KR102341603B1 - Primer sets for detecting Soybean leaf crinkle mottle virus and uses thereof - Google Patents

Abstract

The present invention relates to a primer set for specifically detecting a soybean leaf crinkle mottle virus, a soybean leaf wrinkle mottle virus detection kit comprising the primer set, and a method for detecting a soybean leaf wrinkle mottle virus using the primer set, wherein the primer set comprises: oligonucleotide primer sets of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; and oligonucleotide primer sets of SEQ ID NOs: 7 and 8.

Description

Primer sets for detecting Soybean leaf crinkle mottle virus and uses thereof

The present invention relates to a primer set for detecting soybean leaf crinkle mottle virus and uses thereof.

Plant viruses cause diseases in many plants and cause serious economic damage throughout agricultural production, such as a decrease in production and quality of various crops. In particular, in recent years, as the amount of international trade in food and various plants has increased, even foreign pathogenic plant viruses that did not exist in Korea are introduced, and the damage caused by them is gradually increasing. For this reason, prevention, treatment, and quarantine of viruses on major crops are important tasks in agriculture. In addition, it is impossible to prevent or treat diseases caused by plant viruses by spraying pesticides, unlike diseases caused by fungi or bacteria. Therefore, a precise and rapid diagnosis of whether a plant or seed is infected with a virus is a prerequisite for preventing damage caused by virus infection of cultivated crops in advance and managing viral diseases.

Currently, the RT-PCR method with high detection sensitivity and convenience is most commonly used for detecting RNA viruses, and species-specific primers are required for PCR detection of pathogens. In addition, when detecting by PCR test, if the intensity of the specific reaction is low and it is difficult to determine, it is difficult to make an accurate diagnosis. Therefore, it is most important to develop a primer specific to the species to be detected that does not react with nucleic acids of other species.

On the other hand, Korean Patent No. 1250388 discloses Alfalfa mosaic virus (AMV), Soybean yellow mottle mosaic virus (SYMMV), Unreported novel virus (USV3, tentative name: Soybean yellow mottle mosaic virus), Soybean yellow common mosaic virus (SYMCV), peanut stunt virus (PSV), soybean dwarf virus (SbDV) and 'Soybean mosaic virus (SMV) multi- that can diagnose 'Specific primer for diagnosis and use thereof' is disclosed, and Korean Patent No. 0857043 discloses 'specific primer for diagnosis of soybean mosaic virus', but the 'primer set for detecting soybean leaf wrinkle mottle virus and its use' of the present invention There is nothing described about

The present invention has been derived from the above needs, and the present inventors can specifically detect soybean leaf crinkle mottle virus, a novel virus isolated from soybean plants showing symptoms of virus infection. As a result of preparing the primer set, and analyzing the specificity and detection limit, the primer set according to the present invention has 8 types of plant viruses based on legumes (Tomato spotted wilt virus, Soybean yellow mottle mosaic virus, Soybean common mosaic virus) , Clover yellow vein virus, Peanut stunt virus, Bean common mosaic virus, Cucumber mosaic virus, Soybean mosaic virus), by confirming that it specifically binds only to the bean leaf wrinkle mottle virus, thereby completing the present invention.

In order to solve the above problems, the present invention provides an oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; And oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Soybean leaf crinkle mottle virus comprising one or more oligonucleotide primer sets selected from the group consisting of (Soybean leaf crinkle mottle virus) provides a primer set for specifically detecting do.

The present invention also provides the oligonucleotide primer set; and a reagent for performing an amplification reaction. It provides a kit for specifically detecting soybean leaf wrinkled mottle virus.

In addition, the present invention comprises the steps of isolating total RNA from a soybean sample; amplifying a target sequence by using the isolated total RNA as a template and performing RT-PCR (Reverse Transcription Polymerase Chain Reaction) using the oligonucleotide primer set of the present invention; and detecting the amplification product.

Since the primer set of the present invention can specifically detect soybean leaf crinkle mottle virus, a novel virus isolated from soybean plants, it will be usefully utilized in the quarantine site of legume crops. .

1 is a schematic diagram showing the positions of the primers designed in the present invention on the genome of soybean leaf crinkle mottle virus.
2 is a PCR result of four designed primer sets.
3 is a PCR result for searching for optimal temperature conditions of the four designed primer sets.
4 is a PCR result of detection limit analysis using primer sets No. 1 and No. 3;
5 is a double polymerase (nested PCR) result using primer sets No. 2 and No. 4;
6 is a PCR result of examining the specificity of the primer set designed in the present invention for a soybean infection virus reported in Korea. Lane M: size marker, lane 1: Tomato spotted wilt virus (TSWV), lane 2: Soybean yellow mottle mosaic virus (SYMMV), lane 3: Soybean common mosaic virus (SYCMV), lane 4: Clover yellow vein virus (ClYVV) , lane 5: Peanut stunt virus (PSV), lane 6: Bean common mosaic virus (BCMV) and Cucumber mosaic virus (CMV), lane 7: Soybean mosaic virus (SMV), lane 8: negative control, lane 9: Soybean leaf crinkle mottle virus (SLCMoV). lane 6 is a composite sample.

In order to achieve the object of the present invention, the present invention provides an oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; And oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Soybean leaf crinkle mottle virus comprising one or more oligonucleotide primer sets selected from the group consisting of (Soybean leaf crinkle mottle virus) provides a primer set for specifically detecting do.

Soybean leaf crinkle mottle virus according to the present invention is a virus newly isolated from soybean plants in which the present inventors have confirmed mottle and/or leaf crinkle symptoms, and has a size of about 16.1 kb. (+) It is a novel virus with a single-stranded RNA genome. The genomic information of the soybean leaf wrinkle mottle virus is as shown in SEQ ID NO: 9.

The primer set of the present invention preferably includes one or more, two or more, three or more primer sets selected from the group consisting of the four primer sets, preferably four primer sets, that is, SEQ ID NO: 1 and an oligonucleotide primer set of 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; and oligonucleotide primer sets of SEQ ID NOs: 7 and 8;

The primer may include an oligonucleotide consisting of a fragment of 16 or more, 17 or more, 18 or more, 19 or more, 20 or more consecutive nucleotides in the sequence of SEQ ID NOs: 1 to 8, depending on the sequence length of each primer. have. For example, the primer of SEQ ID NO: 1 (20 oligonucleotides) may include an oligonucleotide consisting of a fragment of 16 or more, 17 or more, 18 or more, 19 or more consecutive nucleotides in the sequence of SEQ ID NO: 1. . In addition, the primer may include an addition, deletion or substitution of the nucleotide sequence of SEQ ID NOs: 1 to 8. The oligonucleotide primers of SEQ ID NOs: 1, 3, 5 and 7 of the present invention are forward primers, and the oligonucleotide primers of SEQ ID NOs: 2, 4, 6 and 8 are reverse primers.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

As used herein, the oligonucleotide used as a primer may also contain a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid or An intercalating agent may be included.

