KR101024116B1 - PCR primer pair detecting Cowpea mild mottle virus and method for detecting Cowpea mild mottle virus using the same - Google Patents

Abstract

The present invention relates to a PCR primer pair for detecting eastern soft spot virus and a method for detecting eastern soft spot virus using the same, more specifically, a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 8; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 9; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8; And PCR primer pairs for detecting Cowpea mild mottle virus ( CPMMV) selected from the group consisting of primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 9, and RT-PCR or RT-PCR and nested PCR using the same. The present invention relates to a method for detecting eastern mildew virus by a binding method. The present invention provides a PCR primer pair capable of detecting CPMMV specifically in a sample, a CPMMV detection method using the same, and a kit for detecting CPMMV. Such PCR primer pairs, detection methods and kits for detecting the present invention can be quickly, easily and accurately confirmed the presence of CPMMV in an unknown sample, and thus can be useful in industrial and quarantine sites.

Eastern Stain Virus, RT-PCR, Nested PCR, Quarantine

Description

PCR primer pair detecting Cowpea mild mottle virus and method for detecting Cowpea mild mottle virus using the same}

The present invention relates to a PCR primer pair for detecting eastern soft spot virus and a method for detecting eastern soft spot virus using the same, more specifically, a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 8; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 9; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8; And PCR primer pairs for detecting Cowpea mild mottle virus ( CPMMV) selected from the group consisting of primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 9, and RT-PCR or RT-PCR and nested PCR using the same. The present invention relates to a method for detecting eastern mildew virus by a binding method.

In the past, electron microscopy and serological methods (ELISA) were mainly used for the diagnosis of viruses. Electron microscopy can confirm the presence of the virus, but its morphological features make it impossible to diagnose the species. Among serological methods, enzyme linked immunosorbent assay (ELISA) is about 1000 times lower in sensitivity than the most commonly used diagnostic method or PSI, and the unexpected nonspecificity of antibodies and test samples. Often, the reaction fails to diagnose.

Therefore, in the diagnosis of a virus, a PCR method having high detection sensitivity and convenience is most commonly used. An important point in the development of primers for PCR diagnosis of pathogens is that, first, all strains and isolates present in the viral species must be detected. To this end, primers should be designed for nucleotide sequences common to all strains and isolates of the viral species to be detected. Second, there must be specificity between different species. For this purpose, primers should be designed that do not react to the sequences of other viruses that are flexible to the virus species to be detected.

Cowpea mild mottle virus (CPMMV) is a filamentous virus composed of single stranded RNA, 13 nm wide and 750 nm long. Taxonomically it belongs to the genus Flexiviridae Caravirus. CPMMV is mainly transmitted by juice, seeds and tobacco powder. CPMMV is naturally associated with legumes and occurs in some crops, such as tomatoes. At present, various kinds and large amounts of plants are imported from foreign countries, and it is urgent to develop accurate, fast and simple detection methods to quarantine them.

Therefore, the present inventors have conducted research to develop a new method for detecting Eastern blight virus specifically, and as a result, we have developed nine new primer pairs that can specifically detect Eastern blight virus. The present invention was completed by confirming that it is possible to effectively detect eastern light stain virus in an unknown sample.

Accordingly, it is an object of the present invention to provide a pair of eastern mildew virus detection, assay PCR primer pairs and a method for detecting eastern mildew virus using the same.

In order to achieve the above object, the present invention is a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 8; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 9; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8; And it provides a PCR primer pair for detecting the cowpea mild mottle virus selected from the group consisting of the primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 9.

In order to achieve the other object of the present invention,

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention; And

(c) provides a method for detecting Eastern blot virus from a sample comprising the step of separating the PCR product by size.

In order to achieve another object of the present invention, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention;

(c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And

(d) providing a method for detecting eastern soft stain virus from a sample comprising the step of separating the nested PCR product of step (c) by size.

In order to achieve another object of the present invention, the present invention provides a kit for detecting eastern soft stain virus comprising a PCR primer pair for detection of the present invention.

Hereinafter, the present invention will be described in detail.

