CN117551771A - Construction method and kit of single-ended anchored multiplex PCR amplicon library for detecting tumor low-frequency mutation - Google Patents
Construction method and kit of single-ended anchored multiplex PCR amplicon library for detecting tumor low-frequency mutation Download PDFInfo
- Publication number
- CN117551771A CN117551771A CN202311773336.7A CN202311773336A CN117551771A CN 117551771 A CN117551771 A CN 117551771A CN 202311773336 A CN202311773336 A CN 202311773336A CN 117551771 A CN117551771 A CN 117551771A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- upstream
- downstream
- enrichment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 230000035772 mutation Effects 0.000 title claims abstract description 32
- 238000007403 mPCR Methods 0.000 title claims abstract description 31
- 238000010276 construction Methods 0.000 title claims abstract description 24
- 108091093088 Amplicon Proteins 0.000 title claims abstract description 16
- 206010028980 Neoplasm Diseases 0.000 title claims abstract description 14
- 238000001514 detection method Methods 0.000 claims abstract description 24
- 238000012163 sequencing technique Methods 0.000 claims abstract description 20
- 206010058467 Lung neoplasm malignant Diseases 0.000 claims abstract description 10
- 201000005202 lung cancer Diseases 0.000 claims abstract description 10
- 208000020816 lung neoplasm Diseases 0.000 claims abstract description 10
- 238000011144 upstream manufacturing Methods 0.000 claims description 46
- 239000002773 nucleotide Substances 0.000 claims description 25
- 125000003729 nucleotide group Chemical group 0.000 claims description 25
- 238000000034 method Methods 0.000 claims description 15
- 230000003321 amplification Effects 0.000 claims description 14
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 14
- 230000000295 complement effect Effects 0.000 claims description 11
- 108090000623 proteins and genes Proteins 0.000 claims description 10
- 230000008439 repair process Effects 0.000 claims description 10
- 238000012408 PCR amplification Methods 0.000 claims description 8
- 239000003153 chemical reaction reagent Substances 0.000 claims description 6
- 230000008569 process Effects 0.000 claims description 5
- 210000004369 blood Anatomy 0.000 claims description 4
- 239000008280 blood Substances 0.000 claims description 4
- 230000036438 mutation frequency Effects 0.000 claims description 4
- 108090000790 Enzymes Proteins 0.000 claims description 3
- 102000004190 Enzymes Human genes 0.000 claims description 3
- 238000012216 screening Methods 0.000 claims description 3
- 238000004873 anchoring Methods 0.000 claims description 2
- 238000000605 extraction Methods 0.000 claims description 2
- 238000011451 sequencing strategy Methods 0.000 claims description 2
- 230000035945 sensitivity Effects 0.000 abstract description 7
- 238000013461 design Methods 0.000 abstract description 5
- 206010064571 Gene mutation Diseases 0.000 abstract description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 17
- 238000006243 chemical reaction Methods 0.000 description 15
- 108020004414 DNA Proteins 0.000 description 11
- 239000012634 fragment Substances 0.000 description 11
- 239000000047 product Substances 0.000 description 10
- 239000011324 bead Substances 0.000 description 8
- 238000005516 engineering process Methods 0.000 description 8
- 238000000137 annealing Methods 0.000 description 5
- 108020004707 nucleic acids Proteins 0.000 description 5
- 150000007523 nucleic acids Chemical class 0.000 description 5
- 102000039446 nucleic acids Human genes 0.000 description 5
- 238000002156 mixing Methods 0.000 description 4
- 238000000746 purification Methods 0.000 description 4
- 239000006228 supernatant Substances 0.000 description 4
- 238000005119 centrifugation Methods 0.000 description 3
- 238000004925 denaturation Methods 0.000 description 3
- 230000036425 denaturation Effects 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 208000005443 Circulating Neoplastic Cells Diseases 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 230000000875 corresponding effect Effects 0.000 description 2
- 238000012165 high-throughput sequencing Methods 0.000 description 2
- 230000006872 improvement Effects 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 108700019961 Neoplasm Genes Proteins 0.000 description 1
- 102000048850 Neoplasm Genes Human genes 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 238000007405 data analysis Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000006911 enzymatic reaction Methods 0.000 description 1
- 230000003211 malignant effect Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 208000002154 non-small cell lung carcinoma Diseases 0.000 description 1