The present invention also provides an oligonucleotide primer set according to the present invention; And it provides a kit for specifically detecting Soybean leaf crinkle mottle virus, comprising a reagent for performing an amplification reaction.

In the kit of the present invention, the oligonucleotide primer set is the same as described above.

In the kit of the present invention, the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, and a buffer, and may further include a ribonuclease inhibitor, a thermostable polymerase, etc. not limited The DNA polymerase may be a reverse transcriptase such as an RNA dependent DNA polymerase, a reverse transcriptase originating from a variety of sources, for example, avian myeloblastosis virus-derived reverse transcriptase. derived virus reverse transcriptase (AMV RTase), murine leukemia virus-derived virus reverse transcriptase (MuLV RTase) and Rous-associated virus 2 reverse transcriptase (RAV-2 RTase) ), but is not limited thereto. In addition, the buffer may include both a reverse transcription buffer and a PCR buffer.

In one embodiment of the present invention, the kit may further include a user guide describing optimal conditions for performing the reaction. The handbook is a printout explaining how to use the kit, eg, how to prepare reverse transcription buffer and PCR buffer, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information published or provided through electronic media such as the Internet.

The present invention also provides a method for detecting soybean leaf crinkle mottle virus in a soybean sample using the oligonucleotide primer set according to the present invention. Specifically,

isolating total RNA from soybean samples;

amplifying a target sequence by using the isolated total RNA as a template and performing RT-PCR (Reverse Transcription Polymerase Chain Reaction) using the oligonucleotide primer set according to the present invention; and

It may include; detecting the amplification product.

The method of the present invention comprises isolating total RNA from a soybean sample. The soybean sample is a soybean sample showing symptoms of virus infection, and may be a leaf or a stem, but is not limited thereto. A method for isolating total RNA from the soybean sample may use any method known in the art, for example, a phenol extraction method may be used. The target sequence may be amplified by performing RT-PCR using the isolated total RNA as a template and using one or more oligonucleotide primer sets according to an embodiment of the present invention as primers. Such PCR methods are well known in the art, and commercially available kits may be used.

In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling material may be a material emitting fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer during amplification of the target sequence, the target sequence may be labeled with a detectable fluorescent labeling material. ^{In addition, when a radioactive isotope such as 32} P or ³⁵ S is added to a PCR reaction solution for labeling using a radioactive material, the amplification product is synthesized and radioactivity is incorporated into the amplification product, so that the amplification product can be radioactively labeled. The one or more oligonucleotide primer combinations used to amplify the target sequence are as described above.

In one embodiment of the present invention, the method for detecting the soybean leaf wrinkle mottle virus includes detecting the amplification product, and the detection of the amplification product is gel electrophoresis, capillary electrophoresis, fluorescence measurement, or phosphorescence measurement. , but is not limited thereto, by means of radiometric measurements or DNA chips. As one of the methods for detecting the amplification product, capillary electrophoresis may be performed. Capillary electrophoresis may use, for example, an ABi Sequencer. In addition, gel electrophoresis can be performed, and agarose gel electrophoresis or acrylamide gel electrophoresis can be used for gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, when PCR is performed by labeling the 5'-end of the primer with Cy-5 or Cy-3, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactive measurement method is a ^{radioactive isotope such as 32} P or ³⁵ S added to the PCR reaction solution during PCR to label the amplification product, and then a radioactive measuring instrument, for example, a Geiger counter (Geiger counter) or liquid scintillation The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Blank sample, total RNA extraction and cDNA synthesis

In 2013, samples showing mottle and/or leaf crinkle symptoms were collected in Chuncheon, Gangwon-do, and used as a blank sample. For the collected sample, 100 mg of leaf tissue showing symptoms was cut, and total RNA was extracted using TRI Reagent (Molecular Research Center, INC, USA). For the extracted total RNA, cDNA was synthesized using M-MLV Reverse Transcriptase (Invitrogen, Carlsbad, USA) according to the vendor's manual.

2. Soybean Leaf Wrinkle Mottle Virus Species Specific Primer Design

For the bean leaf wrinkle mottle virus species-specific primer design, first of all, among 13 viruses belonging to the same genus (Genus, Closterovirus), two species whose complete genome is not registered (Burdock yellows virus, Wheat yellow leaf virus) The nucleotide sequence information of 11 species except NCBI was downloaded from NCBI Genbank. The total nucleotide sequence of the 12 species downloaded above and the total nucleotide sequence of the bean leaf wrinkle mottle virus were obtained from DNAMAN ver. Sequence alignment was performed using 5.2.10 (Lynnon BioSoft, Canada) software. The downloaded information of 11 species of the genus Closterovirus is shown in Table 1.

Information on 11 genera of Closterovirus used for multiple sorting number Virus name abbreviation Accession no. nation One Beet yellow stunt virus BYSV NC043106 United States of America 2 Beet yellows virus BYV NC001598 United States of America 3 Carnation necrotic fleck virus CNFV LC480257 Korea 4 Carrot yellow leaf virus CYLV NC013007 Germany 5 Citrus tristeza virus CTV MK018120 United States of America 6 Grapevine leafroll-associated virus 2 GLRaV-2 KU508672 China 7 Mint virus 1 MV-1 AY792620 - 8 Raspberry leaf mottle virus RLMV DQ357218 United States of America 9 Rose leaf rosette-associated virus RLRaV NC024906 China 10 Strawberry chlorotic fleck-associated virus SCFaV NC008366 United States of America 11 Tobacco virus 1 TV-1 NC027712 China

Next, by comparing the total nucleotide sequences of 11 viruses belonging to the genus Closterovirus of Table 1 and the soybean leaf wrinkle mottle virus, primers were designed within the region specifically possessed only by the soybean leaf wrinkle mottle virus. As a result, a total of 4 sets of soybean leaf wrinkle mottle virus species-specific primers were designed.

