNA polymerase (Bst2.0 WarmStart®

DNA polymerase), the nucleic acid can be amplified 10°10 times in about 15-60 minutes at a constant temperature of 60-65°C, which is characterized by simple operation, strong specificity and easy detection of products. The LAMP primer sets are generally composed of inner primers

FIP (F1c+F2) and BIP (B1c+B2), outer primers F3 and B3, and loop primer LoopF/LoopB. The loop primer is a primer designed between F1c and F2 or between B1c and B2. It is mainly used to greatly improve the efficiency of isothermal amplification under the premise that the normal extension reaction of LAMP is started. However, the current common LAMP technology cannot achieve real-time fluorescent quantitative probe detection of PDCoV.

SUMMARY

The purpose of the present invention is to provide a kind of LAMP primer sets, probe, kit and application for detecting porcine delta coronavirus, in order to solve the problems existing in the prior art, using real-time fluorescent quantitative LAMP detection primer sets and probes, rapid quantitative detection of porcine delta coronavirus with high specificity and sensitivity is realized.

In order to achieve the above objectives, the present invention provides the following solutions:

The present invention provides detection primer sets and probes, including nucleotide sequences such as the primer sets consisting of FIP, BIP, F3, B3 and LoopF shown in 1-5 and the probe shown in SEQ ID NO:6.

Preferably, the 5'end and 3'end of the probe respectively carry the fluorescent group FAM and the quencher group BHQ1.

The present invention also provides an amplification kit for detecting porcine delta coronavirus, which includes the detection primer sets and probe.

The invention also provides the application of the detection primer sets and probe in the preparation of a product for detecting porcine delta coronavirus.

Preferably, the product includes a kit or reagent.

Preferably, the detection of porcine delta coronavirus includes the following step(1) obtain the RNA of the sample to be tested; (2) Using the RNA as a template, using the detection primer sets and probe of claim 1 or 2 or the kit of claim 3 to amplify the biological sample to determine whether it contains porcine delta coronavirus.

Preferably, the amplification system includes: Isothermal Amplification Buffer (10x)2.5uL,

Bst 2.0 WarmStart DNA polymerase 1 pL, WarmStart® RT reverse transcriptase 0.5uL, RNase

H2 enzyme 0.3L, dNTPs 5pL, MgSO, 1.5uL, FIP+BIP primer 4pL, F3+B3 primer 0.5uL, LoopF 1.5L, probe 0.3uL, RNA template 2uL, ddH20O 5.9 JL.

Preferably, the amplification conditions are: reaction at 64°C for 30-60min.

The invention discloses the following technical effects: (1) The invention utilizes Bst 2.0 WarmStart® DNA polymerase and WarmStart® RT reverse transcriptase to realize isothermal amplification at 64°C. (2) According to the fluorescent group modified loop primer probe designed by the invention, RNA bases which can be combined with target gene sites are designed at corresponding sites, and when they are specifically combined complementarily, RNase H2 enzyme is activated to be cleaved, and the reporting fluorescent groups and quenching fluorescent groups are separated to generate fluorescent signals; when no specific binding occurs, no fluorescence signal is generated, which can not only be observed in real time by fluorescence quantitative amplification instrument, but also make the method have very good specificity. (3) The kit provided by the invention has rapid reaction, and the reaction can be completed within 40min minutes, and the fastest reaction can be completed within 20min minutes. (4) The kit provided by the invention has good specificity, and has negative reaction to transmissible gastroenteritis virus (TGEV), porcine reproductive and respiratory syndrome virus (PRRSV), classical swine fever virus (CSFV), swine acute diarrhea syndrome coronavirus (SADS-CoV) and porcine rotavirus (PoRV); the sensitivity is high, and the lowest RNA template of 10 copies/uL PDCoV can be detected, which is 10-100 times higher than that of ordinary RT-

PCR method, and equivalent to qPCR method of TagMan probe. (5) The probe fluorescence quantitative LAMP kit for real-time quantitative detection of

PDCoV provided by the invention can quickly and sensitively detect PDCoV. The kit is simple to operate, quick to react, easy to observe the reaction results, good in specificity, capable of real- time quantitative detection of PDCoV, very suitable for export quarantine, food hygiene and field detection of livestock farms, and easy to be widely popularized and applied.

BRIEF DESCRIPTION OF THE FIGURES

In order to more clearly explain the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present invention, and for ordinary technicians in the field, other drawings can be obtained according to these drawings without creative efforts.

