KR101174695B1 - Primer combination for diagnosing Squash mosaic virus and uses thereof - Google Patents

Abstract

The present invention provides a SqMV diagnostic primer combination comprising at least one primer combination selected from the primers represented by SEQ ID NOS: 1-10, SqMV diagnostic kit comprising the primer combination, and species-specific diagnosis of SqMV using the primer combination. It is about a method.

The pH test system of the present invention may be used for the industrialization of plant virus RT-PCR diagnostic kits and for the inspection of SqMV from plants in quarantine and clinical diagnosis.

Diagnosis method, pumpkin mosaic virus, RT-PCR, gourd, nested PCR, positive control, seed transmission virus, diagnosis system, plant quarantine, disease-free seed

Description

Primer combination for diagnosing Squash mosaic virus and uses approximately}

The present invention relates to a PCR (PCR) test system for diagnosing Squash mosaic virus (SqMV), which causes great damage to gourds and crops. The PSI test system includes an optimal primer pair for SqMV diagnosis and a matching primer pair for the assay, and a species-specific primer bank and a positive control that can support it.

In the past, electron microscopy and serological methods (ELISA) were mainly used for the diagnosis of viruses. Electron microscopy can confirm the presence of the virus, but its morphological features make it impossible to diagnose the species. Among serological methods, the ELISA method is about 1000 times lower in sensitivity than the most commonly used diagnostic method or PSI, and often fails to diagnose due to unexpected nonspecific reaction of antibodies and test samples.

Currently, the diagnosis of RNA virus is the most commonly used RT-PCR method with high detection sensitivity and convenience. The development of species-specific primers is the most important for the diagnosis of the pathogen. Specific primers for diagnosing SqMV have not been patented.

SqMV occurs in natural foods and crops in the natural state, and the means of transmission include contact infection by juice, insecticide transmission by beetle, and seed transmission by infection of embryo. SqMV requires diagnostics to detect it in the seeds of gourds and crops imported as quarantine pathogens. Until now, ELISA method is mainly used for diagnosing SqMV, but is often misdiagnosed by nonspecific reaction of plant extract and antiserum. In addition, if the infection rate of SqMV is low in the seed to be tested, the ELISA diagnosis is likely to fail the test. Thus, in order to detect viruses in these seeds, it is generally necessary to diagnose PSI with 1000 times higher detection sensitivity than ELISA. The quarantine site requires the diagnosis of various pathogens on a single test sample, which requires a lot of labor and test costs. Therefore, the development of the same test method for each pathogen is necessary. When diagnosing by PSI, it is necessary to establish pathogen-specific diagnostic primer banks and to test for positive and negative reactions in case of difficulty in discriminating due to the low intensity of specific reactions or for non-specific reactions with other nucleic acids. You need a system that can. On the other hand, when isolate-specific primers are used for diagnosis, the test may fail, and therefore, development of a species-specific primer capable of detecting all isolates present in a viral species is required.

The present invention has been made in accordance with the above demand, and there are strains or isolates having slightly different base sequences in SqMV species. Thus, if isolate-specific primers are used for diagnosis, there is a risk of failure. In other words, the virus diagnostic primer should be species specific for each virus. Primers in the present invention are designed to work species specific. In other words, the nucleotide sequences known to date are collected within the species to search for common nucleotide sequences of all strains and isolates. The species-specific sequence was selected by excluding the nucleotide sequences of other viruses with a flexible relationship among the common nucleotide sequences. From these species-specific sequences, sequences having optimal conditions as primers were designed as species-specific primers. The designed primers were subjected to the actual reverse transcriptase-polymerase chain reaction (RT-PCR) for each combination and did not have a nonspecific reaction with nucleic acids other than the target virus. In addition, the assay primer (nested primer) was developed together for the final selected primer combination. In addition, by securing a variety of diagnostic primer combinations for SqMV to build a primer bank that can be assayed for the positive and negative reactions to fish. A plasmid cloned from the primer design region of SqMV was prepared to obtain a positive control, and the base sequence was determined to confirm the positive reaction. In addition, the pH reaction conditions were identically developed in all virus and primer combinations to increase the inspection efficiency at the quarantine site.