The PCR primer pair for detecting eastern mildew virus (CPMMV) of the present invention specifically detects CPMMV, and does not detect other Karaviruses that are similar in line with CPMMV, and do not detect other viruses. Thus, the PCR primer pair for detecting CPMMV of the present invention can specifically detect CPMMV. PCR primer pair for detecting CPMMV of the present invention is preferably a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 8; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 9; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8; And it may be a primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 9. More preferably, the PCR primer pair for detecting CPMMV of the present invention may be a primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 8; Or a pair of primers represented by SEQ ID NO: 2 and SEQ ID NO: 8. The primer pairs do not show non-specific amplification with karavirus or other viruses and can detect all isolates present in the species, and thus can be used for more accurate detection.

PCR primer pairs of the present invention can be usefully used to detect CPMMV in a sample. Accordingly, the present invention provides a method for detecting CPMMV from a sample comprising performing PCR using the PCR primer pairs.

More specifically, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention; And

(c) provides a method for detecting Eastern blot virus from a sample comprising the step of separating the PCR product by size.

The extraction of RNA in step (a) may be performed according to a method commonly used in the art, and may be performed using a commercially available RNA extraction kit.

In addition, in step (b), RT-PCR uses the isolated RNA as a template, the reverse primer among the primer pairs of the present invention is used as a primer, and synthesizes complementary DNA strands by reverse transcription using a reverse transcriptase, followed by PCR. The reaction can be carried out. The PCR reaction may be carried out using a PCR reaction mixture containing various components known in the art required for the PCR reaction. The PCR reaction mixture includes an appropriate amount of DNA polymerase, dNTP, PCR buffer and water (dH ₂ O) in addition to the complementary DNA synthesized by reverse transcription and the PCR primer pair provided in the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl, and the like. At this time, the concentration of MgCl ₂ greatly affects the specificity and quantity of amplification. In general, when Mg ²⁺ is excessive, nonspecific PCR amplification products increase, and when Mg ²⁺ is insufficient, PCR The yield of the product is reduced. The PCR buffer solution may further include an appropriate amount of Triton X-100. PCR also denatured the template DNA at 94-95 ° C., followed by denaturation; Annealing; And a cycle of extension, followed by general PCR reaction conditions which are finally elongated at 72 ° C. The denaturation and amplification may be performed at 94-95 ° C. and 72 ° C., respectively, and the temperature at the time of binding may vary depending on the type of primer, preferably 52-57 ° C., and more preferably 55 ° C. . The time and number of cycles in each step can be determined according to the conditions generally made in the art.

In step (c), DNAs of PCR products may be separated according to sizes according to methods well known in the art. Preferably it can be confirmed by an agarose gel (agarose gel) or polyacrylamide gel electrophoresis or fluorescence analysis (ABI prism 3100 genetic analyzer-electropherogram). At this time, in order to use the fluorescence analyzer PCR is performed in the step (b) using a primer pair attached to a fluorescent die known in the art. PCR amplification results can be preferably confirmed by agarose gel electrophoresis. After electrophoresis, the result of electrophoresis can be analyzed by ethidium bromide staining. General reverse transcription reactions, performing PCR and analyzing the results are well known in the art.

In addition, the present invention may further include the step of performing nested PCR to increase the accuracy of the detection reaction.

More specifically, the present invention

(a) isolating RNA from the sample;

(b) using the isolated RNA as a template and performing RT-PCR using the primer pair of the present invention;

(c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And

(d) providing a method for detecting eastern soft stain virus from a sample comprising the step of separating the nested PCR product of step (c) by size.

RNA extraction, RT-PCR and PCR product separation in steps (a), (b) and (d) are as described above, and nested PCR in step (c) is performed in step (b). RT-PCR may be amplified by a method of performing PCR using a nested primer (nested primer pair) to be amplified. At this time, the conditions of the PCR reaction are as described above, the nested primer pair is not limited as long as the RT-PCR product can be amplified, but for the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 8 Primer pairs of SEQ ID NO: 5 and SEQ ID NO: 6; Alternatively, the primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8 may be primer pairs of SEQ ID NO: 3 and SEQ ID NO: 6.

The addition of such a nested PCR step can minimize errors due to non-specific reactions in the detection of CPMMV can be usefully used when necessary.

In another aspect, the present invention provides a kit for the detection of eastern light stain virus comprising a PCR primer pair according to the present invention. In addition to the PCR primer pairs, the kit may further include a DNA polymerase and a PCR reaction buffer solution of the above-described composition to easily perform the PCR reaction, and perform electrophoresis to confirm whether the PCR product is amplified. Components necessary for may be further included in the kit of the present invention.