- 210000002381 plasma Anatomy 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 238000004153 renaturation Methods 0.000 description 1
- 208000029729 tumor suppressor gene on chromosome 11 Diseases 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a construction method and a kit of a single-ended anchored multiplex PCR amplicon library for detecting tumor low-frequency mutation, belonging to the technical field of molecular biology. The invention constructs a multiplex PCR library construction method and a kit suitable for low-frequency mutation detection by utilizing a short Y joint consisting of a molecular tag and a general sequence, a specific capture primer and a primer set consisting of an enrichment primer with Index suitable for a sequencing platform. The invention designs the gene mutation capturing primer combination related to lung cancer, greatly improves the sensitivity and specificity of lung cancer MRD detection, and the single-end anchored multiplex PCR amplified library construction method and the kit improve the utilization rate of template molecules, reduce background noise, simplify experimental flow, reduce the operation difficulty of MRD detection and increase the sensitivity and accuracy of detection.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a construction method and a kit of a single-ended anchored multiplex PCR amplicon library for detecting tumor low-frequency mutation.
Background
Increasing the sensitivity of detection of small numbers of Circulating Tumor Cells (CTCs) or micro-circulating cell-free tumor DNA (ctDNA) allows MRD detection of various malignant patients. The MRD detection has high requirements on the specificity and sensitivity of the detection method due to the low content of MRD in blood plasma; various detection techniques are uneven, and the problems of higher technical threshold and long detection period exist. At present, a high-throughput sequencing technology (NGS) is the mainstream in the aspect of tumor gene detection, but a common double-end sequencing library building method with common meaning for NGS is low in joint connection efficiency of a short-fragment nucleic acid, an unknown sequence nucleic acid and a liquid sample with low concentration, low in template utilization rate and high in omission ratio.
Multiplex PCR is a PCR technique used to amplify multiple different DNA fragments simultaneously. The technology is an improvement technology based on the conventional PCR, and comprises the procedures of primer design, reaction system construction, reaction condition design and the like. In order to ensure the accuracy of multiplex PCR, the designed primers cannot be combined with each other or with the region except the target fragment on the template DNA; in addition, the design of the primers requires attention to the following points: primer specificity, primer length, annealing temperature, etc. The reaction system of multiplex PCR is basically the same as that of conventional PCR, and comprises template DNA, primers, dNTPs, thermostable DNA polymerase and the like. However, the reaction system of multiplex PCR requires higher concentrations of primers and dNTPs to support the amplification of multiple amplified fragments. Similar to conventional PCR, the reaction conditions for multiplex PCR include denaturation, renaturation, extension, and annealing. However, multiplex PCR requires higher annealing temperatures and longer extension times to support the amplification of multiple amplified fragments. With the development of PCR technology, techniques for rapidly amplifying adjacent fragments of known sequences based on a small piece of sequence information have emerged, one of which is anchor PCR (anchored PCR). In anchored PCR, one primer is a sequence-specific primer designed based on a known sequence, and the other primer is a non-specific primer designed based on a common feature of the sequences. Such a non-specific universal primer functions as an anchor primer attached to one end thereof, and thus is called a misdefined primer, and a sequence bound to an anchor primer is called an anchor sequence. The single-end anchored multiplex PCR technology improves the multiplex PCR technology, optimizes the PCR system and primer design, introduces a single molecular tag, rapidly and repeatedly amplifies the adjacent fragments of the known sequence, improves the utilization rate of short fragment nucleic acid, fully covers known and unknown variation sites, and has the characteristics of strong specificity, high amplification efficiency and easy realization of clinical detection.