In order to solve the above problems, the present invention provides a primer combination for SqMV diagnostic comprising one or more primer combinations selected from the primers represented by SEQ ID NO: 1 to 10.

The present invention also provides a kit for SqMV diagnosis comprising the primer combination.

In addition, the present invention provides a method for species-specific diagnosis of SqMV using the primer combination.

According to the present invention, the pumpkin mosaic virus (SqMV) fish test system can diagnose SqMV from plant seeds and tissues with a detection limit of 1,000 times or more than the conventional method using antiserum. SqMV diagnostic primers included in the PSI test system have been developed to react with all SqMV strains known to date, and also include tools for the validation of positive and negative responses. The test system of the present invention may be used for the examination of SqMV from seeds in the industrialization and quarantine of plant virus RT-PCR diagnostic kits.

In order to achieve the object of the present invention, the present invention provides a SqMV diagnostic primer combination comprising one or more primer combinations selected from the primers represented by SEQ ID NO: 1 to 10.

In the SqMV diagnostic primer combination of the present invention, the forward primer is selected from the group consisting of the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, and the reverse primer is SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 may be selected from the group consisting of. However, in the primer combination of the present invention, the forward primer should be located on the 5 'side rather than the reverse primer.

SqMV diagnostic primer combination of the present invention is preferably a primer combination of SEQ ID NO: 1 and 8 (combination 3); And primer combinations (combination 4) of SEQ ID NOs: 2 and 8.

The SqMV diagnostic primer combination of the present invention is more preferably a primer combination of SEQ ID NOs: 1 and 8 (combination 3); And primer combinations of SEQ ID NOs: 2 and 8 (combination 4). Simultaneous use of two primer combinations can diagnose SqMV more accurately.

SqMV diagnostic primer combinations of the invention also include primer combinations of SEQ ID NOs: 2 and 8; And it may further include one or more selected from the group consisting of primer combinations of SEQ ID NO: 3 and 9. That is, the SqMV diagnostic primer combination of the present invention has a verification function for the RT-PCR product of the primer SqM-C40 / N20 combination and the SqMV diagnostic primer combination 4 having a verification function for the RT-PCR product of the SqMV diagnostic primer combination 3 The gene primer SqM-C45 / N30 combination may be further included. If assay of the first RT-PCR test result is necessary, i.e. to confirm that the RT-PCR product is a result derived from SqMV, a PCR test is performed using the assayed primer for this primer combination. At this time, if the RT-PCR reaction result is derived from SqMV, the assay PCR will show a positive reaction (see FIG. 5).

The primers may be at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 in the sequence of SEQ ID NOs: 1 to 10, depending on the sequence length of each primer. Oligonucleotides consisting of segments of two or more consecutive nucleotides. For example, the primer of SEQ ID NO: 1 (20 oligonucleotides) may comprise an oligonucleotide consisting of segments of at least 16, 17, 18, 19 or more consecutive nucleotides within the sequence of SEQ ID NO: 1; , The primer of SEQ ID NO: 2 (22 oligonucleotides) is an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 consecutive nucleotides in the sequence of SEQ ID NO: 2 It may include.

In the present invention, "primer" refers to a single stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied and may serve as a starting point for the synthesis of the primer extension product. The length and sequence of the primer should allow to start the synthesis of the extension product. The specific length and sequence of the primers will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

As used herein, oligonucleotides used as primers may also include nucleotide analogues such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

In order to achieve another object of the present invention, the present invention

One or more primer combinations according to the invention; And it provides a SqMV diagnostic kit, comprising a DNA fragment having a nucleotide sequence of SEQ ID NO: 11. The kits of the present invention may further comprise reagents required for RT-PCR, which reagents include, but are not limited to, forward primers and reverse primers, reverse transcriptases, ribonuclease inhibitors, heat resistant polymerases and The reaction buffer may include both reverse transcription buffer and PCR buffer, and the heat resistant polymerase may use EF Taq polymerase and the like, and the reverse transcriptase may be reverse transcriptase, for example, algae from various sources. Avian myeloblastosis virus-derived virus reverse transcriptase (AMV RTase), mouse leukemia virus-derived virus reverse transcriptase (MuLV RTase) and Rouse-associated virus 2 It may include a reverse transcriptase (Rous-associated virus 2 reverse transcriptase (RAV-2 RTase).