Fig. 1 is the optimization result diagram of Mg?*, in which: setting different final concentrations of MgSO., a: 8mm; b: 6mM; c: 4mM; d: 2mM;

Fig. 2 is a graph of dNTP optimization results, where: set different final concentrations of dNTPs, a: 2.4mM; b: 2.0mM; c: 1.6mM; d: 1.4mM; e: 1.2mM; f: negative control;

Fig. 3 shows the optimization results of RNase H2 enzyme dosage, where: set different final concentrations of RNase H2 enzyme, a: 4.0U/mL; b: 3.2U/mL; c: 2.4U/mL; d: 1.6U/mL; e: 0.8U/mL;

Fig. 4 shows the results of temperature optimization, where different reaction temperatures are set, a: 60°C; b: 61°C; c: 62°C; d: 83°C; e: 64°C; f: 65°C;

Fig. 5 shows the results of probe optimization, in which: probes with different final concentrations, a: 0.16 uM; b: 0.12 uM; c: 0.08 uM; d: 0.04 uM; e: negative control;

Fig. 6 is a graph of specific results, where A: PDCoV; B: Porcine Epidemic Diarrhea Virus (PEDV); C: Transmissible Gastroenteritis Virus (TGEV); D: Porcine Reproductive and

Respiratory Syndrome Virus (PRRSV); E: Classical Swine Fever Virus (CSFV); Swine Acute

Diarrhea Syndrome Coronavirus (SADS-CoV) and Porcine Rotavirus (PRoV); G: Negative

Control.

Fig. 7 is the sensitivity result graph, in which: the standard RNA of PDCoV is diluted 10 times and tested according to the following copy number, a: 1x10° copies/uL; b: 1x10°copies/uL; c: 1x10* copies/pL; d: 1x10° copies/pL; e: 1x10? copies/uL; f: 1x10 copies/uL;

Fig. 8 shows the position of the primers of the present invention in the conserved region of the N gene of PDCoV.

DESCRIPTION OF THE INVENTION

Various exemplary embodiments of the present invention will now be described in detail.

The detailed description should not be considered as a limitation to the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and embodiments of the present invention.

It should be understood that the terms described in the present invention are only used to describe specific embodiments and are not used to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value within the stated range and any other stated value or intermediate value within the stated range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art in the field of the present invention.

Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe methods and/or materials related to the documents. In the event of conflict with any incorporated document, the content of this invention shall prevail.

Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present specification, which is obvious to those skilled in the art. Other embodiments derived from the description of the present invention will be obvious to the skilled person. The specification and embodiments of this application are only exemplary.

As used herein, "comprising", "including", "having", "containing", etc., are all open terms, which means including but not limited to. (1) Primers were synthesized by Shanghai Sangon Biotech Service Co., Ltd.; Bst 2.0

WarmStart® DNA polymerase and WarmStart® RT reverse transcriptase were purchased from

New England Biolabs; RNase H2 enzyme was purchased from IDT company; fluorescent quantitative PCR instrument (Roche company, article number: LightCycler® 96 SW 1.1) was kept in our laboratory.

(2) Porcine Deltacoronavirus (PDCoV), Transmissible gastroenteritis virus (TGEV), Porcine reproductive and respiratory syndrome virus (PRRSV), Classical swine fever virus (CSFV),

Swine acute diarrhea syndrome coronavirus (SADS-CoV) and Porcine rotavirus (PoRV) are kept in the Institute of Animal Health, Guangdong Academy of Agricultural Sciences. 5

Embodiment 1 1. Primer design

According to the principle of primer design, the primer design is based on the sequence of the conservative region of the N gene of PDCoV using Primer Explorer V5 software, according to our experience, ensure that the GC content of the primers is between 40% and 60%, and the

Tm value of each primer is about 55°C. Through preliminary screening, we obtained a set of primers with better theoretical values. The primers and probes were synthesized by Shanghai

Sangon Biotech Service Co., Ltd. The synthesized primers were diluted with sterilized tri- distilled water to a concentration of 10 uM and stored at -20°C. Including a pair of internal primers (FIP and BIP), a pair of external primers (F3 and B3), a loop primer Loop F and a probe primer, see Table 1. The primer positions are shown in Figure 8, where FIP is composed of F1c and F2, and BIP is composed of B1c and B2, where F1c is the reverse complementary sequence of F1, and B1c, B2c, and B3c are reverse complementary sequences of B1, B2, and

B3.