Disclosure of Invention
Aiming at the technical problems of low joint connection efficiency, low template utilization rate, high omission factor and the like of short-fragment nucleic acid, unknown sequence nucleic acid and a liquid sample with low concentration in a common double-end sequencing library construction method of a high-throughput sequencing technology, the invention aims to provide a single-end anchored multiplex PCR amplicon library construction method and a kit for detecting tumor low-frequency mutation.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a construction method of a single-ended anchored multiplex PCR amplicon library for detecting tumor low-frequency mutation, which comprises the following steps:
(1) Extracting a blood ctDNA sample, and purifying after connecting a short Y joint through end repair and end addition A;
(2) Designing corresponding specific capturing primers according to the selected target gene region, and carrying out single-end anchored multiplex PCR capturing on the product obtained in the step (1);
(3) And (3) carrying out second round PCR amplification enrichment on the product obtained in the step (2) to obtain the single-ended anchored multiplex PCR amplicon library for detecting the tumor low-frequency mutation.
Further, the End Repair and End addition of "A" described in step (1) is accomplished by the End Repair & A-Tailing Enzyme Mix reaction system.
Further, the short Y linker in step (1) comprises an upstream primer F and a downstream primer R which are partially complementary, wherein the upstream primer F comprises a short Y linker complementary sequence, and the nucleotide sequence is shown as SEQ ID NO. 1; the downstream primer R comprises a general sequence 1, a molecular tag (underlined base in bold) and a short Y-adaptor complementary sequence, and the nucleotide sequence is Wherein the molecular tag is 8-16 bp long and is formed by A, T, C, G random arrangement and combination, but four continuous identical bases do not appear.
Further, the target gene region in step (2) includes a mutation region strongly associated with lung cancer.
Further, the specific capture primers in step (2) include an upstream capture primer and a downstream capture primer; the upstream capturing primer comprises an upstream general sequence 2 and an upstream specific primer, and the nucleotide sequence is shown as SEQ ID NO. 4-93; the downstream capturing primer is a universal primer, and the nucleotide sequence is shown as SEQ ID NO. 3.
Further, the PCR amplification enrichment process of step (3) is performed using enrichment primers, including an upstream enrichment primer and a downstream enrichment primer; the upstream enrichment primer comprises a P5 end joint sequence, an IndexD sequence and a general sequence 2; the downstream enrichment primer included the P7 terminal sequence, the IndexN sequence, and the universal sequence 1.
Further, the above-mentioned linker sequence may be any commonly used linker sequence or a newly developed linker sequence, and the linker sequence may be different depending on the sequencing platform, so long as it is sufficient to enable sequencing of the target sequencing platform. In addition, the adaptor sequence further comprises an Index sequence with the length of 8bp, which is used for distinguishing different DNA samples, and the base composition of the Index sequence is not particularly limited, so that the different DNA samples can be distinguished, namely: the Index sequences in the upstream universal primers differ in the primer set used to construct the amplicon library for the same DNA sample. Alternatively, the linker sequence comprises part of the sequences of the P5 and P7 linkers.
Further, the nucleotide sequence of the upstream enrichment primer in the step (3) is shown as SEQ ID Nos. 94-102, and the nucleotide sequence of the downstream enrichment primer is shown as SEQ ID Nos. 103-114.
The invention also provides a detection method suitable for blood screening gene low-frequency mutation, wherein the single-end anchored multiplex PCR amplicon library obtained by the construction method is sequenced by an Illumina sequencing platform, and experimental data obtained by bioinformatics are analyzed and compared to obtain mutation sites and mutation frequencies in a target region.
Further, the Illumina sequencing platform comprises Illumina NextSeq 500, illumina Hiseq2000, illumina Hiseq2500 and Illumina Novaseq; the sequencing strategy was PE150.
In another aspect, the invention provides a kit for single-ended anchored multiplex PCR amplicon library construction, the kit comprising the following components: ctDNA extraction reagent, end repair, addition of "A" and enzyme and buffer needed for short Y joint connection, single end anchoring multiplex PCR captured primer and reagent and amplification enriched primer and reagent.