The kit may also include instructions. The guide is a printed document that explains how to use the kit, such as how to prepare reverse transcription buffer and PCR buffer, and the reaction conditions presented. The instructions include brochures in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information that is disclosed or provided through electronic media such as the Internet.

DNA fragment having the nucleotide sequence of SEQ ID NO: 11 included in the kit of the present invention can be used as a plasmid having the function of a positive control for RT-PCR or PCR reaction using the combination of SqMV diagnostic primer (see Fig. 6).

In order to achieve another object of the present invention, the present invention

Separating total RNA from gourd and plant samples;

Amplifying a target sequence by using the isolated whole RNA as a template and performing RT-PCR using one or more primer combinations according to the present invention; And

It provides a method for species-specific diagnosis of SqMV, comprising detecting the amplification product.

As a method for separating total RNA from gourd and plant samples, a method known in the art may be used, for example, a phenol extraction method may be used. Using the isolated whole RNA as a template, one or more primer combinations according to one embodiment of the present invention may be used as a primer to amplify a target sequence by performing RT-PCR. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer to allow the target sequence to be labeled with a detectable fluorescent labeling substance. In addition, the label using the radioactive material may add radioactive isotopes such as ³² P or ³⁵ S to the PCR reaction solution when PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. One or more oligonucleotide primer combinations used to amplify the target sequence are as described above.

The method of the present invention includes detecting the amplification product. Detection of the amplification product may be performed through DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. Capillary electrophoresis can use, for example, an ABi Sequencer. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorimeter. can do. In addition, radioactivity measuring method is to add a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product when performing PCR, and then radioactive measuring apparatus, for example, Geiger counter or liquid flash The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example

Example 1 Design and Combination of SqMV Diagnostic Primers

SqMV is a spherical virus of about 30 nm in diameter consisting of about 6.8 kb and 4.5 kb of stranded RNA. It is taxonomically belonging to the genus Comoiridae comovirus. SqMV consists of succulent transmission, beetle spread by beetle, and seed transmission through the stomach. In nature most hosts are associated with gourds and plants. The design of the diagnostic primers consisted of RNA 2 encoded by viral transport and envelope proteins.

SqMV consensus sequencing was performed by multiple comparisons of base sequences (Table 1) of three SqMV isolates known to date. This common sequence was searched for species-specific sequences compared to the two viral bases of Comoviridae (Table 2) that are taxonomically similar to SqMV. Of these species specific nucleotide sequences, 10 diagnostic primers satisfying primer conditions were designed (Table 3). The designed primer is shown in FIG. 1. Ten primer combinations were made using these primers, and RT-PCR products are shown in Table 4.

Table 1. SqMV isolate sequences used for consensus sequencing

Separator or System Genbank accession no. Host Size (bp) Analysis genome SqMV-Y AB054689 - 3354 RNA-2 SqMV-Z AF059532 pumpkin 3369 RNA-2 SqMV-Kimble AF059533 pumpkin 3356 RNA-2

Table 2. Comoviridae virus sequences used for species-specific sequencing

Separator or System Genbank accession no. Host Size (bp) Analysis genome SqMV-Y AB054689 - 3354 RNA-2 SqMV-Z AF059532 pumpkin 3369 RNA-2 SqMV-Kimble AF059533 pumpkin 3356 RNA-2 BPMV M62738 - 3662 RNA-2 CPMV X00729 - 3481 RNA-2

Table 3. Diagnostic Primers Designed from SqMV Species Common Sequences

primer order SEQ ID NO: Length Position ^a Forward SqM-N10 ATTTGGTGGGAGATTATTCA One 20 357-376 SqM-N20 CCGAAAAAGCTGTGGTCAATCA 2 22 529-550 SqM-N30 TAAAATGTATGAGCGAAGTAAGAG 3 24 581-604 SqM-N40 GATGGTTCGTACGCCCTTAGA 4 21 2,717-2,737 Reverse SqM-C10 CTAAAGCGAACTGGGAAAGAA 5 21 3,275-3,295 SqM-C20 CCAGCCACTTCAAAGTCTTCCATA 6 24 3,173-3,196 SqM-C30 TTTGCATCTCTTCCTTTGTCATCT 7 24 1,249-1,272 SqM-C40 TTGGACAATGGCCCCCTTTTC 8 21 1,188-1,208 SqM-C45 AAACTAACAGCGCAACCTGC 9 20 1,129-1,148 SqM-C50 GGTGTGAGAGTTCCTGTTGG 10 20 699-718

^a Location is Genbank accession no. Created on the basis of AB054689.