Table 1 Primer name and sequence ~~ Primername Sequence (553)

FIP (SEQID NO:1) CGAGACCGGTTGCCAAATACCTCGTAAGACCCAGCATCAAGC

BIP (SEQ ID NO:2) GCCAATGTCGGCTCTGCAGACAGGCACATGTCTGGCTAG

F3 (SEQ ID NO:3) CCAGGAAACGCGACCAATC

B3 (SEQ ID NO:4> TGGCCAGCGAAAAGCATT

Loop F (SEQ ID NO:5) GGGTAAAGTCCGCTTGGGA probe (SEQ ID NO:6> TGAGAAGACGGGTA(FAM)TGGC(RNA base) TGATC-BHQ1 2. Extraction of viral genome RNA

A small amount of RNA extraction kit from Axygen Company was used to extract the total

RNA template of virus samples in each experimental group according to the kit instructions, which was used for subsequent experiments. 3. Establishment of LAMP detection method (1) Optimization of the reaction system

The concentration ratios of MgSO.4, probes, dNTPs, and RNase H2 were optimized sequentially, and the results obtained were analysed on a fluorescent quantitative PCR instrument.

By setting different final concentrations of MgSOa: 2 mM, 4 mM, 6 mM, 8 mM, and at the same time replacing the nucleic acid template with water to set a blank control (see Figure 1); different final concentrations of dNTPs: 1.2mM, 1.4mM, 1.6mM, 2mM, 2.4mM, and set a blank control with water instead of nucleic acid template (see Figure 2}; the final concentrations of

RNase H2 enzyme: (a) 0.8u/ml, (b) 1.6um/I, (c) 2.4u/ml, (d) 3.2u/ml and (e) 4.0u/ml, and the blank control was set with water instead of nucleic acid template (see Figure 3). The detection condition is 64°C for 60min. Results As shown in Figure 1- Figure 3, according to the experimental results, the optimized detection system was finally determined, as shown in Table 2.

Table 2 Amplification reaction system ~~ Reagent = Usageamount Use Final (pL) concentratio concentration n 10x Isothermal Amplification Buffer ~~ 25 ~~ 10x 1x

MgSO4 1.5 100 mM 6mM dNTP 5 10mM 2mM

FIP+BIP 4 10 uM 1.8uM

LoopF 1.5 10 uM 0.6uM

F3+B3 0.5 10 uM 0.2uM

Probe 0.3 10 uM 0.12uM

Bst DNA polymerase 1 8000U/L 320U/mL

WarmStart®aRTx 0.5 15000U/L 600U/mL

RNase H2 enzyme 0.3 2U/uL 2.4U/mL

RNA 2

H2© 5.9

Total 25 (2) Optimization of reaction temperature

In order to obtain the optimal reaction temperature, the amplification reaction was placed at 60.0°C, 61.0°C, 82.0°C, 63°C, 64°C, 65°C, and the reaction time was 60 min. At the same time, water was used to replace the nucleic acid template as a blank control. Determine the optimal reaction temperature from multiple repeated experiments. The results are shown in Figure 4, indicating that the optimal reaction temperature is 64°C. 4. The establishment of amplification detection methods (1) Synthesis of the probe

The 5'of the Probe was modified by FAM and the 3'by BHQ1, and synthesized by Shanghai

Sangon Biotech Service Co., Ltd. (2) Optimization of probe concentration

In order to reduce the non-specificity of Probes and ensure the detection effect at the same time, probe with different final concentrations: 0.04 u m, 0.08 uM, 0.12 HM and 0.16 uM were added into the amplification reaction system, and then detected by fluorescence quantitative

PCR instrument to screen the best probe concentration. The amplification conditions were 64°C and 60 min.

The results are shown in Figure 5. The optimal probe concentration was finally determined to be 0.12 pM. 5. Analysis of specificity and sensitivity of amplification detection system (1) Specificity analysis

Use the genomic RNA of PDCoV, TGEV, PRRSV, CSFV, SADS-CoV and PRoV as templates for specific analysis of the detection system, and set a blank control with water instead of nucleic acid template. The reaction system was prepared according to Table 2 above, and the reaction conditions were the optimized conditions determined in the above step 3, and the fluorescence quantitative PCR instrument was used for detection.