Further, the short Y joint comprises an upstream primer F and a downstream primer R which are partially complementary, wherein the upstream primer F comprises a short Y joint complementary sequence, and the nucleotide sequence is shown as SEQ ID NO. 1; the downstream primer R comprises a primerComplementary sequences with sequence 1, molecular tag (underlined base bolded) and short Y-linker, nucleotide sequence Wherein the molecular tag is 8-16 bp long and is formed by A, T, C, G random arrangement and combination, but four continuous identical bases do not appear.
Further, the specific capture primer comprises an upstream capture primer and a downstream capture primer; the upstream capturing primer comprises an upstream general sequence 2 and an upstream specific primer, and the nucleotide sequence is shown as SEQ ID NO. 4-93; the downstream capturing primer is a universal primer, and the nucleotide sequence is shown as SEQ ID NO. 3.
Further, the amplification-enriched primers comprise an upstream enrichment primer and a downstream enrichment primer; the upstream enrichment primer comprises a P5 end joint sequence, an IndexD sequence and a general sequence 2; the downstream enrichment primer included the P7 terminal sequence, the IndexN sequence, and the universal sequence 1.
Further, the nucleotide sequence of the upstream enrichment primer is shown as SEQ ID Nos. 94-102, and the nucleotide sequence of the downstream enrichment primer is shown as SEQ ID Nos. 103-114.
The invention also provides application of the kit in detecting tumor low-frequency mutation.
The invention has the beneficial effects that:
the invention provides a construction method of a single-end anchored multiplex PCR library with a molecular tag, which can trace back to original DNA according to tag sequences and alignment positions after library construction and sequencing are completed, and can discriminate whether mutation is real or random error introduced by aligning common sequences of a plurality of sequences derived from the same DNA. When a low-frequency target mutation site needs to be detected, the accuracy of mutation detection can be greatly improved by using a molecular tag, meanwhile, the utilization rate of a ctDNA sample template is greatly increased by using a single-end anchored multiplex PCR technology, the template with low-frequency mutation can be effectively captured, enriched and identified, the high sensitivity and the specificity of MRD detection are ensured, and the related gene mutation (lower than 0.05%) of the low-frequency lung cancer can be detected; the kit and the library establishment flow provided by the invention are also simple to operate and convenient to popularize and apply.
Drawings
In order to more clearly illustrate the embodiments of the present invention, the drawings to which the embodiments relate will be briefly described.
FIG. 1 is a schematic diagram of a library construction method of single-ended anchored multiplex PCR.
Detailed Description
In order that those skilled in the art will better understand the technical solutions of the present application, the present invention will be further described with reference to examples, and it is apparent that the described examples are only some of the examples of the present application, not all the examples. All other embodiments, which can be made by one of ordinary skill in the art based on the embodiments herein without making any inventive effort, shall fall within the scope of the present application.
In the following examples, unless otherwise indicated, all methods conventional in the art are described. In the quantitative experiments of the following examples, three repeated experiments were set up, and the results were averaged.
Example 1
In this example, 3 ctDNA samples (sample numbers are C1, C2 and C3 are all non-small cell lung cancer standard samples) are used as detection objects, an amplicon library of 3 samples is constructed by using the primer and library construction method provided by the invention, and sequencing is performed, and the hot spot mutation region selected in this example is shown in table 1; corresponding primers were designed based on the mutation sites of the screened genes, and the designed specific primer sequences are shown in Table 2. All specific primer sequences are combined to form a fixed Panel related to lung cancer tumor, and the mutation condition of the lung cancer patient gene can be detected.
TABLE 1 information table of 20 hot spot mutation regions strongly correlated with lung cancer
The specific process is as follows:
(1) The extracted cfDNA samples were subjected to end repair using an enzymatic reaction, 3' end plus "a", the specific components are shown in table 2.