Table 4. SqMV Diagnostic Primer Combinations and RT-PCR Expected Products

Example 2: SqMV Diagnostic Primer Bank Construction and Selection of Optimal Primer Combinations

The designed SqMV primers were selected in 10 combinations (Table 4) to select the most effective primer combinations for diagnosis through RT-PCR assays with SqMV and various related viruses. Selection of the optimal diagnostic primer combination consisted of three steps. The first is the selection by RT-PCR with SqMV infected plants, the second is the analysis of nonspecific reactions with comoviride virus with taxonomic similarity, and the third is the virus that infects the plants and gourds of SqMV. Selection through RT-PCR analysis.

Total RNA isolation and RT-PCR methods used in the present invention are as follows.

Total RNA Separation : The total RNA isolation kit (Prophenol), TRIzol (Invitrogen Co.), and easy-spin ™ Total RNA Kit (iNtRON Co.) were commercially available.

RT-PCR : Reverse transcription reaction consists of 0.5 μl total RNA isolated, 12.5 pmole downstream primer, 5-fold reverse transcription buffer (250 mM Tris-HCl, 150 mM KCl, 40 mM MgCl ₂ , 5 mM). DTT, pH 8.5) 5 μl of the reaction solution containing 1 μl, 10 mM dNTP 0.5 μl, 10 U RNase inhibitor, and 2 U AMV reverse transcriptase were incubated at 42 ° C. for 1 hour, and then denatured at 94 ° C. for 10 minutes. . The polymerase chain reaction was carried out in 5 μl of reverse transcriptase and 12.5 pmole upstream primer, 1.25 U Taq DNA polymerase, 10-fold polymerase chain reaction buffer (100 mM Tris-HCl, 500 mM KCl, 15). 2 μl of mM MgCl ₂ , pH 8.3) was added and distilled water was added to make 25 μl of the reaction solution. The reaction solution was amplified 40 times at 95 ° C 45 seconds, 55 ° C 60 seconds, 72 ° C 60 seconds and finally treated at 72 ° C for 7 minutes. RT-PCR products were identified by electrophoresis using 0.5X TBE buffer and 1.5% agarose gel followed by staining with ethidium bromide.

RT-PCR assays with SqMV infected plants confirmed SqMV specific responses in all 10 primer combinations (FIG. 2). Among them, 6 primer combinations (combination 1, 3, 4, 5, 9, 10) with superior reaction strength and no specific non-specific reaction, and the size of RT-PCR product was 900bp or less were selected.

The six primer combinations selected above were selected from four (combination 3, 4, 9, 10) primer combinations through non-specific reaction analysis with combiviride six viruses, which are taxonomically similar viruses (FIG. 3). Nonspecific response assays included Cowpea severe mosaic virus (CPSMV), Cherry leaf roll virus (CLRV), Broad bean wilt virus 2 (BBWV2), Grapevine fanleaf virus (GFLV), Tobacco ringspot virus (TRSV), Raspberry ringspot virus ( RpRSV), Tomato ringspot virus (ToRSV) and Tomato black ring virus (TBSV) were used.

The four combinations selected in the analysis with taxonomic similar virus finally selected the two combinations (combination 3, combination 4) primer combinations from RT-PCR analysis with 13 viruses related to gourds and plants (FIG. 4). The 13 viruses used to analyze nonspecific responses to host-associated viruses are: Arabis mosaic virus (ArMV), Cherry leaf roll virus (CLRV), Cowpea mild mottle virus (CPMMV), Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV), Grapevine fanleaf virus (GFLV), Kyuri green mottle mosaic virus (KGMMV), Melon necrotic spot virus (MNSV), Prune dwarf virus (PDV), Tobacco rattle virus (TRV), Tomato black ring virus (TBRV), Broad bean wilt virus 2 (BBWV2), Tomato spotted wilt virus (TSWV).