Soybean Leaf Wrinkle Motle Virus Specific Primer Set set no. Primer name Base sequence (5'→3') SEQ ID NO: Product size (bp) One SLCMoV-F1 CGCTGCAAGGTTTAGTTTGC One 844 SLCMoV-R1 AGGAAACTTAAAGGAGGTCAAT 2 2 SLCMoV-F2 ACTCCTTTAGAAGTCTCAAACT 3 417 SLCMoV-R2 GTGGACAGGTGAAATTTCATC 4 3 SLCMoV-F3 GGTGTACCTATTGTTTCGGTA 5 734 SLCMoV-R3 AGACGAATCGACACCAAACC 6 4 SLCMoV-F4 GCATCTCTCAACCTTGATCTA 7 386 SLCMoV-R4 TAGGATACAATCCATACACTGT 8

Example 1. Diagnosis of Soybean Leaf Wrinkle Mottle Virus

In order to confirm the specificity, optimum temperature condition, and detection limit of the designed species-specific primer, individual PCR was performed for each primer set in Table 2 under the following conditions.

PCR reaction was performed using 2X TOPsimple DyeMIX (aliquot)-HOT premix (Enzynomics, Korea). PCR reaction composition was prepared by adding 1 μl of cDNA template, 1 μl of 10 pmol/μl forward primer, 1 μl of 10 pmol/μl reverse primer, and 17 μl of DNase/RNase-free water (DW) to Premix 1 tube. did PCR reaction conditions were repeated 35 cycles at 95°C for 10 minutes, followed by denaturation at 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 1 minute and 30 seconds, and 5 at 72°C. After the last extension process for minutes, the temperature was lowered to 4° C. to terminate the reaction. The amplified gene product was electrophoresed on a 1% agarose gel to which 100 ml of 0.5 X TAE buffer, 1 g of agarose, and 2 μl of EcoDye DNA Stain was added, and confirmed by gel documentation.

As a result, as shown in FIG. 2 , positive bands were clearly observed in all of Lane 1 to 4 corresponding to primer sets 1 to 4, respectively, so that the species-specific primer could specifically detect the soybean leaf wrinkle mottle virus. confirmed that there is.

In addition, using the bean leaf wrinkle mottle virus species-specific primers, the specificity of which was confirmed as described above, to establish optimal temperature conditions, a PCR reaction was performed by varying the temperature conditions of the annealing process. The binding temperature conditions were set to 4 conditions (50 °C, 53 °C, 55 °C, 58 °C), and then PCR reaction was performed with the same composition and reaction conditions as in the above method. Then, the PCR amplification product was electrophoresed on an agarose gel to confirm the result.

As a result, as shown in FIG. 3 , it was confirmed that positive bands were clearly observed without non-specific reaction in all temperature conditions of Lane 1 to 4 (50 to 58° C.) of each primer set. Therefore, it can be seen that the primer set designed in Table 2 can detect soybean leaf wrinkled mottle virus at all temperature conditions between 50 and 58°C.

In order to confirm the detection limit with respect to sets 1 and 3 among the 4 sets of species-specific primers designed in Table 2 above, an experiment was performed under the following conditions. The cDNA used in the PCR reaction was diluted 10-fold through serial dilution and used as a template. The concentration of template cDNA before dilution was 370.70 ng/μl. The dilution range was ^{performed in 8 steps from 10 -1} to 10 ^-8 , and the composition solution, reaction conditions and results were checked in the same way as above.

As a result, as shown in FIG. 4 , in primer sets 1 and 3, positive bands were confirmed only up to the category corresponding to Lane 1 to 3. That is, it was found that detection was possible up to ^{10 -3.}

Example 2. Diagnosis of double polymerase chain reaction (nested PCR)

Nested polymerase chain reaction (Nested PCR) was performed using sets 2 and 4 among the 4 designed species-specific primer sets. In FIG. 4, PCR reaction was performed using the amplification products of ^{Lane 3 (template: 10 -3} ) and 4 (template: 10 ^-4 ), which showed faint positive reactions in sets 1 and 3, as template strands. The amplification product was diluted 10-fold through the step-dilution method performed above, and using this as a template, the PCR composition and conditions above the double polymerase chain reaction were all performed in the same manner. In FIG. 5, Lane 1 to 4 are amplification products of Lane 3 of set 1 of FIG. 4, Lane 5 to 8 are amplification products of Lane 4 of set 1 of FIG. 4, and Lane 9 to 12 are amplification products of Lane 3 of set 3 of FIG. 4 For the products, Lane 13 to 16, the amplification product of Lane 4 of the 3rd set of FIG. 4 was used as a template strand.

As a result of performing a double polymerase reaction from the amplification product showing a faint reaction in FIG. 4, ^{positive bands up to 10 -1} and 10 ^-4 were clearly observed (FIG. 5). Through this, all of the designed soybean leaf wrinkle mottle virus species-specific primers can specifically detect soybean leaf wrinkle mottle virus when PCR diagnosis is performed. It was confirmed that the present virus can be efficiently diagnosed from the template strand of

Example 3. Verification of specificity for soybean leaf wrinkle mottle virus

In order to verify the species-specific reaction of the soybean leaf wrinkle mottle virus-specific primers designed in Table 2, individual PCR was performed for each primer set for 8 plant viruses reported in domestic legumes. The eight plant viruses are as follows: Tomato spotted wilt virus (TSWV), Soybean yellow mottle mosaic virus (SYMMV), Soybean common mosaic virus (SYCMV), Clover yellow vein virus (ClYVV), Peanut stunt virus (PSV), Bean common mosaic virus (BCMV), Cucumber mosaic virus (CMV) and Soybean mosaic virus (SMV).

As a result of the PCR reaction, it was confirmed that the primer set designed in the present invention as shown in FIG. 6 specifically reacted only with soybean leaf wrinkle mottle virus, and did not react with other legume-derived viruses.