TABLE 2 cfDNA sample for end repair and 3' end addition of "A" component
Reaction conditions: the temperature of the heat cover is 75 ℃,30 ℃ for 30min,65 ℃ for 30min and 4 ℃ for ever.
The cfDNA subjected to end repair and added with "a" described above was ligated to a short Y linker, and specific components are shown in table 3.
TABLE 3 cfDNA plus "A" and short Y linker attached components
Reaction conditions: the thermal cap was closed or uncapped, 15min at 22℃and ever at 4 ℃. The ligation product was purified by 0.8Xmagnetic beads to give ligation product.
Preparing 80% ethanol with absolute ethanol and Nuclean-Free Water, standing at room temperature (using freshly prepared 80% ethanol for purification of magnetic beads), taking out purified magnetic beads from a refrigerator at 4deg.C, mixing well, balancing at room temperature for 30min, and mixing well the purified magnetic beads which have been balanced to room temperature;
adding 88 mu L of magnetic beads into the product, sucking or vortex mixing uniformly, and standing for 5min at room temperature; placing the PCR tube on a magnetic rack for 3min after instantaneous centrifugation, and clarifying the solution; maintaining the PCR tube on a magnetic rack, carefully removing the supernatant, adding 200 mu L of 80% ethanol solution into the PCR tube, and standing for 30s;
keeping the PCR tube to remove the supernatant on the magnetic frame, adding 200 mu L of 80% ethanol solution into the PCR tube, standing for 30s, and removing the supernatant;
covering a tube cover, performing instantaneous centrifugation, centrifuging the residual ethanol to the bottom of the tube, placing the PCR tube on a magnetic rack, carefully using a 10 mu L pipette to remove the residual ethanol at the bottom, and taking care not to suck the residual ethanol to magnetic beads; keeping the PCR tube on a magnetic frame, standing for 3-5 min at room temperature, airing the magnetic beads, and completely volatilizing the residual ethanol;
adding 13 mu LNuclease-Free Water, taking the PCR tube off the magnetic rack, sucking or vortex mixing uniformly, and standing at room temperature for 2min;
performing instantaneous centrifugation, placing the PCR tube on a magnetic rack for 2min, and clarifying the solution; mu.L of the supernatant was pipetted into a new PCR tube and labeled for the next reaction.
The short Y linker comprises an upstream primer F and a downstream primer R with partial complementarity, wherein the upstream primer F comprises a short Y linker complementary sequence, and the nucleotide sequence is (5 '-3') TGGATAAAGTCGGA (SEQ ID NO. 1). The downstream primer R comprises a general sequence 1, a molecular tag (underlined base in bold) and a short Y-adaptor complementary sequence, and the nucleotide sequence is Wherein the molecular tag is 8-16 bp long and is formed by random arrangement and combination of A, T, C, G, but four continuous identical bases do not appear.
(2) Single-ended anchored multiplex PCR capture: the products of the previous step were subjected to the first round of PCR amplification, and the amplification reaction system is shown in Table 4.
TABLE 4 PCR amplification reaction System
Reaction conditions: the temperature of the heat cover is 105 ℃, and the temperature of the heat cover is 95 ℃ for 3min of pre-denaturation; denaturation at 95℃for 20 s; extension/annealing at 65-60 ℃ for 1min (delta T= -0.5 ℃/cycle), 10cycles; denaturation at 95℃for 20s, extension/annealing at 60℃for 2min,5cycles;72℃for 5min and 4℃for ever. The PCR products were subjected to 0.9 Xbead screening to obtain the first round amplification products.
The specific capture primer comprises an upstream capture primer and a downstream capture primer; the upstream capture primers include upstream universal sequence 2 and upstream specific primers, and the specific sequences are shown in Table 5. The downstream capture primer is a universal primer comprising universal sequence 1 and nucleotide sequence (5 '-3') TTCAGACGTGTGTGCTCTTCCGATCT (SEQ ID NO. 3).