When SqMV is diagnosed from seeds or plants based on these results, RT-PCR is first performed using primer combinations 3 and 4 selected as optimal diagnostic primers. If this diagnosis is insufficient, verification can be made using a combination of different primers from the SqMV diagnostic primer bank.

Example 3: Example of Diagnosis and Verification of SqMV

The primary diagnosis is performed using Combination 3 or Combination 4 as the optimal primer for SqMV diagnosis at the test site. If assay of the first RT-PCR test result is necessary, i.e. to confirm that the RT-PCR product is a result derived from SqMV, a PCR test is performed using the assayed primer for this primer combination. At this time, if the RT-PCR reaction result is derived from SqMV, the assay shows a positive reaction (Fig. 5). In addition, a positive control was prepared that includes the entire region in which the primers were designed to easily identify PCR products derived from such SqMV primer banks of the present invention. This positive control was available as a positive control for PCR, and the base sequence of the inserted region of the positive control plasmid was determined and provided so that the base sequence of the required PCR product could be easily compared (FIG. 6).

When the diagnostic method of the present invention is carried out, it is possible to precisely diagnose SqMV infection from gourds and crop seeds or plants. It is also possible to industrialize RT-PCR diagnostic kits for plant viruses. By implementing the present invention will be able to minimize the damage of SqMV in domestic gourds and crops, it can be easily used at the border quarantine site can effectively block the influx of SqMV-infected gourds and plant seeds from foreign countries.

1 shows the SqMV primer positions. The location is Genbank accession no. Written based on AB054689.

Figure 2 assays the specificity of SqMV of the 10 primer combinations. RT-PCR template was used as the total RNA extracted from SqMV infected pumpkin leaf tissue, see Table 4 for 1-10 primer combinations.

Figure 3 shows the RT-PCR analysis of the selected SqMV primer combination and Comoviridae virus. 1, 10: SqMV; 2, 11: CPSMV; 3, 12: BBWV2; 4, 13: TRSV; 5, 14: ToRSV; 6, 15: CLRV; 7, 16: GFLV; 8, 17: RpRSV: 8, 18; TBRV.

4 is a result of RT-PCR analysis of the selected SqMV diagnostic primer combination and host-associated virus. 1: SqMV, 2: ArMV, 3: CLRV, 4: CPMMV, 5: CMV, 6: CGMMV, 7: GFLV, 8: KGMMV, 9: MNSV, 10: PDV, 11: TRV, 12: TBRV, 13: BBWV2, 14: TSWV.

5 shows the results of (RT) PCR analysis of SqMV diagnostic optimal primer combinations and assay primer combinations.

M: size marker

1: Optimal diagnostic primer combination 4 (680bp)

2: Primer combination for assay for combination 4 (SqM-C45 / N30) (567 bp)

3: Optimal diagnostic primer combination 3 (852bp)

4: Primer combination for assay (SqM-C40 / N20) for combination 3 (680bp)

