CN115491431A

CN115491431A - Detection kit for detecting Japanese encephalitis B virus nucleic acid based on gene editing technology and application

Info

Publication number: CN115491431A
Application number: CN202110671213.7A
Authority: CN
Inventors: 谢胜松; 赵书红; 李新云; 徐兵荣; 陶大刚; 潘文雅; 杨慧; 阮进学; 刘向东; 刘小磊
Original assignee: Guangxi Yangxiang Co ltd; Huazhong Agricultural University
Current assignee: Guangxi Yangxiang Co ltd; Huazhong Agricultural University
Priority date: 2021-06-17
Filing date: 2021-06-17
Publication date: 2022-12-20

Abstract

The invention discloses a detection kit for detecting Japanese encephalitis virus nucleic acid based on a gene editing technology and application thereof, wherein a crRNA with higher activity and a pair of amplification primers with high sensitivity and high specificity are obtained by screening, and an amplification reaction can be completed in a heating thermos cup by utilizing a CRISPR-Cas12a detection system and combining a double-labeled fluorescent probe (ROX). Finally, the detection result can be directly visible with naked eyes or fluorescence, the detection sensitivity for Japanese B encephalitis virus nucleic acid is 9 copies/microliter, and other viruses susceptible to pigs, such as ASFV, PRRSV, PDCoV, TGEV and the like, can be distinguished specifically. The invention has the advantages of convenient operation, simple equipment, low cost, time saving, high efficiency, high specificity, high sensitivity and the like, can be widely applied to all big pig breeding enterprises, improves the economic benefit of the breeding industry and provides convenience for early diagnosis.

Description

Detection kit for detecting Japanese encephalitis B virus nucleic acid based on gene editing technology and application

[ technical field ] A method for producing a semiconductor device

The invention belongs to the technical field of nucleic acid detection, and particularly relates to a detection kit for detecting Japanese B encephalitis virus nucleic acid based on a gene editing technology and application thereof.

[ background of the invention ]

Epidemic encephalitis B is a natural epidemic disease of zoonosis, takes blood sucking insects such as culex tritaeniorhynchus and the like as main vectors, and is one of the main infectious diseases epidemic in summer and autumn in China. The disease is an acute infectious disease mainly caused by central nervous system diseases, is clinically emergent, has symptoms of hyperpyrexia, disturbance of consciousness, convulsion, spasticity, meningeal stimulation and the like, has sequelae after the heavy patients are cured, and has great harm to children. Japanese encephalitis was first discovered in Japan in the 70's 19 th century, and thereafter has a pandemic every 10 years. The Japanese encephalitis vaccine is incorporated into a planned immunization program in 2008, the morbidity is relatively controlled, but the Japanese encephalitis vaccine is not high in vaccination rate due to insufficient vaccination execution strength in part of regions, particularly villages and towns with relatively poor epidemic prevention conditions. In addition, global climate is warmed, ecological environment is changed, mosquitoes are attracted, and the control difficulty of epidemic situation is increased.

At present, the laboratory detection method for encephalitis B in China mainly comprises virus separation and identification, serological detection, molecular biology technology and the like. (1) The virus separation and identification method is a classical method for detecting encephalitis B, and can accurately obtain main information of the virus, such as the genotype, mutation and the like. But the method is not favorable for the rapid detection of Japanese encephalitis due to low virus load, difficult separation, large workload, high requirements on test conditions, long detection time, more influencing factors and the like. (2) There are many serological tests, such as Complement Fixation Test (CFT), neutralization Test (NT), hemagglutination test (HI) and enzyme-linked immunosorbent assay (ELISA), which mainly detect specific antigens and antibodies in the serum and cerebrospinal fluid of Japanese encephalitis patients. Complement fixation test, neutralization test and hemagglutination inhibition test are conventional methods commonly used for epidemiological investigation, but the three methods need to collect two parts of serum in the acute phase and the convalescent phase for detection, the diagnosis is time-consuming and labor-consuming, and the purpose of early rapid diagnosis cannot be achieved. The ELISA method can detect specific Japanese encephalitis antibodies IgM and IgG, but the method is complex in operation, long in time consumption and low in sensitivity, so that the ELISA method cannot be used as an optimal rapid diagnosis method. (3) The molecular biology detection method mainly adopts a reverse transcription-polymerase chain reaction (RT-PCR) technology, and the RT-PCR is considered to be an effective early diagnosis method in the etiology diagnosis method at present. In the real-time fluorescent PCR developed in recent years, closed-tube detection can be realized by adding SYBR Green I fluorescent dye or a specific TaqMan fluorescent probe into a reaction system. Not only maintains the characteristics of sensitivity and the like of the traditional PCR technology, but also avoids false positive pollution and shortens the detection time. However, the PCR method requires expensive instruments and strict laboratory conditions, and is only equipped by large-scale comprehensive hospitals and scientific research institutions with excellent equipment, so that the application of the PCR method is limited, and the PCR method cannot fully play a role in disease prevention and control and community detection.

The rapid detection of nucleic acid occupies a great position in the aspects of early disease diagnosis, biotechnology application and the like, and is widely applied to the fields of medical and health industries, import and export quarantine, food processing and the like.

With the development of scientific technology, the CRISPR detection technology gradually replaces the original detection technology that requires nucleic acid amplification, and has the remarkable advantages of strong specificity, high sensitivity, time saving and cost saving. Such as PCR or RT-PCR, which have the highest utilization rate, have higher requirements for experimental equipment and experimenters compared with CRISPR detection technology, and thus, the realization of the basic and generalized application, namely the point-of-care testing (POCT), is difficult.