Meanwhile, standard recombinant DNA and molecular cloning techniques used in the present invention are well known in the art and described in the following literature (Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual) , 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989); by Silhavy, TJ, Bennan, ML and Enquist, LW, Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1984) and by Ausubel, FM et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-lnterscience (1987)).

In one embodiment of the present invention, the CPMMV common base sequence is searched by comparing the nucleotide sequences of three CPMMV isolates known to date, using RNA encoded with an envelope protein in order to design a CPMMV diagnostic primer. As a result, sequences similar to the viral sequences of six similar Carlaviruses were selected. Based on this, nine primers were designed and nine primer combinations were made using these primers (Tables 3 and 4).

In another embodiment of the present invention, four primer combinations having low non-specific reactions and strong reaction strength to CPMMV using RT-PCR assay using RNA isolated from plants infected with CPMMV as samples for the nine primer combinations ( Combinations 5, 6, 8, 9) were selected first. Then, using the different types of viruses, the first primers were selected to test whether the four primers responded to the different types of viruses.

In another embodiment of the present invention, CPMMV was detected using a primer combination selected for a sample suspected of having been infected with CPMMV. As a result, each primer combination and the results of nested PCR for them were also amplified well confirmed that the sample was infected with CPMMV.

Accordingly, the present invention provides a PCR primer pair capable of specifically detecting CPMMV in a sample, a CPMMV detection method using the same, and a kit for detecting CPMMV. Such PCR primer pairs, detection methods and kits for detecting the present invention can be quickly, easily and accurately confirmed the presence of CPMMV in an unknown sample, and thus can be useful in industrial and quarantine sites.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

≪ Example 1 >

Design of CPMMV Diagnostic Primer

The design of the CPMMV diagnostic primers consisted of regions encoded by the envelope protein. In order to search for species-specific nucleotide sequences, base sequences of three known CPMMV isolates (Table 1) were compared to find a common nucleotide sequence, which was classified into six viral sequences of Caraviruses that are taxonomically similar to CPMMV. Compared to Table 2), CPMMV species specific sequence group was found. Nine diagnostic primers were designed based on this species-specific sequence group (Table 3; locations in Table 3 were prepared based on Genbank ac. No. AF024629). The designed primers are located in FIG. 1 and nine primer combinations were made using these primers (Table 4; positions in Table 4 were prepared based on Genbank ac. No. AF024629).

Sequence of CPMMV Isolates Used for Common Base Sequence Analysis Separator or System Genbank ac. no. Size (bp) CPMMV-M AF024629 2511 CPMMV-H AF024628 2505 Arachis repens DQ444266 1300

Caravirus sequencing used for species specific sequencing virus Genbank ac. no. Size (bp) Pea streak virus -ATCCPV-87 AF354652 2685 Blueberry scorch virus -NJ-2 L25658 8512 Lily symptomless virus -South Korea AJ516059 8394 Poplar mosaic virus -ATCC PV275 X65102 8737 Potato virus M -Russian wild D14449 8533 Potato virus S -Leona AJ863509 8478

Diagnostic primers designed from the CPMMV species consensus sequence SEQ ID NO: Primer Name direction Sequence Length (bp) location One CPMM-N10 Forward ATTGCCCGATATTGATGCTGAA 22 1,312-1,333 2 CPMM-N20 Forward GGAAAACCCAAAGTGCCTCAGA 22 1,371-1,392 3 CPMMN-N20 Forward GCTACGGCCGAAGAGATGG 19 1,535-1,553 4 CPMM-N30 Forward AGGGCCTGGGTGTTCCGTCTGA 22 1,575-1,596 5 CPMMN-N10 Forward TGGGTGTTCCGTCTGAACATG 21 1,581-1,601 6 CPMMN-C20 Reverse TTGCTGCCCAATCGGAAGG 19 1,814-1,832 7 CPMM-C10 Reverse GGCTATCCGCTTGTAAGTATTGTGA 25 1,954-1,978 8 CPMM-C20 Reverse TCTTTTCGCTTGGAGTAGGCTTTCT 25 1,925-1,949 9 CPMM-C30 Reverse TGCTGCCCAATCGGAAGGT 19 1,813-1,831