TABLE 5 90 specific primer lists designed based on strongly lung cancer-related 20 hot spot genes
By adopting the primer pair for PCR amplification, the PCR amplification efficiency of each mutation region can be well ensured, and the construction efficiency of a library and the sequencing accuracy are improved.
(3) Library enrichment and amplification: the amplification products of the previous step were subjected to a second round of amplification, and the amplification reaction system is shown in Table 6.
TABLE 6 amplification reaction System
Reaction conditions: the temperature of the hot cover is 105 ℃ and 95 ℃ for 1min; beginning at 98 ℃ for 20 s; 60 ℃ for 30s,72 ℃ for 1min,10cycles;72℃for 5min and 4℃for ever. The PCR amplified product is purified by 0.9 Xmagnetic beads to obtain a DNA sample library, and the DNA sample library is subjected to concentration determination and fragment length determination by a fragment analyzer and then is used for sequencing analysis.
The enrichment primer comprises an upstream enrichment primer and a downstream enrichment primer; the upstream enrichment primer comprises a P5 end joint sequence, an IndexD sequence and a general sequence 2; the downstream enrichment primer included the P7 terminal sequence, the IndexN sequence, and the universal sequence 1.
The upstream enrichment primer sequences are shown in Table 7 (the bolded bases in the sequence are the positions of the index tag sequence).
TABLE 7 upstream enrichment primer sequences
The downstream enrichment primer sequences are shown in Table 7 (the bolded bases in the sequence are where the index N tag sequence is located).
TABLE 8 downstream enrichment primer sequences
(4) On-machine sequencing and result analysis
The amplicon library, which was constructed as described above, was selected for PE150 on-line using the Illumina Novaseq. Each sample required a 2G data volume for high depth sequencing. The average sequencing depth of each sample was not less than 100000×. Sequencing data were converted, quality controlled, aligned with the reference genome, and mutation sites and mutation frequencies were summarized. The final experimental results are shown in table 9.
TABLE 9 sequencing data quality control and mutation detection results
| Sample numbering | Data volume | Average depth | >Q30(％) | Capture efficiency |
| C1 | 1.59G | 71185.38 | 94.5 | 42.12 |
| C2 | 1.73G | 67484.02 | 94.5 | 37.64 |
| C3 | 2.06G | 89733.2 | 94.68 | 42.13 |
Example 2
In order to test the detection efficiency of the library construction method on the low-frequency mutation sites, 7 point mutations are selected from the selected lung cancer gene Panel for testing. According to different initial library construction amounts, 20ng of standard ctDNA with mutation frequencies of 0.01%, 0.05%, 0.1% and 0.5% are respectively taken for sample library construction, each group is repeated for 3 times, the experimental process comprises end repair, 3' end addition A, short Y joint connection, purification after connection, first round PCR and purification, second round PCR and purification and the sequencing and data analysis processes of the machine, and the detection sensitivity can reach 0.05%, and the results are shown in Table 10.
TABLE 10 detection of mutation sites
The results show that the library construction method and the kit provided by the invention have the advantages of good detection performance, high capture efficiency, excellent detection accuracy and sensitivity, and good application to detection of low-frequency mutation.
While the invention has been described in detail with reference to the specific embodiments thereof, there may be room for improvement in the practice thereof, and it will be apparent to one skilled in the art that suitable modifications may be made to the experimental procedures without departing from the spirit of the invention, which is intended to be within the scope of the invention as claimed.
Claims (10)
1. A method of constructing a single-ended anchored multiplex PCR amplicon library for detecting tumor low frequency mutations, comprising the steps of:
(1) Extracting a blood ctDNA sample, and purifying after connecting a short Y joint through end repair and end addition A;
(2) Designing corresponding specific capturing primers according to the selected target gene region, and carrying out single-end anchored multiplex PCR capturing on the product obtained in the step (1);
(3) And (3) carrying out second round PCR amplification enrichment on the product obtained in the step (2) to obtain the single-ended anchored multiplex PCR amplicon library for detecting the tumor low-frequency mutation.