[ summary of the invention ]

The invention provides a detection kit for detecting Japanese encephalitis virus nucleic acid based on a gene editing technology and application thereof, wherein the detection kit is used for detecting the Japanese encephalitis virus nucleic acid by combining RT-LAMP technology with CRISPR-Cas12a, and a double-labeled fluorescent probe for directly detecting the nucleic acid by naked eyes or fluorescence visualization is used, so that a detection method and the kit for detecting the Japanese encephalitis virus nucleic acid by naked eyes, rapidness, sensitivity, high specificity are developed. The naked eye detection kit for Japanese B encephalitis virus nucleic acid developed by the invention has great application value.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

a primer set for detecting Japanese encephalitis virus nucleic acid based on a gene editing technique, the primer set comprising a RT-LAMP primer set for C gene:

c-1 primer set: the upstream sequence: 5 'ggagccatgaagttgtcaa-3';

the downstream sequence: 5' atccttggatcattgcc-;

c-2 primer set: the upstream sequence: 5 'flag-doped ggtggggaatcacgatacgtctgccaggggaagcttttgatg-doped flag 3';

the downstream sequence: 5 'caatccgatcgtcggctacatgtggtaagcttaggagcattcg-3';

c-3 primer pair: the upstream sequence: 5 'caatgtccgtgttgtatatg-3';

the downstream sequence: 5 'gtgagggacacctcatcgtac-doped 3';

the invention also provides a detection kit for detecting Japanese B encephalitis virus nucleic acid based on a gene editing technology, and the kit comprises the primer group;

the AmpLification system of the kit is 25 mu L, wherein 8U Bst 3.0 is 1 mu L, 10 xIsothermal AmpLification Buffer II is 2.5 mu L, 6mM MgSO ₄ 2.5 mu L of mixed solution of 1.4mM dNTP Mix and C gene primer group, 1 mu L of template and water without nuclease to be complemented to 25 mu L; the mixed solution of the C gene primer group is 2.5 mu L and is 10X primers, wherein the mixed solution of the C gene primer group comprises 1 mu L of C-1 primer group, 8 mu L of C-2 primer group and 2 mu L of C-3 primer group.

According to the kit for detecting the Japanese B encephalitis virus nucleic acid based on the gene editing technology, the amplification reaction is carried out in a heating type thermos cup, and the temperature range of the thermos cup is 25-100 ℃.

The invention also provides a method for detecting the Japanese B encephalitis virus, which adopts the primer group for detecting the Japanese B encephalitis virus nucleic acid based on the gene editing technology and the kit for detecting the Japanese B encephalitis virus nucleic acid based on the gene editing technology, and comprises the following steps:

1) Preparing a Japanese B encephalitis virus nucleic acid template;

2) Amplifying the amplification system of the kit and the primer group in a heating thermos cup under the reaction conditions of 40min at 65 ℃ and 10min at 80 ℃ to obtain an amplification product; extracting amplification products to carry out electrophoresis identification on agarose gel with the concentration of 1.5 percent, wherein the amplification products are positive when the agarose gel detects that a C gene template has a strip and a non-template control has no strip; negative when no band was detected for both the C gene template and the non-template control.

The invention also provides a naked eye visual detection method of Japanese encephalitis virus, which adopts the primer group for detecting Japanese encephalitis virus nucleic acid based on the gene editing technology and the kit for detecting Japanese encephalitis virus nucleic acid based on the gene editing technology, and comprises the following steps:

1) Preparing a Japanese B encephalitis virus nucleic acid template;

2) Amplifying in a heating type thermos cup under the reaction conditions of 40min at 65 ℃ and 10min at 80 ℃ by adopting the amplification system of the kit and the primer group to obtain an amplification product;

3) Carrying out Cas12a enzyme digestion reaction on the amplification product obtained in the step 2); the reaction system is as follows: mu.M of crRNA of the purified C gene, 3. Mu.L of the LAMP amplification product of step 2), 0.5. Mu.M of Cas12a, 20. Mu.M of ssDNA-reporter (ROX-N12-BHQ 2), 2. Mu.L of 10xNEB buffer 2.1, up to 20. Mu.L with nuclease-free water;

4) When the fluorescence signal of the C gene is detected under the conditions of no exciting light, blue light and ultraviolet light, the sample is proved to be positive; otherwise, the product is negative;

5) Carrying out enzyme digestion reaction on the amplification product obtained in the step 2) by using a test strip Cas12 a; the reaction system is as follows: 1 μ M of crRNA of the purified C gene, 3 μ L of the LAMP amplification product of step 2), 0.5 μ M of Cas12a, 2.5 μ M of ssDNA-reporter (FAM-N12-Biotin), 2 μ L of 10x NEB buffer 2.1, up to 20 μ L with nuclease-free water; after the reaction is carried out at 37 ℃ of 30min and 98 ℃ of 2min, transferring the reaction product into a 1.5mL centrifuge tube, adding 80 mu L of Milenia gene plasmid Assay Buffer, blowing and mixing uniformly for reacting at room temperature for 5min, and putting a test strip for identifying and detecting the result; when a control line and a detection line of the test strip simultaneously generate a red strip, the test strip is positive; when the control line of the test strip shows a red strip, the test line shows no red strip, which is negative;

the crRNA nucleic acid sequence of the C gene is as follows: 5 'and' cagacggttattcgtgattccacaccagatagaaat-.

The amplification reaction is carried out in a heating type thermos cup, and the temperature range of the thermos cup is 25-100 ℃.

Compared with the prior art, the invention has the following advantages:

1. the invention provides a primer group and a kit for detecting Japanese B encephalitis virus nucleic acid based on a gene editing technology and application thereof.

2. The invention utilizes RT-LAMP technology combined with CRISPR-Cas12a detection, uses a double-labeled fluorescent probe for direct naked eye or fluorescence visualization detection of nucleic acid, develops a detection method and a kit for naked eye, rapid, sensitive and high specificity detection of Japanese encephalitis virus nucleic acid, performs naked eye visualization or fluorescence visualization reaction after enzyme digestion of CRISPR-Cas12a, has the characteristics of low cost, time saving and simple observation, and is a rapid, accurate and direct naked eye visualization detection method of Japanese encephalitis virus.

3. The method has simple operation and equipment, has the advantages of low cost, time saving, high specificity, high sensitivity and the like, can be widely applied to various large breeding enterprises, improves the economic benefit of the breeding industry and provides convenience for early diagnosis. Therefore, the naked eye detection kit for Japanese encephalitis virus nucleic acid developed by the invention has great application value.

[ description of the drawings ]

Fig. 1 is a schematic diagram of the naked eye visual detection method of japanese b encephalitis virus of the present invention (CRISPR-Cas 12a based naked eye visual detection method of japanese b encephalitis virus, wherein:

A. japanese B encephalitis virus structure diagram, crRNA-1, crRNA-2, crRNA-3, crRNA-4 and crRNA-5 can target C gene amplification fragment;

B. japanese encephalitis B virus detection flow chart, after sample collection, carrying out 5 minutes of lysis treatment and 55 minutes of RAVI-CRISPR reaction on the sample;

C. screening for highly active crRNA targeting Japanese encephalitis virus C gene using ssDNA-reporter of modification type 5'ROX-N12-3' BHQ2; ssDNA activator represents a complementary single-stranded DNA molecule of crRNA, without PAM; DNA template represents the amplification product of the C gene, wherein C-crRNA-1, C-crRNA-2, C-crRNA-3, C-crRNA-4, C-crRNA-5 can target the amplified fragment of the C gene; the No excitation light refers to a picture shot by a camera under the condition that No excitation light source exists, namely the picture shot by the camera under natural light; the bulb light refers to a picture shot by a mobile phone in a blue light gel cutting instrument; UV light refers to pictures taken with a cell phone in an ultraviolet gel imaging system; UV light (Gel Imaging System) refers to pictures taken with a digital camera and associated software in an ultraviolet Gel Imaging System).