<110> Korea Institute of Arboretum Management <120> Primer sets for detecting Soybean leaf crinkle mottle virus and uses it <130> PN20268 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 cgctgcaagg tttagtttgc 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 aggaaactta aaggaggtca at 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 actcctttag aagtctcaaa ct 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gtggacaggt gaaatttcat c 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggtgtaccta ttgtttcggt a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agacgaatcg acaccaaacc 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gcatctctca accttgatct a 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 taggatacaa tccatacact gt 22 <210> 9 <211> 16163 <212> DNA <213> Unknown <220> <223> Soybean leaf crinkle mottle virus <400> 9 gtttttatac cagtctcttt gctcttgcgc acgttggtgt tgcttttgca aagttttatt 60 accgtccttt attcttcttc tttctcggtt acttacttct ttctgctctt gtttcaatgg 120 cttactcaat ggcgtccctt tactccttcg ttcacgcttt gttccatctc tacatcgctg 180 aacttaccac tgatagcttc aagtcccgtg ccacccgttc tgctattcag aaatatctta 240 gcgattcctc gagcgacgat gctcaagttg ctgtccctca tgttagcgaa gatcgctttg 300 ctagtgctct tcttctgctg actaatctgt tcgtttctgt cgtcccacgc tccatccgtt 360 ttggcgcaaa catcaccttc agtagtcagt ttgtgggtga tttgctcggt cgtccaattt 420 gcgatttcgt tgaaaattgc gaagtcaaat ttgggggttt cgctgcaagg tttagtttgc 480 cgtccagtgt tgttgatcaa tttttcttgc gtatcccatc cttgttttgt gatactttcg 540 attccgtttc cgtccctatt tcttccctac ctttgcagtt tgatcgtatt ctgcgtttgt 600 cttctactta tgtctctgcg tccactgtaa ccaagaattc tctcggaact ttcgtgtcaa 660 acgtttgttc agcgaaacct tctttaagtc cctttttaag tgcttccggt tctgaccgta 720 acactccttt agaagtctca aactccacta tattaacgtt ctccaaccgc actgaaacga 780 aatttcttgt tgtttcctca aaattcggtg ttttggggac atctaacgtt gggggtttga 840 ccaccactcc taacgatcac cctgtattgg tgaaaaacgt tggtggcact aaataccaac 900 tttacaaagc ctcatatccc cgaaggttac ccttgggtga ttgtaaagga gaaaagaagc 960 aaaagaagat caggaacaag ttggaatcca ttaagtttaa acgaggggat tataagaaga 1020 aggaaaccca atccggtgtt ccaagtaaac ccaaacataa taaaacgaat gagattccct 1080 ttttattctt tgggtctata caatccaaac ttcggatgga tgaaatttca cctgtccaca 1140 cggccgacgt gacgaatgtc gtcactgaac ccaccaaaca ccaggactct cttgtcctga 1200 ccaaacctgc acctgattta actcaggttg ctgtgaaacg gacgccggtt aatcgttcgt 1260 tccctgagct gcccaaatcc aaattgacct cctttaagtt tcctaagaat accagaaggg 1320 gtttttacaa gcatcccaac accgtcatca ccaaaaccag cccttattcg gcgactacca 1380 acacttttct ttttaaaccc aagaaaagtg ctttattaaa cggggacact gtgcagtccc 1440 ttgaaaaaat ttatctaggt cttaaaaaat tttcaccttc ccaaggcatg gtgtattttg 1500 accacttcac aaattcgctt aaagattcgt tttttgtgaa agtgatcaag tcaaccctag 1560 ccgaagtgat tttggtcagg tcggacgggt ctagttacat ttgttatttt tcgtgttctc 1620 agatgtactc agaaatgagt ttattctaca ggcgtggtgt gctgcctgta acctgcttta 1680 aatcttacac tcccccttca gggaaatgtt accttaacca catactctat ttaagtatgt 1740 gttatcggag ggttttcgac cctgtcggtg ccgacttggg ttcatttcct ctagctcctg 1800 atttcaggaa attgtgcgta gagacttttg gtaagtctag cctcgcatat cccatctacg 1860 ggaagtttat gatgaagaac acattccact gcgataacct gtccagcaca ggtttttcta 1920 tcaggcgtat gtcttgggcg atcggtggag agacgccaac tgagaaatat atcgaactca 1980 ccgacgccat gaaacacgaa ggaatcgaaa gagttctttc gaaattgggc ggtagggatt 2040 cgctcttagg gatgtcgtgc gagaaagatt taatcacttt caaaaacgaa caatactcgt 2100 accggcagga aaaagaggaa attagagttc ctttctatat gagcgagagt attcaaacga 2160 acctcgtgaa aaattatcct caattcaatc ttaagttcac gcattcctcg cattcagacc 2220 accctgccgc tgcagcttcc agactacttg aaaactatac gctgagtcgc atttgcgtta 2280 aaaatttttc tgacatcggc ggatgcccac tgtttcacac cagcgatggg aagtcgggtg 2340 gtgttcacgt ctgtagaccc gtctatgact caaaagatgc ccaaagaaaa gttcttaggg 2400 aacatcaatt aagtaggatg gttaagaaga tggagactgc gaagcttatt gaagctcctt 2460 cccgcttatc tttttgccat aaacctttgg gcgaatgtga agtgaaatcg gactctttaa 2520 ttctcgtcca agtctatgat gcaaccctgg aggacatctt taaaagcatg ctaattaaac 2580 atgccagtgt tgcctactta actatggtgt caccaggaga aattctcgac gaaagagaag 2640 ttttctattg cgctgatttg gattgtgaga tatcgataaa taagccgacc gataagataa 2700 cctacaagtt tggtacgtct tgttacacac attcgctttc gaatataacc aatatcatga 2760 aaacaccttt gtctgtatac aaaggccacc ttttttcaat tgaatgtagc gattgccgga 2820 tgggcgttaa ctattacaag atcaccaaat cagaaatcag ccctgatatg atctgcacaa 2880 agacacttag gtacaaaaga gtgcaaaacg aactttacaa agtgcggtta cctagattca 