CPMMV Diagnostic Primer Combination and RT-PCR Expected Products Combination Reverse location Forward location Product (bp) One CPMM-C10 1954-1978 CPMM-N30 1575-1596 404 2 CPMM-N20 1371-1392 608 3 CPMM-N10 1312-1333 667 4 CPMM-C20 1925-1949 CPMM-N30 1575-1596 375 5 CPMM-N20 1371-1392 579 6 CPMM-N10 1312-1333 638 7 CPMM-C30 1813-1831 CPMM-N30 1575-1596 257 8 CPMM-N20 1371-1392 461 9 CPMM-N10 1312-1333 520

<Example 2>

Selection of CPMMV Diagnostic Primer Combinations

Among the nine CPMMV diagnostic primer combinations of Table 4, the most effective primer combinations for CPMMV diagnosis were selected as follows. First, a combination of strong and non-specific responses to CPMMV was first selected using CPMMV-infected plants, and then three sorts of karaviruses similar to CPMMV and 13 other viruses occurring in legumes related to the host were identified. The primer combination that specifically responds to CPMMV was finally selected.

<2-1> Selection through RT-PCR with CPMMV Infected Plants

RNA was isolated from the CPMMV infected plant as a sample, and it was confirmed whether the genome of CPMMV could be amplified by RT-PCR.

Isolation of total RNA from the sample was carried out using commercially available total RNA isolation kits (Prophenol using phenol (Promega), TRIzol (Invitrogen Co.), easy-spin TM Total RNA Kit (iNtRON Co.)). .

Reverse transcription reaction was performed with 0.5 μl total RNA isolated, 12.5 pmole downstream primer, 5-fold reverse transcription buffer (250 mM Tris-HCl, 150 mM KCl, 40 mM MgCl ₂ , 5 mM DTT, pH 8.5). ) 5 μl of the reaction solution containing 1 μl, 10 mM dNTP 0.5 μl, 10 U RNase inhibitor, and 2 U AMV reverse transcriptase were incubated at 42 ° C. for 1 hour, and then denatured at 94 ° C. for 10 minutes. The polymerase chain reaction was carried out in 5 μl of reverse transcriptase and 12.5 pmole upstream primer, 1.25 U Taq DNA polymerase, 10-fold polymerase chain reaction buffer (100 mM Tris-HCl, 500 mM KCl, 15). 2 μl of mM MgCl ₂ , pH 8.3) was added and distilled water was added to make 25 μl of the reaction solution. The reaction solution was amplified 40 times at 95 ° C 45 seconds, 55 ° C 60 seconds, 72 ° C 60 seconds and finally treated at 72 ° C for 7 minutes. RT-PCR products were confirmed by electrophoresis using 0.5 × TBE buffer and 1.5% agarose gel and stained with ethidium bromide.

As a result, as shown in Fig. 2, primary primer combinations of the four (combination 5, 6, 8, 9) primer combinations were superior in the RT-PCR assay with CPMMV infected plants and did not show nonspecific responses that interfere with diagnosis. Selected.

<2-2> Analysis of response with other viruses related to host of CPMMV

Whether the primers react to other viruses through RT-PCR with three karaviruses that are taxonomically similar to CPMMV and 13 other viruses occurring in legumes related to the host for the four primer combinations selected above It was analyzed.

Viruses Used in RT-PCR Virus Display Garlic common latent virus GCLV Potato s virus PVS Shallot latent virus SLV Alfalfa mosaic virus AMV Arabis mosaic virus ArMV Bean yellow mosaic virus BYMV Beet mosaic virus BtMV Cowpea chlorotic mottle virus CCMV Cowpea severe mosaic virus CPSMV Cucumber mosaic virus CMV Grapevine fanlef virus GFLV Prune dwarf virus PDV Ribgrass mosaic virus RMV Soybean mosaic virus SMV Tobacco rattle virus TRV Tomato bushy stunt virus TBSV

To this end, RNA and CP-RTR reactions were performed as in <Example 2-1> using the viruses and CPMMV listed in Table 5 as samples, respectively.

As a result, as shown in Figure 3, it was confirmed that the primer combinations 5 and 6 were not specifically amplified in three caraviruses that are taxonomically similar to CPMMV and 13 other viruses occurring in legumes related to the host. These two primer combinations were found to be the most preferred primer combination for CPMMV assay.

<Example 3>

Selection of primer combinations for assaying CPMMV diagnostic results

Assay primer combinations are CPMMV species specific and the base sequence of the primer must be located in the diagnostic output.