Fig. 2 is a schematic diagram for evaluating sensitivity of detecting japanese encephalitis virus C gene by combining RT-LAMP and CRISPR-Cas12 in the present invention (wherein:

A. RT-LAMP amplification and in vitro transcription of the C gene RNA product gel electrophoresis detection, lane 1:2000DNA marker; lane 2: 8.97X 10 ⁴ copies/. Mu.L, lane 3: 8.97X 10 ³ copies/. Mu.L, lane 4: 8.97X 10 ² copies/. Mu.L, lane 5: 8.97X 10 ¹ copies/. Mu.L, lane 6: 8.97X 10 ⁰ copies/. Mu.L, lane 7: 8.97X 10 ^-1 copies/. Mu.L, lane 8: a non-template control group;

B. performing naked eye visualization and fluorescence visualization detection through CRISPR-Cas12a by using the RT-LAMP amplification product in the graph A;

C. detecting a fluorescent signal on a multifunctional enzyme label instrument through CRISPR-Cas12a by using the RT-LAMP amplification product in the graph A;

D. performing RT-qPCR detection called 'gold standard' for corresponding RNA of the in vitro transcription C gene as a template;

E. the RT-LAMP product in the graph A is used for visual detection through the enzyme digestion reaction of the test strip Cas12 a.

FIG. 3 is a schematic diagram of the invention for evaluating specificity of RT-LAMP and CRISPR-Cas12 combined detection of Japanese B encephalitis virus C gene (wherein:

A. products of RT-LAMP amplification in vitro transcription of the C gene and the specificity of a C gene primer pair are detected and evaluated by gel electrophoresis;

B. naked eye visual detection by using CRISPR-Cas12a technology: test tube 1, using RNA transcribed in vitro by Japanese encephalitis virus as a template; a test tube 2, using ASFV nucleic acid as a template; test tube 3, using PRRSV nucleic acid as template; a test tube 4, which takes PDCoV nucleic acid as a template; test tube 5, using TGEV nucleic acid as template; a test tube 6, which takes PEDV nucleic acid as a template;

D. for visual detection by the test strip Cas12a enzyme digestion reaction using RT-LAMP product in the graph A).

FIG. 4 is a strategy diagram of the naked eye visual detection method of Japanese encephalitis virus of the present invention (establishing a strategy for realizing on-site rapid naked eye visual detection of Japanese encephalitis virus based on a CRISPR-Cas12a one-tube method):

A. a working procedure for detecting the Japanese encephalitis virus by a one-tube method by taking a heating type vacuum cup which is used in daily life as a heating device;

B. a mobile tool box for detecting Japanese encephalitis B virus by using a field CRISPR nucleic acid detection technology, and a model diagram of a CRISPR-Cas12a experimental result is quickly visualized by combining an APP field analysis with a machine learning algorithm;

C. using the in vitro transcribed RNA of each dilution as a template, using a fitting curve made by RT-qPCR and the RNA prepared by a nucleic acid rapid extraction method as a template to carry out the position of the CT value of the RT-qPCR in the fitting curve, and using NC as a non-template control group;

D. in vitro transcription of RNA using the RNA of FIG. C (copy number 8.97X 10) ⁴ ) And carrying out portable one-tube method CRISPR-Cas12a naked eye visualization detection in a thermos cup by taking RNA prepared by a nucleic acid rapid extraction method as a template, wherein NC is a non-template control group.

[ detailed description ] embodiments

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in detail below. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. This invention may, however, be embodied in many different forms than those specifically described herein, and it will be apparent to those skilled in the art that many more modifications are possible without departing from the spirit and scope of the invention.

Description of the terms

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

As used herein, the term "comprising" or "includes" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of or" consisting of 823030A ".

The term "CRISPR-Cas12a nucleic acid detection" refers to a technique for detecting a target nucleic acid molecule by means of a fluorescent signal detection system, wherein the CRISPR-Cas12a is used for specifically recognizing and cutting a target gene, and can nonspecifically cut a ssDNA fluorescent reporter gene.

The term "Cas12a" (also referred to as "Cpf 1"): cas12a is characterized by having both cis and trans single-stranded DNA cleavage activities as an endonuclease in the CRISR system. Cas12a is well suited for rapid nucleic acid detection studies.

The term "crRNA": refers to a small guide RNA molecule that can guide targeting of a specific nucleic acid molecule and activate Cas12a cleavage activity.

The term "ssDNA dual fluorescent reporter probe": it refers to a single-stranded DNA (ssDNA) of a certain length, to the bases of which the 5 'and 3' ends are added with a fluorescent group and a quenching group. The effect of the fluorescent probe in the CRISPR detection system is that after ssDNA is nonspecifically cut by Cas12a, the fluorescent group is separated from the quenching group, the quenching group removes the blocking effect on the fluorescent group, and the change of fluorescence intensity can be detected by means of a fluorescent signal detection device under the condition of light irradiation with specific wavelength.

The term "japanese encephalitis b": refers to a kind of neurophagy zoonosis caused by Japanese encephalitis virus infection.

Example 1:

screening high-activity crRNA of a targeted Japanese B encephalitis virus C gene:

the C gene (AF 014161.1) and genome (NC _ 001437.1) sequences of japanese b encephalitis virus were downloaded from NCBI database, respectively. Primer 5 software was used to design primer pairs for amplifying the C gene (table 1); for the PCR amplified region, 5 pieces of crRNA were designed using CRISPR-offinder software (https:// sourceform. Net/projects/CRISPR-offinder-v1-2 /), PAM was TTTV, and the in vitro transcription primer set was designed using the crRNA empty vector as a template (Table 1). From infected with Japanese encephalitis virus PK-15 cell supernatant, recovery and extraction of Japanese encephalitis virus genomic RNA and cDNA reverse transcription. The experimental procedure for detecting nucleic acid using CRISPR-Cas12 is as follows:

TABLE 1 PCR primers and primer pairs for amplification of sgRNA in vitro transcription templates

(1) PCR amplification of the C gene fragment: a50. Mu.L LPCR reaction solution was prepared, in which 25. Mu.L of Taq PCR Master Mix, 10pmol of each of the upstream and downstream primers, and 1. Mu.L of cDNA template (about 10 ng) were added. The PCR reaction program was set up as follows: 30 cycles of 94 ℃ 30s,57 ℃ 30s,72 ℃ 42s, and final extension at 72 ℃ for 5min.