The result is shown in Figure 6: The primer amplification reaction product using PDCoV genomic RNA as a template has a specific curve (see Figure 6 A), however, no specific curves of TGEV, PRRSV, CSFV, SADS-CoV and PRoV templates appear (see B, C, D, E, F in Figure 6), and no specific curves of the blank control appear (see G in Figure 8). The results show that the specificity of the detection system is good, and PDCoV can be specifically detected. (2) Sensitivity analysis

Using the pGEM-T easy-N plasmid containing the full length of the PDCoV N gene as a template, using T-start-F and PDCoV-N-R primers (T-start-F primer sequence is tgtaatacgactcactatagggcga (SEQ ID NO:7), the PDCoV-N-R primer sequence is ctacgctgctgattcctgctttatc (SEQ ID NO:8)), carry out PCR amplification, and then purify the PCR product containing the RNA polymerase promoter, and then use it as a template for in vitro transcription. Use the mMESSAGEMMACHINE® kit to perform transcription according to the operating instructions. After transcription, use lithium chloride precipitation method to remove unbound nucleotides and most of the protein, purify and recover RNA, and determine the RNA template concentration by UV spectrophotometer to be 18.1ng/pL, then, the transcribed RNA template was diluted 10 times gradient with sterilized pure water, and 2uL of sample solution was taken from each diluted sample for LAMP amplification detection (see the system and primers shown in Table 2), ordinary RT-PCR detection (see Table 3) and TagMan probe fluorescence quantitative PCR detection (see Table 4).

Table 3 Ordinary RT-PCR reaction systems ~~ 2xOneStepMx ~~ 5uL

One Step Enzyme Mix 0.5L

PDCoV-N-F (10uM) 0.4 pL

PDCoV-N-F(10uM) 0.4 pL

Template RNA 2 uL ddH:0 1.7L ~~ Totalcapacty ~~ foul

The general RT-PCR program is as follows: 50°C 30min reverse transcription; 94°C pre- denaturation 3 min; 94°C 30 s, 58°C 30 s, 72°C 1 min is a cycle, running 35 cycles; finally, extend at 72°C for 5 min; store at 4°C. (The kit used for ordinary RT-PCR is Novozan HiScript II

One Step RT-PCR Kit (Cat. No.: P611-011)).

The primers for real-time PCR by TagMan probe method are:

PDCoV-M-F:5'- cgaccacatggctccaattc-3'(SEQ ID NO:9);

PDCoV-M-R:5'-cagctcttgcccatgtagct-3'(SEQ ID NO: 10);

Probe PDCoV-probe: 5'-FAM-cacaccagtcgttaagcatggcaagc-TAMRA-3'(SEQ ID NO:11); using PDCoV-M-F and PDCoV-M-R as primers for Real-time PCR, the reaction system is shown in Table 4:

Table 4 TagMan probe method fluorescence quantitative Real-time PCR reaction system © Reagent (concentration) ~~ Dosage (uL» © 2xOneStepQProbeMx 5

One Step Q Probe Enzyme Mix 0.5

PDCoV-M-F (10puM> 04

PDCoV-M-R (10uMD 0.4

PDCoV-probe (10uM)> 0.4

RNA 2

RNase-free ddH20 1.3

Total 10uL

The reaction procedure of the TagMan probe method for fluorescence quantitative Real- time PCR is as follows: 45°C 10min reverse transcription; 95°C pre-denaturation 10min; 95 °C for15s, 80°C for 45 s, 72 °C for 20 s is a cycle, run 40 cycles, and finally extend at 37 °C for 30 s; store at 4 °C. (The kit used in the TagMan probe method is Novozan HiScript II One Step gRT-PCR Probe Kit (Cat. No.: Q222-01)).

The sensitivity of the above-mentioned real-time fluorescent quantitative LAMP detection method, ordinary RT-PCR and TagMan fluorescent quantitative Real-time PCR detection method were compared respectively. The results showed that the sensitivity of real-time fluorescent quantitative LAMP detection by probe method was 10-100 times that of ordinary RT-

PCR method. Compared with TagMan probe fluorescent quantitative Real-time PCR, the sensitivity of real-time fluorescent quantitative LAMP detection method is the same, with the lowest detection of 10 copies/L. In a word, the probe-based real-time fluorescent quantitative

LAMP detection method provided by the invention has the same sensitivity as TagMan probe- based fluorescent quantitative Real-time PCR detection method, but compared with TagMan probe-based fluorescent quantitative Real-time PCR detection method, the probe-based real- time fluorescent quantitative LAMP detection method has the advantages of simpler operation (isothermal reaction at 64°C) and shorter reaction time {only 40 min). In addition, in the real-time fluorescent quantitative LAMP detection method of probe method, the probes are designed with

RNA bases that can be combined with the target gene DNA at the corresponding positions.