2940 atagaaagaa aaaagtttgc gtgcccgggt atgattacat ttatttggat gaaaagtttg 3000 tatccagagt atacgagtac gttgtcgcaa actgtagcgt ggtcaattcg aaaactttcg 3060 agtgggtttg gagctttata aaaagcagta aatccagagt cgtcgtcagc gggaaagtga 3120 tccatagaga cgtgcacttg gacctaaagt accttgaaaa tttttctgcc gttatgttag 3180 ccgcgggtgt gaaaagcagg ttagcttcgg aacaactagc agaaaatttg cactacctca 3240 gcggcgacgc tggtattatt gaatcggtta tgttcgccat acgggagaaa ttgagttgtt 3300 accttgattc ttttggcgaa tacttgagaa atctaatcaa gaaggttttg aattacggca 3360 tggaaataag ctttattgat ctagagggcg ctttggaacg cgtgacggac tatcacgaat 3420 tcgacgtacc gattaacgtc gtagggttcg gtaagataga tgaggaggct gaaacgtccg 3480 cctacttgaa gcgcctcgaa gaagccatcg ccgccaacac agctggtgaa gtgatagaat 3540 ctcatatcgc tgatcgacgt gtggatgcga agacgggttt ttacactcca ccgtgccacc 3600 gtaaaggagg tttacgcgga gggatttctt acgatttcaa catcctccga acaatcctgg 3660 ataacgctgt tagacttaaa cttagtccgg atatagtaag atcttatcta tcgtacgaga 3720 atcttattaa atttctgggg tcaatgttcg gacgtgtcag ttcgaccgtt tctagcgttc 3780 tgacacattt cgtcacgcat tgtctcaact ttggtggtag tttaaaacac tttcttgata 3840 aatttgtaaa attgatcggg tctatttcca gttttgtgag taactgcaac gaaccgaagc 3900 tgctcgagtc gctgttggta gcgttttggg attgcaccgc cggttcttta attaaaaaca 3960 caaaggccca atttaaagtt gttattaatt ctgttctgcg gctggtcgcc gttgtgaaac 4020 ttcgcgttac ggagtgcaag ctagtgaaat tccttgatag gtatttatcc agctggtgcg 4080 aaggtatttt tagcgatgat ttaacgtgca tctctattga aaccatcgtt agcgccgcaa 4140 cgtacgctat cgtttacgct ctcaatttgg gtactaagaa cataagtggc gtccaatttg 4200 tcactacggt ccttaggtgt atgggagtcg aactaaatct gagatttctc aagtctgaac 4260 acttaggaaa tggagcgtcc acggtggatg aatacctgtt ttataagaac ttattcatgg 4320 gtgtcactgt cgggttttcg ggtttaggct tctacacaag tctcgtcgtg ggcagcggtt 4380 tagtccccaa catcctgcga agaatttgta ctcactttat atcttcagaa tccagtctat 4440 acgtcggata tattaagtgc ggcttacacg acttgagtac tctgatcacc ttaaagaaaa 4500 agatcagatc gatgatcaga gatgtcgtcg ccatgttttt aaaagaagaa ttcgctaggt 4560 tttcgagctc cgttaaactt aagtcaggta agaaggtttg tgaactcaaa caacttgtcc 4620 aattaaccat cctgaactgt ttcaataaag ttcgttcgtt ctttcctgaa actaagttga 4680 gtttgagtca acacactcca gatgacgaaa ctgagtatta ttcggccgaa gaagagttcc 4740 gggtgtcttg ggcaaatacg ctgaaattag aaggcacatc agagacaaag tcgctgattc 4800 ctgttttaag gtgcagcagt ctatcggcga cgttgtttcc aacgtgagga aacttaagaa 4860 tttcactacg ccttactccg aatccgacaa tgcgaaactc atgagtgctt ttattcgtct 4920 gcaagaaatg agtgacgaaa tcgacgagga acttgattgc gttctcgtgg atcctacgga 4980 agactacgac tcagattata gcgattttga agacgaacta actcttcttc gtcacgagaa 5040 acgagggggt ttacgtgggg gttctaattc ctcctttagc ctagtcagag tggccgtaaa 5100 gacccttaaa tacttagtaa aatgtgtgtg gaaagtcgcg acgtacgata ttcccttttc 5160 gaattttctt cttaaggttg ctagtgagtc gaacggtttc acgaacgctt caaccgtttt 5220 tagtctcgtc tgtgaaccgt tgcgcacgtg ttccttcgag atcattctta actacggtat 5280 cataaagcaa taccttattg aaaccggggg gtgtctcatg tgtttcggat tctacagatc 5340 cgccgccgtg gtgcatggat gcttgatgcg tatggatgaa attgaaaact cttccgtgat 5400 cgtgggctta aagtttttga tttctcaatt gcgtagaacg tttcgcaatc ttacgagtaa 5460 atgcttcgac gctactaagg gagtgcataa attcaaatcc gtgtcctctg tcggcaactc 5520 ttcgaaggct catatagcgg ggaacagtgt atcgggtacg tacgacgacg caaacaggtt 5580 gagactagaa ttggaagtcg cggttgaaga ctttcttcaa gaaaaaactc gcgacgttta 5640 caaaatgttg aaacctgtcg atagcaccaa caaagctgaa ttaattacta cacctgaaga 5700 agtaccttct tcttccggga taattcagga attcaacgtc gacaaaattg aagtgggtga 5760 aagtagttcg ctttgtctca cttttaaacc tgaagactgc gaaagggctg ttttatcggg 5820 tgacgtttgt gagaacctga aactcgagaa cactatcatc actcctgcag ataccatttc 5880 agtaccgcgg agaaagatgt tgaggaaccc gagaagcagc aactttttat tcatgttgaa 5940 taaaaatggc gaacaacccg ttccgttcgt tgtgactaaa tctgcttaca cgaacgcggt 6000 cagagaattt tactaccttc aagaagtgac ttgctttgaa atctacaata agttgagtcg 6060 ttactacgac gaactcagcg tttctgactt caacagaaaa gtcgttaatt gtggtaacga 6120 cgcggacttg tacgtacatg acgtcacgac gggcgtcgtc agcggaaaaag aaggtcgggt 6180 ggcactcaag acttttgacg accacgagta ctgtttttct tcctcaggtt tggtcaagta 6240 cgacgagagt caaaaacggg tttcgaaatt gttccataac cagacgaaat ttttagcttg 6300 tgatctgttc ttgttaggga acccctttta cagaagtttc gagttctcga acagagatat 6360 tgacgtactt ttgtacgaag ccccaccggg tggtggaaaa acttattcgc tgatcgagtt 6420 atttatgaaa cattacggtg aaaaagatat tttagttcta accgccaaca agagttctcg 6480 tgaagagatc ctgaagaaaa taaatgtggc tttaggaaaa tctaccaaga atctccccct 6540 tgctgacggt aaagtactca ctatcgactc atacctgatg aaccataggg