(2) In vitro transcription of crRNA: the template for in vitro transcription of crRNA was amplified by PCR using a plasmid containing T7 promoter and crRNA scaffold as template and T7-crRNA-F and different crRNA-R primers (Table 1). The experimental reaction system was 50. Mu.L, with 25. Mu.L of Taq PCR Master Mix, 10pmoL of upstream and downstream primers, and 1. Mu.L (about 10 ng) of template for crRNA empty vector. The reaction conditions are as follows: 30 cycles of 94 ℃ 30s,55 ℃ 30s,72 ℃ 5s, and finally an extension at 72 ℃ for 5min. The PCR products were recovered using agarose gel DNA recovery kit (desert). According to HiScribe ^TM The Quick T7 High Yield RNA Synthesis Kit (NEB) synthesizes crRNAs under the following reaction conditions: the reaction was carried out at 37 ℃ for about 16h. And (3) purifying the transcribed sgRNAs by a phenol chloroform method, measuring the concentration, subpackaging, and freezing at-80 ℃ for long-term storage.

> pUC57-T7-crRNA (vector partial sequence)

T7 promoter sequence

CGAGGGGACGGTGATTGGAGATCGGTACTTCGCGAATGCGTCGAGATGGATCCCTAATACG

crRNA scaffold：19nt

ACTCACTATAGGGAATTTCTACTGTTGTAGATAATCGCATTGCCTCCGTAGTGAATTTTTTAAAGGGCCCGTCGAC TGCAGAGGCCTGCATGCAAGCTTATCGGATGCCGGGACCGACGAGTGCAGAGGCGTGCAAGCGAGCTTGGCGTAATCATG GTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA

(3) Cas12a cleavage reaction: in a 20. Mu.L reaction, crRNA (0.5. Mu.M) purified in step 2, cas12a (0.25. Mu.M), 3. Mu.L of PCR-amplified purified product in step 1, ssDNA-reporter (ROX-N12-BHQ 2) (20. Mu.M), NEB buffer 3.1, 0.5. Mu.L of RNase inhibitor were added. The negative control is set without adding the detection target gene template, namely without adding the C gene amplification product. The positive control is set to only add ssDNA activator, and corresponding sgRNA reaction primers such as C-crR-1R, C-crR-2R, C-crR-3R, C-crR-4R, C-crR-5R and the like replace target genes. The reaction was stopped at 37 ℃ for 15min and then at 98 ℃ for 2 min.

(4) And (3) detecting and judging a result: and (3) directly placing the centrifugal tube containing the reaction solution in a natural light environment, a blue light gel cutting instrument or an ultraviolet gel imaging instrument to detect the change of fluorescence intensity. Results as can be seen in fig. 1, fluorescence signals were detected by using ssDNA-reporter in example 1, visualized with naked eye or visualized with fluorescence, indicating that it can be used in CRISPR-Cas12a nucleic acid detection experiments. Comparing 5 crRNAs aiming at Japanese encephalitis virus C gene, the strongest signals of C-crRNA-4 and C-crRNA-5 are obtained under the condition that ssDNA-activator is used as a template of a target gene, and the strongest signals of C-crRNA-3 and C-crRNA-4 are obtained under the condition that an amplification product of the C gene is used as a template, so that the strongest fluorescence signal of C-crRNA-4 is comprehensively screened, and the highest detection activity of the crRNA is shown.

(5) As a result: as shown in fig. 1: comparing 5 crRNAs aiming at Japanese encephalitis B virus C gene, the crRNAs have obvious fluorescent signals. Wherein C-crRNA-4 and C-crRNA-5 change most obviously with naked eyes under the condition that ssDNA-activator is used as a template of a target gene. Under the condition that the amplification product of the C gene is used as a template, the fluorescence signal of C-crRNA-4 is relatively strongest, thereby indicating that the detection activity of the crRNA is highest.

Example 2:

assessing the sensitivity of detecting the Japanese encephalitis virus C gene by combining LAMP and CRISPR-Cas 12:

assessing the sensitivity of the method for detecting Japanese B encephalitis virus nucleic acid based on CRISPR-Cas12a technology naked eye visualization, transcribing RNA of a partial section of Japanese B encephalitis virus C gene in vitro, diluting the RNA into different copy numbers as a template, and carrying out CRISPR-Cas12a nucleic acid naked eye visualization or fluorescence visualization detection and test strip detection after RT-LAMP amplification. The experimental procedure was as follows:

TABLE 2 amplification of in vitro transcription templates, RT-LAMP amplification primer pairs and RT-qPCR primer pairs

(1) In vitro transcription of the C gene partial fragment RNA: cDNA which is recovered and extracted from PK-15 cell supernatant infected with Japanese encephalitis virus and subjected to reverse transcription is used as a template, PCR primer pairs of C genes are used for amplification, and an amplification product is cloned into a PMD18-T vector. Subsequently, in vitro transcribed templates were PCR amplified using IVT-C-F and IVT-C-R as primers (Table 2). The specific procedure is that the reaction system is 50. Mu.L, wherein the Taq PCR Master Mix is 25. Mu.L, the upstream and downstream primers are 10pmoL respectively, and the template is 1. Mu.L (about 10 ng). The reaction procedure is as follows: 30 cycles of 94 ℃, 30s of 57 ℃ and 55s of 72 ℃, final extension for 5min at 72 ℃, running gel by electrophoresis of PCR products on agarose gel with the concentration of 1 percent, and recovering target bands by using a Tianma gel recovery kit. Using HiScribe ^TM The Quick T7 High Yield RNA Synthesis Kit (NEB) synthesized the RNA of the C gene in vitro and reacted at 37 ℃ for about 4h. The transcribed RNA is purified by phenol chloroform method, and is frozen and stored at minus 80 ℃ for a long time after the concentration is measured.