2. The method of claim 1, wherein the short Y linker in step (1) comprises an upstream primer F and a downstream primer R having partial complementarity, wherein the upstream primer F comprises a short Y linker complementary sequence, and the nucleotide sequence is shown in SEQ ID NO. 1; the downstream primer R comprises a general sequence 1, a molecular tag (underlined base in bold) and a short Y-adaptor complementary sequence, and the nucleotide sequence is (5 '-3') TTCAGACGTGTGCTCTTCCG ATCTNN… NNTCCGACTTTATCCAT, wherein the molecular tag is 8-16 bp long, is formed by A, T, C, G being arranged and combined arbitrarily, but four consecutive identical bases do not occur.
3. The method of claim 1, wherein the target gene region of step (2) comprises a mutant region strongly associated with lung cancer; the specific capture primer comprises an upstream capture primer and a downstream capture primer; the upstream capturing primer comprises an upstream general sequence 2 and an upstream specific primer, and the nucleotide sequence is shown as SEQ ID NO. 4-93; the downstream capturing primer is a universal primer, and the nucleotide sequence is shown as SEQ ID NO. 3.
4. The method of claim 1, wherein the PCR amplification enrichment process of step (3) is performed using an enrichment primer comprising an upstream enrichment primer and a downstream enrichment primer; the upstream enrichment primer comprises a P5 end joint sequence, an IndexD sequence and a general sequence 2; the downstream enrichment primer included the P7 terminal sequence, the IndexN sequence, and the universal sequence 1.
5. The construction method according to claim 4, wherein the nucleotide sequence of the upstream enrichment primer in the step (3) is shown in SEQ ID Nos. 94-102, and the nucleotide sequence of the downstream enrichment primer is shown in SEQ ID Nos. 103-114.
6. A detection method suitable for blood screening gene low-frequency mutation is characterized in that single-end anchored multiplex PCR amplicon library obtained by the construction method of any one of claims 1-5 is sequenced by an Illumina sequencing platform, and experimental data obtained are analyzed and compared by bioinformatics to obtain mutation sites and mutation frequencies in a target area.
7. The method of claim 6, wherein the Illumina sequencing platform comprises Illumina next seq 500, illumina Hiseq2000, illumina Hiseq2500 and Illumina Novaseq; the sequencing strategy was PE150.
8. A kit for single end anchored multiplex PCR amplicon library construction according to any one of claims 1-5, characterized in that said kit comprises the following components: ctDNA extraction reagent, end repair, addition of "A" and enzyme and buffer needed for short Y joint connection, single end anchoring multiplex PCR captured primer and reagent and amplification enriched primer and reagent.
9. The kit of claim 8, wherein the short Y-adaptor comprises an upstream primer F and a downstream primer R having partial complementarity, the upstream primer F comprising a short Y-adaptor complementary sequence having a nucleotide sequence set forth in SEQ ID No. 1; the downstream primer R comprises a general sequence 1, a molecular tag (underlined base in bold) and a short Y-adaptor complementary sequence, and the nucleotide sequence is (5 '-3') TTCAGA CGTGTGCTCTTCCGATCTNN…NNTCCGACTTTATCCAT, wherein the molecular tag is 8-16 bp long and is formed by A, T, C, G random arrangement and combination, but four continuous identical bases do not appear;
the specific capture primer comprises an upstream capture primer and a downstream capture primer; the upstream capturing primer comprises an upstream general sequence 2 and an upstream specific primer, and the nucleotide sequence is shown as SEQ ID NO. 4-93; the downstream capturing primer is a universal primer, and the nucleotide sequence is shown as SEQ ID NO. 3;
the amplification-enriched primers comprise an upstream enrichment primer and a downstream enrichment primer; the upstream enrichment primer comprises a P5 end joint sequence, an IndexD sequence and a general sequence 2; the downstream enrichment primer included the P7 terminal sequence, the IndexN sequence, and the universal sequence 1.