gtctaaggtg 6600 tgatttgtta ttcatagacg agtgctttat ggtccacgcc ggaggagtac tagcctgtat 6660 ggaatttaca aaggcgaaga agtgtctaat gttcggtgat agtaggcaga tacattacat 6720 tgaaaggaac gagtatgaag ccgcgttata ttctgactta gacaaattca tcgctccgga 6780 agctcgagtc tacggcgaca tttcttacag gtgtccgtgg gatgtctgtg tttggctgtc 6840 ggacaactac cctaatttga ttaggagtac gaatgtctcg agtgaaggga agtcctcatg 6900 aacataaagg agatcgagtg cgttgaggat gtgccggtgt cggatgacta tgtttatctg 6960 actttcttgc aatccgagaa gaaagagctc gaaaaatact taaagaaaaa taattgtaaa 7020 tcgtttgtca agacagtgca cgaaactcaa ggtgatactc attcaaaggt catgctggtt 7080 aggaccaagt ttcaagaaga cgatcctttc cgtagtttta accatattaa tgtcgccata 7140 tcgaggcaca ctgaatcttt gacatatgcc gttctaagcg ctcgtcgtaa tgatgacatt 7200 tgcgaggcga tcaacagatc taaagctcta gtggataaat ttagagtgaa tccaaccact 7260 ttctccggca gtgtgcttga cattaacgtc aaccaagttt ttcctgacaa taccacttgc 7320 aaagctacct ctgctcccgt gggggtgatc aatgacttcc ttaatgaagt tgttcctggt 7380 agtgcaacga ttgacttcgg tgacttatcg tcggatctct cttcacaacc ttttgaatca 7440 ggtgctgacc atgtcgtgat tagagactcc gctaagcctg ggggtatcac agatcacgat 7500 gaacagcgcg tttagcgcag tgcggtcgca ggctattcct aaaagaaggc cttcactaca 7560 agaaaacctt ttgtcatacg aatcaaggaa ttataactat aatatactgg aaaggttttc 7620 tagcccagaa gatttcggac acgctatggc tatgaatgtc ataagaaact gcttagactt 7680 agaaaaggtg gcggagatgc gaaatgaagt tattgcgata accgaaaaag ggtttcggga 7740 atggtgcagt aagcgatctc catctcagct caaagctctc gagagcgatt tacagcgtcc 7800 tctagtgatc gaagaagaaa taatcaggtt caagctcatg gtaaaaaggg atgctaaagt 7860 aaaattggat tcttcttgtt tgcagaaaca cccccccgcg cagaacataa tgtttcaccg 7920 taaagctatc aacgccattt actcgccgtg ttttgatgag tttaagaaca ggttcttagc 7980 gagtttaaat ctcaacattg tattttttac cgaaatgacg aatcaaacct tcgcctccat 8040 agtcggtaac atgttaaaca acgaaggttc atttgaagtg ggagaaatcg acttctccaa 8100 gtatgataag tcgcaagatg cgtttataaa agcttacgaa agaactctat acgcggagtt 8160 tggtttcgat cctgagcttc tgagtatctg gatggaaggc gaatacttaa gcgaagcgac 8220 gactctcgat gggcaacttt cattcaccgt ggagaatcag aggaagtccg gtgcttcgaa 8280 cacgtggatt ggtaattcta tagtgaccct gggtatcctt gccatgtttt acaaattaga 8340 tagatttaaa gccgtctaca tttccggtga tgattctctg ttattttcgg atgtaccgat 8400 agctaatcat gcagaaagca tatgctcgga attagggttt gaaactaaat tcctcaaccc 8460 tagtgtacca tacttttgct cgaagttctt ggtcattctt tctaacaaga cttacttcgt 8520 gccagatccg tacaaacttt tggtcaaact gggtgtggct agagatgaag tggaagatga 8580 agagttgttc gaagttttca cttcatttag agacttaaca aaggatttgg ttgacgaaag 8640 agtcctgcaa gttctggctt taatggtcaa cgctaaatat ggtatagaat ccggtaacac 8700 ctttctagct ctttgtacta tacattgctt aagagcgaac ttctcttcct tttcgaggct 8760 atttcccagg agaaggggtt ggaaagtcgt cttcggaaaa tacaagactc ttttcagaaa 8820 ggttaagaac ttctttagat acacgacgga gtcgattcat tcgcccttcg gtgaagcata 8880 ttttctctat cgagagtaac ttctgttctg cgcagctaca gaagcaaata ataaaatgac 8940 tttagaatac gtatttgatg cttacggttc cgcttgtaac ggctggaatc gttctgatat 9000 aataacactc tacgctaaat taaaccgtaa taattttagt tccttgattt acggcgaacg 9060 gcgttgggtg ttatggttgg acgacaaaga gaatatcttt gagcttgttt tccaaagaac 9120 tggtgttgac tcgtacgtcg ttttcgaggt taacaggaaa ctcgacgatg aacatcacga 9180 taccagtcgc atactacaca aaggaaagct cactagccac gacactttca taaaagtgaa 9240 tttacacgcc ttggacgaaa atatcgtacg cgtcgcggtt tcgtttagtg gtgtacctat 9300 tgtttcggta gcgaacgtct ccacattgag tcccgaaaac ttgtttttag cgtttgggag 9360 tgaaacgtgt tttactggtc aatacgtaga cgacctcttt tggttatcaa ccgcttggga 9420 ttctataact ttttcgggtt tcgatgctcg attcgtgcgc ctcgaaaata ggcgtaccac 9480 tccgctcgca tctctcaacc ttgatctaag cgaatctccc ggcgtcttta acaatgtacc 9540 aaatttttcg cgagaaacca attcaagggg ttccaatcga aacaaggtaa agatagaaaa 9600 ttttttaaat gctgatcaca ataacttcgg ttctaatgcc gcggattcct tgtctaactt 9660 tacacctatt aaagtttcaa ccccacctgc gtcgggagaa ccaacgcctg tcgattcgcc 9720 tccttatatt cgtaaaagaa aagaaggctt cctcactaca tccttttacg tcgacttatc 9780 ggctctgctc atagtcatat tgttgttagt tgttggtgtg tgtttgtgga tttcaagtta 9840 aagttttaga tacagtgtat ggattgtatc ctacgttcgt acttactttt agctttcggt 9900 gtttttatca gtcttttgtt agttttcctc tcctttgttt tatataagtt ggttaaatac 9960 atcaacaaca aaccgtctga cttacacgtt ggtgactctc gaaggtttgg tgtcgattcg 10020 tctagggtta tataatggtg ttattcggtt tagacttcgg taccactttt tctagtttgt 10080 gtgttttcaa gtcgggaaaa atcgtggctc ttaaacaaca gaactccgct tatatcccta 10140 cgtatttatt cttacatgcg aactcagatg atatggttta cggttatgac gccgagacgc 10200 tcagcactag tggtgagatc agaggaggat