(2) And (3) detecting RT-LAMP amplification sensitivity: the Japanese B encephalitis virus C gene RNA was diluted to 8.97X 10 ⁴ 8.97X 10 copies/microliter ³ 8.97X 10 copies/microliter ² 8.97X 10 copies/microliter ¹ Copy/microliter, 8.97X 10 ⁰ 8.97X 10 copies/microliter ^-1 Copy/microliter, etc., using RNA of C gene with different dilution times as template, and amplifying by using C-1-F/C-1-R, C-2-F/C-2-R, C-3-F/C-3-R (Table 2); the Amplification system was 25. Mu.L, where Bst 3.0 8U,10X Isothermal Amplification Buffer 2.5. Mu.L, mgSO ₄ 6mM, dNTP Mix 14mM each, primer Mix 2.5. Mu.L (10Xprimer: C-1-F/C-1-R4. Mu.L, C-2-F/C-2-R0.5. Mu.L, C-3-F/C-3-R1. Mu.L), template 1. Mu.L. The reaction conditions are as follows: 40min at 65 deg.C and 10min at 80 deg.C. After the reaction, 3. Mu.L of the amplification product was electrophoretically identified on a 2% agarose gel.

(3) In vitro transcription preparation of crRNPreparation of A: the in vitro transcribed template was PCR amplified using T7-crRNA-F and C-crRNA-4R primers, using plasmid containing T7 promoter and crRNA scaffold (pUC 57-T7-crRNA) as template. The specific procedure is that the reaction system is 50. Mu.L, wherein the Taq PCR Master Mix is 25. Mu.L, the upstream and downstream primers are 10pmoL respectively, and the template is 1. Mu.L (about 10 ng). The reaction procedure is as follows: 30 cycles of 94 ℃ 30s,55 ℃ 30s and 72 ℃ 5s, final extension at 72 ℃ for 5min, running the PCR product on agarose gel with the concentration of 2.5% for electrophoresis, and recovering the target band by using a desert gel recovery kit. Using HiScribe ^TM Quick T7 High Yield RNA Synthesis Kit (NEB) synthesized crRNAs and reacted at 37 ℃ for about 6h. The transcribed crRNAs are purified by a phenol chloroform method, and are subpackaged and frozen at the temperature of minus 80 ℃ for long-term storage after the concentration is determined.

(4) Cas12a cleavage reaction: in a 20. Mu.L reaction, RT-LAMP product (3. Mu.L) in step 2, crRNA (1. Mu.M) purified in step 3, cas12a (0.5. Mu.M), ssDNA-reporter (ROX-N12-BHQ 2, 20. Mu.M or ROX-N12-BHQ2, 2.5. Mu.M in the case of using a plate-labeling instrument) and NEB buffer 2.1,2. Mu.L were added. The reaction was stopped at 37 ℃ for 15min and then at 98 ℃ for 2 min.

(5) Test strip Cas12a enzyme digestion reaction: in a 20. Mu.L reaction, RT-LAMP product (3. Mu.L) in step 2, crRNA (2. Mu.M) purified in step 3, cas12a (0.5. Mu.M), ssDNA-reporter (FAM-N12-Biotin, 2.5. Mu.M), buffer NEB buffer 2.1,2. Mu.L were added. Reacting at 37 ℃ for 30min, and then terminating the reaction at 98 ℃ for 2 min; the reaction product was transferred to a 1.5mL centrifuge tube, 80. Mu.L of Milena Genline colloidal Assay Buffer was added, the mixture was blown up and mixed well and reacted at room temperature for 5min, and the strip was observed on a test strip.

(6) RT-qPCR detection sensitivity: the Japanese B encephalitis virus C gene RNA was diluted to 8.97X 10 ⁴ 8.97X 10 copies/microliter ³ 8.97X 10 copies/microliter ² 8.97X 10 copies/microliter ¹ Copy/microliter, 8.97X 10 ⁰ 8.97X 10 copies/microliter ^-1 Copying/microlitre and the like, performing RT-qPCR detection by taking RNA of C genes with different dilution times as a template and C-qPCR-F and C-qPCR-R as primers (table 2); the System is reverse in Bio-Rad CFX96TM Real-Time System InstrumentIt should be used. The specific steps are that the Reaction system is 20 mu L, wherein 2 XLuna Universal Probe One-Step Reaction Mix is 10 mu L, luna

RT Enzyme Mix (20X) 1. Mu.L, upstream and downstream primers 0.4. Mu.M each, monAmp TM ChemoHS qPCR Mix (Monad) 10. Mu.L, template 1. Mu.L. The reaction procedure is as follows: first, 45 cycles of 55 ℃ for 10min,95 ℃ for 1min, and then, 95 ℃ for 10s and 10 ℃ for 30 s.

(7) And (3) detecting and judging a result: directly placing the reaction solution in a natural light and blue light gel cutting instrument or an ultraviolet gel imaging system for detection, and comparing the intensity changes of signals detected by naked eye color and fluorescence visualization after amplification by using different copy templates; or reading the numerical value by using a multifunctional microplate reader (excitation light 576nm and emission light 601 nm); thereby determining the nucleic acid detection sensitivity.

(8) As a result: as shown in fig. 2: the RT-LAMP amplification product is detected by gel electrophoresis, the lowest sensitivity of detecting the Japanese B encephalitis virus C gene by RT-LAMP amplification gel electrophoresis is shown as a lane 6, and the corresponding dilution concentration of the C gene RNA template is 8.97 multiplied by 10 ⁰ Copy/microliter (fig. 2B); the C gene transcribes RNA in vitro to carry out RT-LAMP amplification, the RT-LAMP product is cut by Cas12a enzyme and detected by a natural light and blue light gel cutting instrument or an ultraviolet gel imaging system, the lowest sensitivity of the RT-LAMP product is a No. 5 PCR tube, namely the corresponding template dilution concentration is 8.97 multiplied by 10 ⁰ Copy/microliter. Further, the Cas12a enzyme digestion reaction solution is placed in a multifunctional enzyme labeling instrument, as can be seen from FIG. 2C, the result is the same as that in FIG. 2B, and the detection sensitivity can reach 8.97 × 10 ⁰ Copy/microliter; and in the test strip Cas12a enzyme digestion reaction, only the first 5 test strips are observed to have obvious detection lines, namely the detection sensitivity reaches 8.97 multiplied by 10 ⁰ Copy/microliter (fig. 2E); while the sensitivity was comparable to the RT-qPCR "gold standard" (FIG. 2D).