Accordingly, assay primer combinations were selected from the diagnostic primer candidate groups shown in Table 3. For assays for the results using primer combination 5, CPMMN-C20 and CPMMN-N20 combinations were used; CPMMN-C20 and CPMMN-N10 combinations were selected for assaying the results using primer combination 6.

Primer Combinations and PCR Anticipated Products for CPMMV Assay Black target product Primer name for assay Sequence number Expected product length Combination 5
(CPMM-C20 / N20, 579bp) CPMMN-N20 3 298 bp CPMMN-C20 6 Combination 6
(CPMM-C20 / N10, 638bp) CPMMN-N10 5 252 bp CPMMN-C20 6

<Example 4>

Examples of CPMMV Diagnostics and Tests

Samples suspected of being infected with CPMMV were crushed in RNase free state and RNA was isolated using TRIzol. Using isolated RNA, RT-PCR was performed using primer combination 5 or 6 of the present invention in the same manner as in <Example 2-1>, and the results were confirmed by electrophoresis. In addition, nested PCR was performed using primer combinations suitable for each of the results shown in Table 6 for the assay of the results obtained by RT-PCR using the primer combination 5 or 6. The result obtained by RT-PCR and the result of the nested PCR for assay were electrophoresed in the same manner as in <Example 2-1> to confirm the result.

As a result, as shown in FIG. 4, CPMMV diagnosis was successfully performed using primer combinations 5 or 6, respectively. As a result, the nested PCR assay was also amplified well to confirm that the sample was infected with CPMMV.

In addition, in order to use as a positive control for detecting CPMMV, a plasmid including the entire region of the primer (SEQ ID NO: 10) was prepared. As a result of performing PCR on primer combination 5 or 6, the amplification was well performed as shown in FIG. 5.

As described above, the present invention provides a pair of PCR primers capable of specifically detecting CPMMV in a sample, particularly legumes and eggplant crop seeds or plant samples, a CPMMV detection method using the same, and a kit for detecting CPMMV. Such PCR primer pairs, detection methods and kits for detecting the present invention can be quickly, easily and accurately confirmed the presence of CPMMV in an unknown sample, and thus can be useful in industrial and quarantine sites.

1 is Genbank ac. no. Primer position for CPMMV diagnosis based on AF024629.

Figure 2 confirms the specificity of the CPMMV of the nine primer combinations. Whole RNA extracted from cowpea leaf tissues infected with CPMMV was used as RT-PCR template. M: size marker; 1-9 lanes show the 1-9 primer combinations of Table 4.

Figure 3 shows the RT-PCR results of taxonomically similar caraviruses and host-associated viruses using a primary selected CPMMV diagnostic primer combination. M: size marker; 1: CPMMV, 2: GCLV, 3: PVS, 4: SLV, 5: AMV, 6: ArMV, 7: ArMV, 8: BYMV, 9: BtMV, 10: CCMV, 11: CPSMV, 12: CMV, 13: GFLV, 14: PDV, 15: RMV, 16: SMV, 17: TRV, 18: TBSV.

4 shows nested PCR results of CPMMV diagnostic primer combination and assay primer combination. (M: size marker; 1: primer combination 5 (579 bp); 2: assay nested PCR for combination 5 (CPMMN-C20 / CPMMN) -N20) (298 bp); 3: primer combination 6 (638 bp); 4: nested PCR for assay for combination 6 (CPMMN-C20 / CPMMN-N10) (252 bp))

Fig. 5 shows PCR results using the CPMMV positive control as a sample. (M: size marker; 1: CPMMV DNA fragment inserted into the positive control (1,135bp); 2: primer combination 5 (579bp); 3: primer combination 6 (638bp))