When the two forms specific complementary combination in the reaction, RNase H2 enzyme is activated and cleaved, and the reporter fluorescent group and quenching fluorescent group are separated to generate fluorescent signals, which greatly reduces the occurrence of non-specific reactions.

The above-mentioned embodiments only describe the preferred mode of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, all kinds of modifications and improvements made by ordinary technicians in the field to the technical scheme of the present invention should fall within the protection scope determined by the claims of the present invention.

SEQLTXT-4

SEQUENCE LISTING

<110> Institute of Animal Health, Guangdong Academy of Agricultural Sciences <110> Maoming Branch, Guangdong Laboratory for Lingnan Modern Agriculture <120> Primer set, probe, kit and application for detecting porcine delta coronavirus <130> PCDV NL <160> 11 <170> PatentIn version 3.5 <21e> 1 <211> 42 <212> DNA <213> Artificial sequence <400> 1 cgagaccggt tgccaaatac ctcgtaagac ccagcatcaa gc 42 <2105 2 <211> 39 <212> DNA <213> Artificial sequence <400> 2 gccaatgtcg gctctgcaga caggcacatg tctggctag 39 <2105 3 <211> 19 <212> DNA <213> Artificial sequence <400> 3 ccaggaaacg cgaccaatc 19 <2105 4 <211> 18 <212> DNA <213> Artificial sequence <400> 4 tggccagcga aaagcatt 18 <210>5 5 <211> 19

Pagina 1

SEQLTXT-4 <212> DNA <213> Artificial sequence <400> 5 gggtaaagtc cgcttggga 19 <210> 6 <211> 23 <212> DNA <213> Artificial sequence <400> 6 tgagaagacg ggtatggctg atc 23 <210> 7 <211> 25 <212> DNA <213> Artificial sequence <400> 7 tgtaatacga ctcactatag ggcga 25 <210> 8 <211> 25 <212> DNA <213> Artificial sequence <400> 8 ctacgctgct gattcctgct ttatc 25 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <400> 9 cgaccacatg gctccaattc 20 <210> 10 <211> 21 <212> DNA <213> Artificial sequence <400> 10 cagctcttgc ccatgtagct t 21

Pagina 2

SEQLTXT-4 <210> 11 <211> 26 <212> DNA <213> Artificial sequence <400> 11 cacaccagtc gttaagcatg gcaagc 26

Pagina 3

Claims (8)

CONCLUSIONS Detection primer sets and probe, comprising the primer sets FIP, BIP, F3, B3 and LoopF having nucleotide sequences as set forth in SEQ ID NOS 1-5 and the probe having the nucleotide sequence set forth in SEQ ID NO:6. The detection primer sets and probe according to claim 1, wherein the 5' end and the 3' end of the probe contain the fluorescent group FAM and the quenching group BHQ1, respectively. A set comprising the detection primer sets and probe according to claim 1 or 2. Use of the detection primer sets and probe according to claim 1 or 2 for preparing articles for the detection of swine delta coronavirus. The use according to claim 4, wherein the articles comprise a kit or a reagent. The use according to claim 4, wherein the detection of porcine delta coronavirus comprises the steps of: (1) obtaining RNA from the sample to be tested; (2) using the RNA as template, using the detection primer sets and probe of claim 1 or 2 or the set of claim 3 to amplify the biological sample to determine whether the sample contains swine delta coronavirus. The use according to claim 8, wherein the amplification system comprises: 2.5 HI isothermal amplification buffer (10x), 1 µl Bst2.0 DNA polymerase, 0.5 µl WarmStarRTx, 0.3 µl RNase H2 enzyme, 5 µl dNTPs, 1 1/2 µl MgSO4, 4 µl FIP+BIP primer, 0.5 µl F3 + B3 primer, 1.5 µl LoopF, 0.3 µl probe, 2 µl RNA template, 5.9 µl or ddH2 O. 8. The use according to claim 8, wherein the amplification conditions are: a reaction for 30-60 minutes at a constant temperature of 64°C.