tctttagaga tctcaagaga tgggtcggat 10260 gcgacgaatc gaacgtgcag gagtatatcg ataaacttaa acctcactac tccgtcacga 10320 tggcccctta cggagcgggt tctaagaaaa taccagtttt aggagcttat tcgggggaca 10380 cgtctatgac tgctagttta gccgggttga tctcttactt catcagatcg atcgttactt 10440 ctgcgtgtga agccttcacc tgcgaatgta caggtcttgt ggtatcagtt cctgctaatt 10500 acgactgcat gcaaaggtcg ttcactgaaa actgcgctaa tctcagcgga ttcacgtgcg 10560 tgtatatgat gaacgaaccg tccgctgctg ctttagcgag ttgtagcaaa gtgggaatgt 10620 cgttgaagaa cttgttggtt tacgattttg gggggggcac tttcgacgtt tccgttattt 10680 cggcacgtaa ccaaaccttc gtcgttaaag cttcgggtgg cgacatgaat ttaggtggaa 10740 gagacgtcga tagagcattt cgcgaggaac tttactctat cgcgggactt cccgtggaca 10800 acgaaattga cgtttctgct ctaaaagaaa ctctgtcaaa aatctcattt ccgattaagt 10860 ataacatcaa atccacggac ggccgtcaag ccactgttat ggtagaacca tcgttattaa 10920 ataaagtcat gaagccgttt gtcgagcgta ccgtcggtat tatgcgcgac gtattcaaca 10980 aatacataaa aaatatgggc ttacaccagt cgggatcaaa agtttcctta gtcttagttg 11040 gcggttcttc ttacttacct ggtttgaaag cacttttagg gtcgatagat ttcgtcctcg 11100 aaattataga cttagcggat gctagggctg ccgttgctgc tggatgcgct ttatactcat 11160 catgtataac gtctgaatcg tctatgttgc tagtggattg tgcttcacac aatttgagtg 11220 tgcccaccgg aactggcgaa agtatcgttt tactgccggc tggagctccc atcccgttta 11280 acggtactag aaacattaac ttgaatcgtt gcacacgcac tgcttgttat actcccgcct 11340 tatttgaagg cgagtactta aagtgtgcca gaaacaggaa aatctttagt ggtactgttg 11400 ttttgtcttc tctcggtgtc actacaactg tacctaccac cattcttctc agactagaaa 11460 ccgaggtgtc tagtgtaggc actgtgaaat tttttatagt cggaccttcc aacgaaaaaa 11520 ttctcgtcgg tggtaagcct gcttacgatt tcagtcgtga aactcttaga actcgttacg 11580 tcgctgactt gcacaaaagt aattttaata gagtattgct tatgctagcg ctcacgcgca 11640 ctgctaagtc cagatcgcgg ttgactgaac ccgagaaatc tagagtcgag tcgtacaccg 11700 aagtgaaaga cgtcgaaagg gaatacaaga gatactcaaa caacgatgac tcaatactac 11760 ccttctgcag ggtactcttg gggaacactg ttcaaaaaat tttacgggga gcccgattgg 11820 aagaattacc tttctaaagc tcaaggtagc tataaaccgt ctctcacgaa cggtattaac 11880 ttccttaatg gtgataaggt atcttctact tcgatttaca acgctcgttc cgggacattt 11940 gagtacgaac tcggtttgtt gcggtacagc gagaaacttt tcggttgggc taaaatcgtc 12000 gaaagcgata ttgattccat actgaaatac ataaacgacc cgggggcttt ttcacacgac 12060 gagtacgttg aagttgacgt caaaagtgtc gggtgtcgtt tcaccgtaga taacgtgaaa 12120 gaatatttga aaacacaaga accttccgtg atcgaacacg cttggtcttt gtctaattct 12180 tgtggggaat tgataaatcc ggacgatacg tcaaggttca tcgaactgac atttaagaat 12240 caagacttaa ttaccagcac cgaagcgaaa gtggacaaca aaatcagtga ctatctagtg 12300 tactgcctaa ccatgtacga tgcctcaaaa aagaaatcgg gtttggccaa gacacaacta 12360 tatgaaagtt acgttaaaaa tgtcaggaga tacttagaaa acacggacct atattacaac 12420 aaaccgaatg ataaccctct gttaagtggc atgttgtacg acatgtgcag tgaatacaac 12480 atctattcct cgagttacaa gaagaacttg gaggacttta aggtattcac gcggcagtat 12540 ttaccactta tagaagacgt attcgaattt agttggttat caccttctga agatgaaaga 12600 ttgttatttg aaatcgagcc gtacgaaata ctcactgaag taccaacaat gagtattatc 12660 gacagcaccg tggtgttgga cagcaagctc aaatacttgg agtcctacca tgagaatgac 12720 cctataacag ctatagaaga taaactagaa gctatcatgg tatcgtctaa tcctgagatt 12780 agcagagata aactgtggat ttcgttcttt ttgtattacg gagaataccg aacggctagc 12840 tctagggtca accctaggcc ttctgtgtat aaagtaccag accgagttgg aaattgggaa 12900 gtaaattttt cacaagtgga acagtttttc gacaaactcc aacgtaactc cccttcagtc 12960 tcagttaggc ggaggttttg cggagctaag gcgcacgagt cgttcgttgt atttaaaact 13020 tttaacattg ggtttccacc aattacgaga ctcaatgttc cgcagaaata ctcctatctc 13080 aacgtggact attataagtt cgccaacaga agttacttgt ccgaggatga gttaattata 13140 ttgagcaacg tagctaaaga tatcgacacc atgtgtgtag aacggacgat ttccgtgaaa 13200 gataaaccca tcgctcagcg taaagggttg ctcgttaatc acaacagact gagactcaac 13260 aataagaaca ctttagttaa tactttgtgg aaaaatgccg gaagatcaa agcaagtcat 13320 ggttgaggcc gctatagtac cttacgtatc ggcttctaaa gaatccatcg aaaaatttta 13380 caatggttac gatcacaatt cttttgtgca agttaaccca aacatactca acaaagagga 13440 aattagggtg gtattcgata agttgctgac tgaaatgaaa cagacgttac aaatcgtaga 13500 caaagacttt cacatacaca tttgtttctt cttactgcgt gttggttcgg tcggatgcag 13560 ttcgaaaact cagtatactg gtggttacga gtacgtcgtt gattcgaaga agtattcggt 13620 caaggatgtt tggatattcc ccaccataaa gagtatagtt tccgctttac ccaataagaa 13680 acccaacggt cttaaagcat tttgctcttc attacaagac ttgtacttac tcgtcgcacc 13740 gatgtttccg gagtcctttt cgaatcgcac cgtgggcgtg cgaggagtgc ctaagggaga 13800 agagtatctc ggttgtgact