Example 3:

assessing specificity of LAMP and CRISPR-Cas12 combined detection of Japanese encephalitis virus C gene:

further, the specificity of the naked eye visualization detection of Japanese encephalitis virus technology by using CRISPR-Cas12a auxiliary nucleic acid is evaluated. Mainly tests whether the porcine reproductive and respiratory syndrome virus can distinguish the DNA or RNA virus in the prior pigs, and the designed experimental flow is as follows:

(1) In vitro transcription of the C gene partial fragment RNA: cDNA which is recovered and extracted from PK-15 cell supernatant infected with Japanese encephalitis virus and subjected to reverse transcription is used as a template, PCR primer pairs of C genes are used for amplification, and an amplification product is cloned into a PMD18-T vector. Subsequently, in vitro transcribed templates were PCR amplified using IVT-C-F and IVT-C-R as primers (Table 2). The specific procedure is that the reaction system is 50. Mu.L, wherein 25. Mu.L of Taq PCR Master Mix, 10pmoL of each of the upstream and downstream primers, and 1. Mu.L of template (about 10 ng). The reaction procedure is as follows: 30 cycles of 94 ℃, 30s of 57 ℃ and 55s of 72 ℃, final extension for 5min at 72 ℃, running gel by electrophoresis of PCR products on agarose gel with the concentration of 1 percent, and recovering target bands by using a Tianma gel recovery kit. Using HiScribe ^TM The RNA of the C gene was synthesized in vitro by Quick T7 High Yield RNA Synthesis Kit (NEB) and reacted at 37 ℃ for about 4 hours. The transcribed RNA is purified by phenol chloroform method, and is frozen and stored at minus 80 ℃ for a long time after the concentration is measured.

(2) Preparation of different viral genomic DNA or RNA: PRRSV, PDCoV, TGEV and PDEV are collected from the supernatant of infected susceptible cells, ASFV is extracted from clinical samples, and TAKARA virus genome extraction kits are respectively used for extracting DNA or RNA of each virus genome.

(3) LAMP or RT-LAMP amplification specificity detection: LAMP amplification is carried out by taking nucleic acids of JEV, PRRSV, PDCoV, TGEV, PDEV and ASFV extracted in the step (1) as templates and taking a primer group of a C gene as a primer respectively (Table 2). The Amplification system was 25. Mu.L, where Bst 3.0 8U,10X Isothermal Amplification Buffer 2.5. Mu.L, mgSO ₄ 6mM, dNTP Mix 14mM each, primer Mix 2.5. Mu.L (10Xprimer C-1-F/C-1-R4. Mu.L, C-2-F/C-2-R0.5. Mu.L, C-3-F/C-3-R1. Mu.L), template 1. Mu.L. The reaction conditions are as follows: 40min at 65 deg.C and 10min at 80 deg.C.

(4) Preparation of crRNA by in vitro transcription: the in vitro transcribed template was PCR amplified using T7-crRNA-F and C-crRNA-7R primers, using plasmid containing T7 promoter and crRNA scaffold (pUC 57-T7-crRNA) as template. The specific steps are that the reaction system is 50 mu L, wherein Taq PCR Master Mix 25. Mu.L, 10pmoL of each of the upstream and downstream primers, and 1. Mu.L of template (ca. 10 ng). The reaction procedure is as follows: 30 cycles of 94 ℃ 30s,55 ℃ 30s and 72 ℃ 5s, final extension at 72 ℃ for 5min, running the PCR product on agarose gel with the concentration of 2.5% for electrophoresis, and recovering the target band by using a desert gel recovery kit. Using HiScribe ^TM Quick T7 High Yield RNA Synthesis Kit (NEB) synthesized crRNAs and reacted at 37 ℃ for about 6h. The transcribed crRNAs are purified by a phenol chloroform method, and are subpackaged and frozen at the temperature of minus 80 ℃ for long-term storage after the concentration is determined.

(5) Cas12a cleavage reaction: in a 20. Mu.L reaction, RT-LAMP product (3. Mu.L) in step 2, crRNA (1. Mu.M) purified in step 3, cas12a (0.5. Mu.M), ssDNA-reporter (ROX-N12-BHQ 2, 20. Mu.M or ROX-N12-BHQ2, 2.5. Mu.M in the case of using a plate-labeling instrument) and NEB buffer 2.1,2. Mu.L were added. The reaction was stopped at 37 ℃ for 15min and then at 98 ℃ for 2 min.

(6) Test strip Cas12a enzyme digestion reaction: in a 20. Mu.L reaction, RT-LAMP product (3. Mu.L) in step 2, crRNA (2. Mu.M) purified in step 3, cas12a (0.5. Mu.M), ssDNA-reporter (FAM-N12-Biotin, 2.5. Mu.M), buffer NEB buffer 2.1,2. Mu.L were added. Reacting at 37 ℃ for 30min, and then terminating the reaction at 98 ℃ for 2 min; the reaction product was transferred to a 1.5mL centrifuge tube, 80. Mu.L of Milena Genline colloidal Assay Buffer was added, the mixture was blown up and mixed well and reacted at room temperature for 5min, and the strip was observed on a test strip.

(7) And (3) detecting and judging a result: directly placing the reaction solution in a natural light and blue light gel cutting instrument or an ultraviolet gel imaging system for detection, and comparing the strength change of signals visually detected by naked eye color and fluorescence after amplification by using different virus genomes as templates; or using a test strip to observe the strip; thereby determining the specificity of nucleic acid detection.

(8) The results are shown in FIG. 3: detecting the RT-LAMP or LAMP amplification product by gel electrophoresis, wherein the obvious step-shaped strips appear only in the lane 1, namely Japanese encephalitis B virus, as a template group, and the obvious step-shaped strips do not exist in other templates by a knife; through detection of a natural light and blue light gel cutting instrument or an ultraviolet gel imaging system, only the Japanese B encephalitis virus as a template group has obvious naked eye change and fluorescence signals, and the rest groups have no obvious naked eye change and fluorescence signals. Further, the Cas12a enzyme digestion reaction solution is placed in a multifunctional enzyme labeling instrument, as seen from FIG. 3C, the result is the same as that of FIG. 3B, and only Japanese encephalitis B virus is taken as a template group to generate an obvious fluorescent signal; and in the test strip Cas12a enzyme digestion reaction (figure 3D), only the first test strip has an obvious detection line, namely only the C gene of the Japanese encephalitis virus can be detected, and the test strip does not have cross reaction with the other four viruses susceptible to pigs, so that a false positive result is caused, which shows that the detection technology for detecting the Japanese encephalitis virus nucleic acid based on the CRISPR-Cas12a has strong specificity.