Figure 6 shows SqMV positive control (1780 bp) inserted into the pGEM-T vector.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Primer combination for diagnosing Squash mosaic virus and uses          the <130> PN08260 <160> 11 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SqM-N10 primer <400> 1 atttggtggg agattattca 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SqM-N20 primer <400> 2 ccgaaaaagc tgtggtcaat ca 22 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SqM-N30 primer <400> 3 taaaatgtat gagcgaagta agag 24 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SqM-N40 primer <400> 4 gatggttcgt acgcccttag a 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SqM-C10 primer <400> 5 ctaaagcgaa ctgggaaaga a 21 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SqM-C20 primer <400> 6 ccagccactt caaagtcttc cata 24 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SqM-C30 primer <400> 7 tttgcatctc ttcctttgtc atct 24 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SqM-C40 primer <400> 8 ttggacaatg gccccctttt c 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SqM-C45 primer <400> 9 aaactaacag cgcaacctgc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SqM-C50 primer <400> 10 ggtgtgagag ttcctgttgg 20 <210> 11 <211> 1780 <212> DNA <213> Squash mosaic virus <400> 11 atttggtggg agattattca aatacttcac catttattcc agtacaagga accagcatta 60 tttattaata gctgtcagga tcttgctgct tttttagaga ggaaacattc catggaagtg 120 attcagaagg aaggtttggc tgcttcagca ctcaaggata aggagcgact ggccgaaaaa 180 gctgtggtca atcagcccct gagtaacttg attcctcatt caaataaaat gtatgagcga 240 agtaagagtc ttctatctgg tcttaagcgt ggtttgataa agcaaaaaga ggtagctttt 300 gataagctca tggggggttc gacaatagac ttccagcata ttccaaccgg aactctcaca 360 cctggtgaga ataaggtgct agacatacca attgtcccgc aacatttatt gaccagtacg 420 aatataacgg attaccatca ggccaataat aagagtgcta atggtgctac tgcacttcat 480 gttggagcta tagaagtcat cttagattgc tttacctctc ctgatagtaa catttgtggt 540 ggtatgttgc tggttgatac agcacattta aacccggata atgcaataag aagtgttttt 600 gtcgcgccat ttattggtgg tcgccctatt cgagttttgt tgtttccaga cactttggtg 660 gaaattgccc caaacatgaa ttctcgattt aaattgctat gtactactag caatggcgac 720 gttgcaccag attttaattt agcgatggtc aaagtcaatg ttgcaggttg tgctgttagt 780 ttgaccaaga catacactcc tacagcctac cttgagcaag agctaattaa agaaaagggg 840 gccattgttc aatatttgaa caggcacact ttttctatgc atcggaataa tcagatgaca 900 aaggaagaga tgcaaaagca gtgcctttct tttagactgg aaagtgctct cactttgcag 960 aaaaacatcc tttgcacgcc accttttgta agtcaaccaa ttttgtttac agattggtgg 1020 agatgccaaa gaaggtagta atggtagttt gactgttaat gagagtcagt gtcctcacat 1080 tctcttccac acatgttttg cataagcata acaacagtgg cgataatgaa gtagaattct 1140 cggagattgg tgtggtcgta ccaggtgctg gtagaaccaa ggcttatggt caaaatgaac 1200 tagatcttgc gcaactttcc ttggatgata ctagttctct tcgtggatct gtgttgcaaa 1260 ccaaattagc cacatcccgt gtcattttaa gtaaaacaat ggtcgggaat actatcctta 1320 gggaagattt gctcgccacc ttcttgcagg atagcaatga gagggccgcg atagatttaa 1380 tccgcaccca tgttataaga ggcaaaatac gctgtgttgc ttctatcaat gttccagaga 1440 atacaggttg tgctttggct atttgcttca atagtggcat aacaggagct gctgacacgg 1500 acatatacac cacgagttct caggacgcta tagtgtggaa tcctgcttgt gagaaggctg 1560 ttgagttgtc atttaacccc aatccctgca gtgatgcctg gaactttgtg tttttgcagc 1620 agacaaaggc acatttcgca gttcagtgtg tgactggatg gactacaacg ccacttacag 1680 acttggctct agtgcttaca tggcatatcg atagaaactt gtgcgtgcct gaaactttga 1740 cgattagttc tgcacacgct tctttcccag ttcgctttag 1780  

Claims (7)

delete Primer combinations of SEQ ID NOs: 1 and 8; And one or more selected from the group consisting of primer combinations of SEQ ID NOs: 2 and 8. SqMV species specific diagnostic primer combinations. The method of claim 2, further comprising: a primer combination of SEQ ID NOs: 1 and 8; And a primer combination of SEQ ID NOs: 2 and 8. SqMV species specific diagnostic primer combinations. The method of claim 2, further comprising: a primer combination of SEQ ID NOs: 2 and 8; And one or more selected from the group consisting of primer combinations of SEQ ID NOs: 3 and 9. SqMV species specific diagnostic primer combinations. A primer combination according to any one of claims 2 to 4; And a DNA fragment having a nucleotide sequence of SEQ ID NO: 11, SqMV species specific diagnostic kit. Separating total RNA from gourd and plant samples; Amplifying a target sequence by using the isolated whole RNA as a template and performing RT-PCR using a primer combination according to any one of claims 2 to 4; And Detecting species of the amplification product. The method of claim 6, wherein the detection of the amplification product is performed by DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images