<110> Republic of Korea (Management: Rural Development Administration) <120> PCR primer pair detecting Cowpea mild mottle virus and method for          detecting Cowpea mild mottle virus using the same <160> 10 <170> KopatentIn 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CPMM-N10: forward primer for detecting Cowpea mild mottle          virus (CPMMV) <400> 1 attgcccgat attgatgctg aa 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> CP223-N20: forward primer for detecting Cowpea mild mottle          virus (CPMMV) <400> 2 ggaaaaccca aagtgcctca ga 22 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CPMMN-N20: forward primer for detecting Cowpea mild mottle          virus (CPMMV) <400> 3 gctacggccg aagagatgg 19 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CPMM-N30: forward primer for detecting Cowpea mild mottle          virus (CPMMV) <400> 4 agggcctggg tgttccgtct ga 22 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CPMMN-N10: forward primer for detecting Cowpea mild mottle          virus (CPMMV) <400> 5 tgggtgttcc gtctgaacat g 21 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CPMMN-C20: reverse primer for detecting Cowpea mild mottle          virus (CPMMV) <400> 6 ttgctgccca atcggaagg 19 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CPMM-C10: reverse primer for detecting Cowpea mild mottle          virus (CPMMV) <400> 7 ggctatccgc ttgtaagtat tgtga 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CPMM-C20: reverse primer for detecting Cowpea mild mottle          virus (CPMMV) <400> 8 tcttttcgct tggagtaggc tttct 25 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> CP223-C30: reverse primer for detecting Cowpea mild mottle          virus (CPMMV) <400> 9 tgctgcccaa tcggaaggt 19 <210> 10 <211> 1135 <212> DNA <213> Cowpea mild mottle virus <400> 10 attgcccgat attgatgctg aactccagaa gagactagat agtcttcgtg aatttctcag 60 gaagacgcaa agtgcttcag agatcacaaa tcccggtttt gagctaggga ggcctgaact 120 caagcaatct acattcaatt ctgataagca tacccatatt tatgggaagt ggtccatcga 180 ccaattgagt aggattgtgc caaagaaaat ttcaaacaat atggccacag ctgaggagat 240 ggctaaagtg caaataatct tggaaggctt gggggtacct actgagcatg tggctgaggt 300 cctacttcaa gtagccatat attgcaagga cacaagctcc tctgcttaca tggactcaag 360 cggtactttt gattggaagg gtggatccat actctcagat tctgtgatag ccgctttgcg 420 caaagatgag aatacgttaa ggagagtgtg tagactatat gccccaatca cttggaattt 480 tatgttgact cataaagccc ctccttctga ttgggctgct atgggcttta agtactcaga 540 taggtatgct gcatttgatt gctttgatta cgttgaaaat ccagcagcaa tacagccagc 600 agaagggctt atcagaaagc caacacctag tgaaaagata gctcacaaca catacaaaag 660 gttggccttg gataggtcca atcgaaatga gcacttcgcc aacttgaata ctgaggttac 720 tggaggcact caaggaccag aaatttcaag gaactttaat cacgccaaaa agtaatgctg 780 ggttacaagc gactgtctgt tcttctctat ttgtgttcca ataaaatggg ttgttgtttg 840 ccgtttgatt tgtgtgtttt aatagctttg aagtgtgatc cttctaaaat aaattatggt 900 aagtcttctt atgctaaaaa gcgtagagct cgagcaattg gaagatgtca taaatgttat 960 cgtgtgagtc ctggtttcta ctttacaaag cgttgtaatg gtgtgaattg tgtcccagga 1020 ataacttatc aacgatgggt tgaagaattt atcaaatttg gtttaaaaag ggagtaactg 1080 aggtgatacc cttattgagc caaactcttg aaccaaggaa agagtataaa gagtc 1135  

Claims (6)

Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 8; Primer pairs represented by SEQ ID NO: 1 and SEQ ID NO: 9; Primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8; And a PCR primer pair for detecting Cowpea mild mottle virus selected from the group consisting of primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 9. The method of claim 1, wherein the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 8; Or a pair of PCR primers for detection of eastern light stain virus, which are primer pairs represented by SEQ ID NO: 2 and SEQ ID NO: 8. (a) isolating RNA from the sample; (b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 1; And (c) A method for detecting eastern mildew virus from a sample comprising separating the PCR products by size. (a) isolating RNA from the sample; (b) using the isolated RNA as a template and performing RT-PCR using the primer pair of claim 2; (c) using the PCR product of step (b) as a template, and performing nested PCR using nested primer pairs for the primer pairs used in step (b); And (D) a method for detecting eastern soft stain virus from a sample comprising the step of separating the nested PCR product of step (c) by size. The method according to claim 4, wherein the nested primer pair is a primer pair of SEQ ID NO: 5 and SEQ ID NO: 6 for the primer pair represented by SEQ ID NO: 1 and SEQ ID NO: 8; Or about a primer pair represented by SEQ ID NO: 2 and SEQ ID NO: 8, characterized in that the primer pair of SEQ ID NO: 3 and SEQ ID NO: 6. Eastern soft stain virus detection kit comprising a primer pair of claim 1.

Images