Example 4:

establishing a strategy for realizing on-site rapid detection of Japanese encephalitis B virus based on a RT-LAMP and CRISPR-Cas12 combined one-tube method:

in order to carry out detection in a non-laboratory and non-professional environment, a mobile work box of a field fluorescent CRISPR nucleic acid detection technology is developed, so that the field rapid detection condition can be achieved only by simple instrument facilities, and a detection report can be obtained on the spot. As shown in fig. 4B: in the movable detection tool box, a detection platform which is simple, quick, strong in specificity, high in sensitivity and low in cost can be achieved only by using portable instruments such as a pipettor, a small centrifuge, a heating type vacuum cup and the like.

Meanwhile, in order to prevent aerosol pollution generated by opening test tube cap transfer LAMP amplification products, a method for detecting Japanese encephalitis virus by combining a one-tube method with CRISPR-Cas12a naked eye visualization or fluorescence visualization is further evaluated and established; respectively carrying out RT-LAMP/LAMP amplification and CRISPR-Cas12a naked eye or enhanced fluorescence one-tube method detection by taking RNA of Japanese encephalitis B virus in-vitro transcription C partial gene and RNA extracted by a nucleic acid rapid extraction method as templates, and specifically comprising the following steps:

(1) In vitro transcription of the C gene partial fragment RNA: the cDNA obtained by recovering and extracting RNA from the supernatant of PK-15 cells infected with Japanese encephalitis virus and carrying out reverse transcription on the RNA is used as a template, PCR primer pairs (table 1) of C gene are used for amplification, and the amplification product is cloned to PMD18-T carrierIn the body. Subsequently, in vitro transcribed templates were PCR amplified using IVT-C-F and IVT-C-R as primers (Table 2). The specific procedure is that the reaction system is 50. Mu.L, wherein 25. Mu.L of Taq PCR Master Mix, 10pmoL of each of the upstream and downstream primers, and 1. Mu.L of template (about 10 ng). The reaction procedure is as follows: 30 cycles of 94 ℃, 30s of 57 ℃ and 55s of 72 ℃, final extension for 5min at 72 ℃, running gel by electrophoresis of PCR products on agarose gel with the concentration of 1 percent, and recovering target bands by using a Tianma gel recovery kit. Using HiScribe ^TM The RNA of the C gene was synthesized in vitro by Quick T7 High Yield RNA Synthesis Kit (NEB) and reacted at 37 ℃ for about 4 hours. The transcribed RNA is purified by phenol chloroform method, and is frozen and stored at minus 80 ℃ for a long time after the concentration is measured.

(2) Rapid extraction of japanese b encephalitis virus nucleic acid: PK-15 cell supernatants infected with Japanese B encephalitis virus were mixed uniformly with a quick extract DNA Extraction Solution (Lucigen) 1, and reacted at 95 ℃ for about 5min.

(3) In vitro transcription of crRNA: the in vitro transcribed template was amplified by PCR using T7 promoter and crRNA scaffold plasmid (pUC 57-T7-crRNA) as template and T7-crRNA-F and C-crRNA-4R as primers (Table 1). The method comprises the following specific steps: the reaction system was 50. Mu.L, with Taq PCR Master Mix 25. Mu.L, upstream and downstream primers each being 10pmoL, and crRNA empty vector as template 1. Mu.L (about 10 ng). The reaction procedure is as follows: 30 cycles of 94 ℃, 30s of 55 ℃ and 5s of 72 ℃, final extension for 5min at 72 ℃, running the PCR product on agarose gel with the concentration of 2.5% for electrophoresis, and recovering the target band by using a desert gel recovery kit. Using HiScribe ^TM The Quick T7 High Yield RNA Synthesis Kit (NEB) synthesized crRNAs and reacted at 37 ℃ for about 6h. The transcribed crRNAs were purified by phenol chloroform method, and were separately frozen at-80 ℃.

(4) One-tube method integrates LAMP amplification and Cas12a enzyme digestion reaction: taking Japanese encephalitis B virus in-vitro transcription C gene RNA and Japanese encephalitis B virus nucleic acid extracted by a nucleic acid rapid extraction method as templates, and carrying out one-tube integrated RT-LAMP amplification and Cas12a enzyme digestion reaction on the primer pairs in the table 1 and the crRNA purified in the step (3); the specific steps are that the reaction system is 25 uL, wherein the reagents required for RT-LAMP Amplification, namely 1 uL template (10 ng), 1 uL Bst 3.0DNA Polymerase (NEB), 2.5 uL 10 × Isothermal Amplification Buffer, 6mM MgSO4, 14mM dNTP Mix, 2.5 uLC gene primer set mixture (10Xprimer. Setting the temperature of the vacuum cup to 65 ℃, after reacting for 40min, instantly separating the Cas12a reaction solution in the cover into the LAMP reaction solution at the bottom, and uniformly mixing; the temperature of the vacuum cup is set to 40 ℃ and the reaction is carried out for 15min.

(5) And (3) RT-qPCR detection: the Japanese B encephalitis virus C gene RNA was diluted to 8.97X 10 ⁴ 8.97X 10 copies/microliter ³ 8.97X 10 copies/microliter ² 8.97X 10 copies/microliter ¹ 8.97X 10 copies/microliter ⁰ 8.97X 10 copies/microliter ^-1 Copying/microlitre and the like, performing RT-qPCR detection by taking RNA of C genes with different dilution times as a template and C-qPCR-F and C-qPCR-R as primers (table 2); the System was reacted in a Bio-Rad CFX96TM Real-Time System instrument. The specific steps are that the Reaction system is 20 mu L, wherein 2 XLuna Universal Probe One-Step Reaction Mix is 10 mu L, luna

RT Enzyme Mix (20X) 1. Mu.L, upstream and downstream primers 0.4. Mu.M each, monAmp TM ChemoHS qPCR Mix (Monad) 10. Mu.L, templates 1. Mu.L each. The reaction procedure is as follows: first, 45 cycles of 55 ℃ for 10min,95 ℃ for 1min, and then, 95 ℃ for 10s and 10 ℃ for 30 s.

(6) And (3) detecting and judging a result: and (3) directly placing the reaction solution in a natural light and blue light gel cutting instrument or an ultraviolet gel imaging system for detection, and observing the naked eye color and the strength change of a fluorescence visualization detection signal to evaluate the feasibility of establishing a method for detecting the Japanese encephalitis B virus by combining a one-tube method with CRISPR-Cas12a naked eye visualization or type fluorescence visualization.

(7) As a result: as shown in fig. 4: preparation method of nucleic acid by rapid extractionThe Japanese encephalitis virus nucleic acid is detected by RT-qPCR, and the copy number is 8.97 multiplied by 10 ¹ And 8.97X 10 ⁰ (fig. 4C); in the one-tube method combined with CRISPR-Cas12a naked eye visualization or fluorescence visualization detection of Japanese encephalitis virus, the results of the viral nucleic acid extracted by the nucleic acid rapid extraction method are consistent with the results of RNA of the in vitro transcribed C part gene, and obvious naked eye color change and enhanced fluorescence intensity signals are observed, so that the feasibility of integrating RT-LAMP amplification and Cas12a enzyme digestion reaction naked eye visualization or fluorescence visualization detection by the one-tube method is proved.

Thus, aerosol pollution caused by opening a test tube cover to transfer LAMP amplification products is basically avoided, meanwhile, the specificity is strong, the specific crRNA can activate the trans-cleavage activity of Cas12a only by recognizing amplified target nucleic acid molecules, and the false positive interference can be effectively reduced.

To summarize:

the inventor develops a naked eye visual detection method of Japanese B encephalitis virus through extensive and intensive research, and the method can be used for directly and visually detecting the Japanese B encephalitis virus by naked eyes. Use the thermos cup in daily life for heating device for the first time, developed portable detection Japanese encephalitis B virus's removal toolbox to combine the APP based on machine learning algorithm of earlier stage development to carry out result high accuracy and discern, accomplished reaction and result and interpreted integration.

The above examples are merely illustrative of several embodiments of the present invention, and the description thereof is more specific and detailed, but not to be construed as limiting the scope of the invention.

Sequence listing

<110> Guangxi Yangxi Xiang GmbH

Huazhong Agricultural University

<120> detection kit for detecting Japanese B encephalitis virus nucleic acid based on gene editing technology and application

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggagccatga agttgtcaa 19

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atcctctgga tcattgcc 18

<210> 3

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggtgggaatc acgataacgt ctgccagggg aagcttttga tg 42

<210> 4

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

caatcgacgt cggctacatg tggtaagctt aggacattcg 40

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

caatgtccgt gttgttaatg 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gtgaggacac tatcacgtac 20

<210> 7

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cagacgttat cgtgattccc acctatctac aacagtagaa at 42

Claims

1. A primer group for detecting Japanese B encephalitis virus nucleic acid based on a gene editing technology is characterized in that: the primer group comprises an RT-LAMP primer group aiming at the C gene:

c-1 primer set: the upstream sequence: 5 'ggagccatgaagttgtcaa-3';

the downstream sequence: 5 'atccttgggatacattgcc-3';

c-2 primer set: the upstream sequence: 5 'ggtggggaatcacgaacagtctgccaggggaagcttttgatg-3';

the downstream sequence: 5 'caatccgatcgtcggctacatgtggtaagcttaggagcattcg-3';

c-3 primer set: the upstream sequence: 5 '-caatgtccgttgtatg-3';

the downstream sequence: 5 'gtgaggacacttcacgtac-doped 3'.

2. A detection kit for detecting Japanese B encephalitis virus nucleic acid based on a gene editing technology is characterized in that: the kit comprises the primer set of claim 1;

the AmpLification system of the kit is 25 mu L, wherein 8U of Bst 3.0 is 1 mu L, 10 × Isothermal AmpLifiication Buffer II is 2.5 mu L, 6mM of MgSO ₄ 2.5 mu L of mixed solution of 1.4mM dNTP Mix and C gene primer group, 1 mu L of template and water without nuclease to be complemented to 25 mu L; the C gene primer group mixed solution is 2.5 mu L and is 10X primers, wherein the C-1 primer group is 1 mu L, the C-2 primer group is 8 mu L, and the C-3 primer group is 2 mu L.

3. The detection kit for detecting Japanese B encephalitis virus nucleic acid based on gene editing technology according to claim 2, characterised in that: the amplification reaction is carried out in a heating type thermos cup, and the temperature range of the thermos cup is 25-100 ℃.

4. A method for detecting Japanese B encephalitis virus, comprising: the use of claim 1 based on gene editing technology for the detection of Japanese B encephalitis virus nucleic acid primer set and claim 2 based on gene editing technology for the detection of Japanese B encephalitis virus nucleic acid kit, including the steps of:

1) Preparing a Japanese encephalitis virus nucleic acid template;

5. An naked eye visual detection method of Japanese B encephalitis virus is characterized by comprising the following steps: the use of claim 1 based on gene editing technology for the detection of Japanese B encephalitis virus nucleic acid primer set and claim 2 based on gene editing technology for the detection of Japanese B encephalitis virus nucleic acid kit, including the steps of:

1) Preparing a Japanese B encephalitis virus nucleic acid template;

2) Amplifying the amplification system of the kit and the primer group in a heating thermos cup under the reaction conditions of 40min at 65 ℃ and 10min at 80 ℃ to obtain an amplification product;

3) Carrying out Cas12a enzyme digestion reaction on the amplification product obtained in the step 2); the reaction system is as follows: 1 μ M of purified crRNA of the C gene, 3 μ L of the LAMP amplification product of step 2), 0.5 μ M of Cas12a, 20 μ M of ssDNA-reporter (ROX-N12-BHQ 2), 2 μ L of 10xNEB buffer 2.1, made up to 20 μ L with nuclease-free water;

5) Carrying out enzyme digestion reaction on the amplification product obtained in the step 2) by using a test strip Cas12 a; the reaction system is as follows: 1 μ M of crRNA of the purified C gene, 3 μ L of the LAMP amplification product of step 2), 0.5 μ M of Cas12a, 2.5 μ M of ssDNA-reporter (FAM-N12-Biotin), 2 μ L of 10x NEB buffer 2.1, up to 20 μ L with nuclease-free water; after reaction at 37 ℃ of 30min and 98 ℃ of 2min, transferring the reaction product into a 1.5mL centrifuge tube, adding 80 μ L of Milena Genline colloidal Assay Buffer, blowing, uniformly mixing, reacting at room temperature for 5min, and putting a test strip for identifying and detecting a result; when a control line and a detection line of the test strip simultaneously generate a red strip, the test strip is positive; when the control line of the test strip shows a red strip, the test line shows no red strip, which is negative;

6. The naked eye visual detection method of Japanese encephalitis virus according to claim 5, characterized in that: the amplification reaction is carried out in a heating type thermos cup, and the temperature range of the thermos cup is 25-100 ℃.