ttctgaccgc taccagtcca ctcatggaca accaccaacg 13860 ggctataagt ttgtctgctc aaaagaacgc tatcgagagg agcgcttcta atactagtga 13920 aagaagaata gttagtcttt atgacatcgg aaaatttgtc acactctaaa tgtgaaagtt 13980 gaatctcagc gctgcttacg actcgggtat tattttgttc cgtgttactg atcgacgaac 14040 aaacttcttg aacatttagg tttttacaat tctaactatg ggcgatgaac aagctaagca 14100 agctggcgga tctttagcta tcgtcaaccc tgtagttgac gacggcaggt tttccgcgat 14160 cacattagcg tcaacaactg agcttaatgg tgaagcgaag aaattactga aagcaaacgt 14220 actcaagctc ttcaccgata aaggtgtttc cgatgttggt gctgaaaatt gtttgggtct 14280 acttctgtat acgttagcaa tgactggcac gaccgctaag tattcaccac cgggtgacga 14340 actcgttttc caaacaacag ttgctaacgt taccataagt ttaacttgga gcgaatttcg 14400 cgctgtaatg aatgctgatc cccatttaaa gaaacatgtg aacaaactta gggtattcgc 14460 caggactttc gctgaagaat atctcaattt cacacgtaat tacaagtcgg agaaacaatt 14520 gccggagatc cccagagcta acaggcttgg tataccggct gagttcagtt acgcggctgc 14580 tgatttcctg ctaacgacat ccattctccc cgagttagaa caagcggtat tactcaacgc 14640 tagaaataac gcggttagaa ccgatgtctc tgaccatgtt cctatcacta gcttggacca 14700 actgggcaga aagagaattt gaaccctaaa acgtacgact acgatatgca agtaagcgat 14760 ttcaaacctc acatcgtagc gacgaaagat gattacgaga ttgtcgtttc tgttgatgca 14820 actacgtatc ttctggtttt taatcgtgac gttttaaaac atcctaactt taagttaccg 14880 gttttgtgct ttgagtcgtt gtggatttat gaagacaacg tcgtcgttga caagcatgat 14940 agtatatccg agttgaatcg cgctatacac gaaatcgacg gttggatctc gctaaagcgt 15000 gtgacccaac tgatatatga cgtgaattct tgtctcgaag ttattacaac tgcctataag 15060 aggtgcgaga tcttgaaagt acgttaccaa tctcagttaa ctgctttcat aattcttgac 15120 cacgatgcgt cgacgatcgg agcacctatt gagaatacga tggtgaaatt aggtaacggg 15180 tttttgggcg caaattcaaa cttggccgaa gttataaacc tatacccttc gacgaaagtg 15240 atgttctgtg tcatatgacc gagcgctgcc gtggtcgttc ctgttgaagt gtttagtgat 15300 atttaatcaa tttcacgatg cctgcgtttt tcttacccat cgaatacttt aggaactgtg 15360 gtgaaggcgt taactcttta catcagaagc tacattccgg cgaggaaata gacattggcg 15420 agatgatcgg ttcattcaat gacctaagcg cgaaaaactt taccatgaag aattttgtac 15480 tatggttaaa aaatcttaca ccggacgtaa cttacgtcga aaatgaagtt atcttgcacg 15540 acacacaaaa ccagttaagc gagataaagt ttaaacttcg cgaactcctc gccgcctcgt 15600 tttgcaacga cacgccgaga gatatatttc tgttcctgtt agaaactgct ttttccaaca 15660 gtaacacaac ccctgaagaa tctttagaga agaccgttaa gcagtttacg actgctgtgt 15720 atcgagtgct ttcgctaaaa cattctttag atctcagccc gcgaatcttc aagcactcca 15780 tggtgcaaga gagcggtctt aaactcaaac atctgctttc ggcatattac gacatatccg 15840 aagaacaggt gaataacatt tacgaacgtt gtactagaaa cgttcgtgga tatagggtga 15900 cactttcgtg aactttaaca ccctattatc ttaattaata attaaatata aataataaat 15960 tttataaaat aaatataatt aatcttaaat aaagtttaac agggtcgatg tcctttaata 16020 ccctattcgt taagtttcca cagagtggta acggtcggaa gtccgactta gtgttaacgt 16080 agtgaataaa tagttctgag cagaagtttc aacgccttgc tcagttcatc tttaagatat 16140 tcatcttaaa gatctaaata aag 16163

Claims (6)

oligonucleotide primer sets of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; And oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Soybean leaf crinkle mottle virus (Soybean leaf crinkle mottle virus) comprising one or more oligonucleotide primer sets selected from the group consisting of a primer set for specifically detecting. According to claim 1, wherein the oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; and oligonucleotide primer sets of SEQ ID NOs: 7 and 8; a primer set for specifically detecting bean leaf wrinkled mottle virus, comprising: The oligonucleotide primer set according to claim 1 or 2; and a reagent for performing an amplification reaction, a kit for specifically detecting Soybean leaf crinkle mottle virus. The kit according to claim 3, wherein the reagents for performing the amplification reaction include DNA polymerase, dNTPs and a buffer. isolating total RNA from soybean samples;
using the isolated total RNA as a template, and performing RT-PCR (Reverse Transcription Polymerase Chain Reaction) using the oligonucleotide primer set of claim 1 or 2 to amplify a target sequence; and
A method of specifically detecting a soybean leaf crinkle mottle virus, comprising a; detecting the amplification product. The method according to claim 5, wherein the detection of the amplification product is performed through gel electrophoresis, fluorescence measurement, phosphorescence measurement, radiometric measurement, or a DNA chip.

Images