10. Use of a kit according to claim 8 or 9 for detecting tumor low frequency mutations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311773336.7A CN117551771A (en) | 2023-12-21 | 2023-12-21 | Construction method and kit of single-ended anchored multiplex PCR amplicon library for detecting tumor low-frequency mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311773336.7A CN117551771A (en) | 2023-12-21 | 2023-12-21 | Construction method and kit of single-ended anchored multiplex PCR amplicon library for detecting tumor low-frequency mutation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117551771A true CN117551771A (en) | 2024-02-13 |
Family
ID=89812786
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311773336.7A Pending CN117551771A (en) | 2023-12-21 | 2023-12-21 | Construction method and kit of single-ended anchored multiplex PCR amplicon library for detecting tumor low-frequency mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117551771A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117844933A (en) * | 2024-03-07 | 2024-04-09 | 上海复迪生生命科学有限公司 | Multiplex PCR primer group for detecting lung tumor related gene variation and application thereof |
-
2023
- 2023-12-21 CN CN202311773336.7A patent/CN117551771A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117844933A (en) * | 2024-03-07 | 2024-04-09 | 上海复迪生生命科学有限公司 | Multiplex PCR primer group for detecting lung tumor related gene variation and application thereof |
| CN117844933B (en) * | 2024-03-07 | 2024-06-11 | 上海复迪生生命科学有限公司 | Multiplex PCR primer group for detecting lung tumor related gene variation and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108517567B (en) | Adaptor, primer group, kit and library construction method for cfDNA library construction | |
| CN117551771A (en) | Construction method and kit of single-ended anchored multiplex PCR amplicon library for detecting tumor low-frequency mutation | |
| CN113025701B (en) | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene | |
| CN112029837A (en) | Kit for detecting SNP (Single nucleotide polymorphism) sites based on locked nucleic acid modified recombinase-mediated isothermal amplification method and detection method thereof | |
| CN112941635A (en) | Second-generation sequencing library building kit and method for improving library conversion rate | |
| CN109686404B (en) | Method and device for detecting sample confusion | |
| CN113667714B (en) | Target area capturing method, kit and sequencing method | |
| CN113186257A (en) | Constant-temperature hybridization method after PCR amplification based on liquid chip technology | |
| CN111979353A (en) | Library construction method for sequencing novel coronavirus SARS-CoV-2 full-length genome | |
| CN114277114B (en) | Method for adding unique identifier in amplicon sequencing and application | |
| CN116463408A (en) | ABO gene amplification primer, amplification system, amplification method, sequencing library construction method and sequencing method | |
| CN113862394B (en) | RPA detection method for tomato infertility virus | |
| CN115896356A (en) | Reagent for detecting nucleic acid of novel coronavirus, influenza A virus and influenza B virus and application of reagent | |
| CN113025702B (en) | Early screening method and kit for ankylosing spondylitis susceptibility genes | |
| CN112779322A (en) | Gene mutation detection kit based on non-fluorescence labeled probe and high-resolution melting curve, detection method and application thereof | |
| CN110777194A (en) | Denaturation-enhanced digital droplet PCR method for detecting highly fragmented samples | |
| CN111074354A (en) | Construction method of low-abundance DNA mutation sequencing library | |
| CN116179710B (en) | Primer group for BRCA1/2 gene mutation detection based on high-throughput sequencing platform, library construction and cyclization method | |
| US20240200126A1 (en) | Primer group and method for detecting single-base mutations | |
| CN112831558B (en) | Early screening method and kit for Crohn disease susceptibility genes | |
| CN113322353B (en) | RPA kit for detecting sweet potato pinnate mottle virus and sweet potato chlorotic stunt virus | |
| CN114085895B (en) | Detection primer for rapidly detecting MSI and kit thereof | |
| CN117737198A (en) | Construction method and kit of methylation-specific single-ended anchored multiplex PCR amplicon library | |
| CN112708664B (en) | Construction method and kit of multi-gene mutation sequencing library of lung cancer driving gene | |
| WO2020259455A1 (en) | Method for constructing pacbio sequencing library |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |