KR101651815B1 - Primer set for diagnosing White clover mosaic virus and uses thereof - Google Patents

Abstract

The present invention relates to a clone mosaic virus (WCLMV, White) comprising oligonucleotide primer sets of SEQ ID NOS: 2 and 10 and an oligonucleotide primer set of SEQ ID NOS: 4 and 10 clover mosaic virus diagnostic oligonucleotide primer set, oligonucleotide primer set, oligonucleotide primer set, reagent for carrying out an amplification reaction, and a method for diagnosing WClMV using the oligonucleotide primer set, wherein the infection with WClMV Is more than 1,000 times more accurate than the conventional method using antisera. Therefore, it can be used effectively in the quarantine field.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a white clover mosaic virus detection primer set,

The present invention relates to a primer set for the diagnosis of a white clover mosaic virus and its use, and more particularly to a primer set of oligonucleotide primers of SEQ ID NOs: 2 and 10 and a primer set of oligonucleotide primers of SEQ ID NOs: 4 and 10 WClMV, White clover mosaic virus diagnostic oligonucleotide primer set, the oligonucleotide primer set, and a reagent for performing an amplification reaction, and a method for diagnosing WCLMV using the oligonucleotide primer set.

Most of the agronomically important crops are harvested and quality degraded by plant viruses or viroid infections, resulting in serious economic losses. Unlike diseases caused by fungi or bacteria, diseases caused by plant viruses can not be prevented or treated by spraying pesticides. Therefore, precise and rapid diagnosis of viral infection of plants and seeds is a prerequisite for virus disease management in advance, and prevention of damage caused by viral infection of cultivated crops.

White clover mosaic virus (WCLMV, White clover mosaic virus) is a phytopathogenic virus belonging to the virus group IV (+) Plexiglas bayireoseugwa (Flexiviridae) included in the text virus (Potexvirus) as ssRNA virus. WClMV is a flexible filament with a width of about 480nm and a width of 13nm. The RNA of WClMV is about 5.85 Kb, and five genes each encode five proteins (RNA replication, triple gene block protein 1, triple gene block protein 2, triple gene block protein 3 and coat protein) 44.1%.

Currently, RT-PCR methods with high detection sensitivity and convenience are most commonly used to diagnose RNA viruses. When the virus is diagnosed using the PCR method, it is necessary to provide an inspection system against discrimination of the infection due to a low specific strength of the reaction or against nonspecific reaction with other nucleic acids. In addition, the use of isolate-specific primers can lead to failure of diagnosis, and development of species-specific primers capable of detecting all the isolates present in the virus species is required.

Accordingly, the present invention provides an optimal primer for WCLMV diagnosis and a nested primer corresponding thereto, a species specific primer bank capable of supporting the same, and a positive control, so that white clover mosaic virus can be rapidly detected from plants PCR system.

Korean Patent No. 0857043 discloses a specific primer for diagnosis of soybean mosaic virus, Korean Patent No. 1093024 discloses a primer combination for Arabas mosaic virus diagnosis and its use, The primer set for clover mosaic virus diagnosis and its use have not been described.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned needs, and it is an object of the present invention to provide an optimal PCR primer set capable of specifically detecting white clover mosaic virus (WCLMV), a nested PCR primer set for assay, The present inventors completed the present invention by developing a plasmid containing a DNA fragment that can be used as a positive control.

In order to solve the above-mentioned problems, the present invention provides a white clover mosaic virus (hereinafter abbreviated as " white clover mosaic virus ") comprising at least one oligonucleotide primer set selected from the group consisting of oligonucleotide primer sets of SEQ ID NOs: 2 and 10 and oligonucleotide primer sets of SEQ ID NOs: (WClMV, White clover mosaic virus < / RTI > diagnostic oligonucleotide primer set.

The present invention also provides a WClMV diagnostic kit comprising the oligonucleotide primer set and a reagent for carrying out an amplification reaction.

In addition, the present invention provides a method for diagnosing WCLMV using the oligonucleotide primer set.

Using the WClMV diagnostic oligonucleotide primer set, the WClMV diagnostic kit, and the WClMV diagnostic method using RT-PCR of the present invention, the infection of WCLMV from plants including maize or soybean crops is 1,000 times It can be confirmed accurately and quickly so that it can be used effectively at the quarantine site.

Figure 1 is a photograph of a plant that has symptoms of infection with white clover mosaic virus (WCLMV).
Fig. 2 shows the result of the first selection for the specificity test for WClMV as a result of performing RT-PCR using the WClMV diagnostic primer combination (see Table 3).
FIG. 3 is a graph showing the results of non-specificity test using the positive control and the reference viruses PVX, TSV, AMV, ArMV, SLRSV, BBWV, TSWV, TNV and WMV as primers using the primer sets selected through the first selection among WClMV diagnostic primer combinations (Order of loading for each primer set, order of positive control, PVX, TSV, AMV, ArMV, SLRSV, BBWV, TSWV, TNV and WMV).
FIG. 4 is a result of a third selection in which a nonspecificity test with host genomic DNA was performed using two primer sets selected through secondary selection among WClMV diagnostic primer combinations.
FIG. 5 shows the sensitivity test results (A) and the nested PCR primer selection results (B) for the WClMV diagnostic primer sets 9 and 14. (A) indicate the dilution concentration of the positive control plasmid.
Fig. 6 shows the nucleotide sequence (431 bp) of a mutation-positive control containing nested primers WClMV_F3 and WClMV_R4 primer positions and inserted with a nonspecific base sequence. The binding sites of the primers WClMV_F3 and WClMV_R4 for the test were [_], and the insertion positions of the nucleotide sequences were indicated by black boxes.

In order to accomplish the object of the present invention, the present invention provides a kit comprising a set of oligonucleotide primers of SEQ ID NOS: 2 and 10 and a set of oligonucleotide primers selected from the group consisting of oligonucleotide primer sets of SEQ ID NOS: 4 and 10, Mosaic virus (WCLMV, White clover mosaic virus < / RTI > diagnostic oligonucleotide primer set.

In one embodiment of the invention, the WClMV diagnostic oligonucleotide primer set of the present invention preferably comprises a set of oligonucleotide primers of SEQ ID NOS: 2 and 10 (combination 9) and an oligonucleotide primer set of SEQ ID NOS: 4 and 10 ), More preferably an oligonucleotide primer set of SEQ ID NOs: 2 and 10 and an oligonucleotide primer set of SEQ ID NOs: 4 and 10 are added to the set of oligonucleotide primers of SEQ ID NOs: 3 and 10 primer), combination 12) and an oligonucleotide primer set of SEQ ID NOS: 5 and 10 (nested primer, combination 16), and most preferably, the oligonucleotide primer set The oligonucleotides of SEQ ID NOS: 2 and 10 The oligonucleotide primer set of SEQ ID NOS: 3 and 10 (nested primer, combination 12) and the oligonucleotide primers of SEQ ID NOS: 5 and 10 were added to the primer set (combination 9) and the oligonucleotide primer set of SEQ ID NOS: 4 and 10 (Nestled primer, combination 16), but is not limited thereto.

Namely, the WClMV diagnostic primer set of the present invention comprises a nested set of primers (WClMV_F3; SEQ ID NO: 3) having a function for the RT-PCR product of WClMV diagnostic primer combination 9 (WClMV_F2; SEQ ID NO: 2 and WClMV_R4; SEQ ID NO: (WClMV_F5; SEQ ID NO: 5 and WClMV_R4: SEQ ID NO: 10) having a function of checking for the RT-PCR product of WClMV_R4 (SEQ ID NO: 10) and WClMV diagnostic primer combination 14 (WClMV_F4; SEQ ID NO: 4 and WClMV_R4; SEQ ID NO: Number 10). ≪ / RTI > PCR assays are performed using primers (nested primers) for this primer combination to determine if the results of the primary RT-PCR test are required, ie, whether the RT-PCR product is derived from WClMV. If the RT-PCR result is derived from WClMV, it will be positive in PCR for assay.

Wherein the oligonucleotide primer comprises oligonucleotides consisting of fragments of 16 or more, 17 or more, 18 or more, or 19 or more consecutive nucleotides in the sequence of SEQ ID NOS: 2, 3, 4, 5 or 10 according to the sequence length of each primer . ≪ / RTI > For example, the primer (20 oligonucleotides) of SEQ ID NO: 3 may comprise an oligonucleotide consisting of fragments of 16 or more, 17 or more, 18 or more, 19 or more consecutive nucleotides in the sequence of SEQ ID NO: 3 , The primer (18 oligonucleotides) of SEQ ID NO: 2 may comprise an oligonucleotide consisting of fragments of 16 or more and 17 or more consecutive nucleotides in the sequence of SEQ ID NO: 2.

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, the oligonucleotide used as a primer also includes a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid Or may include an intercalating agent.

The present invention also provides a WClMV diagnostic kit comprising the oligonucleotide primer set and a reagent for performing an amplification reaction.

In the kit for WCLMV diagnosis according to an embodiment of the present invention, the kit may further include a DNA fragment having the nucleotide sequence of SEQ ID NO: 12, but is not limited thereto. The DNA fragment having the nucleotide sequence of SEQ ID NO: 12 can be used as a plasmid having a positive control function for RT-PCR or PCR reaction using a WClMV diagnostic oligonucleotide primer set (FIG. 6).

In one embodiment of the present invention, the reagent for performing the amplification reaction may include a DNA polymerase, dNTPs, and a buffer, and may further include a ribonuclease inhibitor, a thermostable polymerase, and the like But is not limited thereto. The DNA polymerase may be a reverse transcriptase such as RNA dependent DNA polymerase and may be a reverse transcriptase from various sources such as avian myeloblastosis virus- derived virus reverse transcriptase (AMV RTase), murine leukemia virus-derived virus reverse transcriptase (MuLV RTase), and Rouse-associated virus 2 reverse transcriptase (RAV-2 RTase , But is not limited thereto. In addition, the buffer may include both a reverse transcription buffer and a PCR buffer, and the thermostable polymerase may be an EF Taq polymerase.

In one embodiment of the present invention, the kit may further include a user guide describing optimal reaction performance conditions. The guide is printed to describe how to use the kit, for example, how to prepare reverse transcription buffer and PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In addition,

Isolating total RNA from the plant sample;

Amplifying the target sequence by performing RT-PCR using the separated total RNA as a template and using the oligonucleotide primer set; And

And detecting the amplification product. ≪ Desc / Clms Page number 2 >

The method of the present invention comprises separating total RNA from a plant sample. Any method known in the art may be used as a method for separating the total RNA from the sample. For example, a phenol extraction method may be used. The target sequence can be amplified by performing RT-PCR using the separated total RNA as a template and using one or more oligonucleotide primer sets according to one embodiment of the present invention as primers. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method according to one embodiment of the present invention, the plant is selected from the group consisting of a variety of plant species, such as a goosebone, a genus, a modern beet, a beetroot, a cuneiform, a cedar herb, spinach, Salicornia, may be chenopodiaceae (Chenopodiaceae) plants or clover (shamrock), Cassia tora, Rakes herbs, butterfly herbs, peas, beans, deulkong, kidney beans, such as soybeans and (Leguminosae) plants, including including Homo seconds, preferably May be spinach, pea or clover, but are not limited thereto, and plants that can be infected with WClMV can be included within the scope of the present invention.

In one embodiment of the invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance may be a fluorescent, phosphorescent or radioactive substance, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. One or more oligonucleotide primer combinations used to amplify the target sequence are as described above.

In one embodiment of the present invention, the method for diagnosing WCLMV comprises detecting the amplification product, wherein the detection of the amplification product is performed using a DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, But it is not limited thereto. As one method of detecting the amplification product, capillary electrophoresis can be performed. Capillary electrophoresis, for example, can use the ABi Sequencer. In addition, gel electrophoresis can be performed, and gel electrophoresis can utilize agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  1. For detection of white clover mosaic virus (WCLMV) Primer  Design and combination

The PCR clone mosaic virus (WCLMV, White Multiple alignment was performed using BioEdit version 7.1.3 after securing the clover mosaic virus and the reference virus strain (pseudotyped and identical host infectious virus) sequences from NCBI (Table 1).

WClMV and reference virus for making WClMV primer Main NCBI base sequence information Virus Type acronym GenBank registration number White clover mosaic virus WClMV NC_003820 Potato virus  X PVX NC_011620 Tobacco streak virus TSV NC_003844 Alfalfa mosaic virus AMV NC_001495 Arabis mosaic virus ArMV NC_006057 Strawberry latent ringspot virus SLRSV NC_006964 Broad bean wilt virus BBWN NC_005289
NC_005290 Tomato spotted wilt virus TSWV NC_002052
NC_002050
NC_002051 Tobacco necrosis virus TNV M33002 Watermelon Moroccan mosaic virus WMV NC_006262

Primer preparation was carried out using DNAMAN DNA analysis software package (DNAMAN version 6.0; Lynnon Biosoft, Canada), and primer specific primers were screened under primer Tm values of 51-59 ° C (Table 2).

WClMV Primer Information Name of the primer The sequence (5 '- > 3') SEQ ID NO: Length (bp) location Forward


WClMV_F1 CGACATCTTAGACGAATACG One 20 4,225 to 4,244 WClMV_F2 CAACTCCCATTGACCGAT 2 18 4,247-4,265 WClMV_F3 CAGCCTTGTCACCAAAGATA 3 20 4,414-4,433 WClMV_F4 CCTATTTGGTTGACCCAGTT 4 20 4,452-4,471 WClMV_F5 TTTGCCTACACCAAGCCTC 5 19 4,512 ~ 4,530 WClMV_F6 ACACAATCTCCCATTCGG 6 18 4,805 to 4,822 Reverse


WClMV_R1 GAGATTGTCAGTTGGTGCT 7 19 4,306 to 4,324 WClMV_R2 GTTATCTTTGGTGACAAGGC 8 20 4,416-4,435 WClMV_R3 GGTTGAAAGGCAAGGATAGT 9 20 4,475-4,494 WClMV_R4 GTCTTTGTATTCACCTCCGA 10 20 4,819-4,838 WClMV_R5 CAATCAAGCCTAAGATGAGC 11 20 4,928-4,947

The primers were designed in forward and reverse directions. Based on this, a primer set capable of PCR amplification between 80-1,300 bp was constructed based on the expected amplification products (Table 3).

Estimated size of WClMV diagnostic primer combination and RT-PCR product Combination Forward Reverse RT-PCR product size (bp) One WClMV_F1 WClMV_R1 100 2 WClMV_F1 WClMV_R2 211 3 WClMV_F1 WClMV_R3 270 4 WClMV_F1 WClMV_R4 614 5 WClMV_F1 WClMV_R5 723 6 WClMV_F2 WClMV_R1 78 7 WClMV_F2 WClMV_R2 189 8 WClMV_F2 WClMV_R3 248 9 WClMV_F2 WClMV_R4 592 10 WClMV_F2 WClMV_R5 701 11 WClMV_F3 WClMV_R3 81 12 WClMV_F3 WClMV_R4 425 13 WClMV_F3 WClMV_R5 534 14 WClMV_F4 WClMV_R4 387 15 WClMV_F4 WClMV_R5 496 16 WClMV_F5 WClMV_R4 327 17 WClMV_F5 WClMV_R5 436 18 WClMV_F6 WClMV_R5 143

For the synthesis of complementary DNA (cDNA), 4 μl of the reaction buffer (50 pmol, NNN NNN NNN NNN NNN NNN NNN NNN N 3 μl of 2 mM dNTP (Enzynomics, Korea), 0.7 μl of RNasin (Promega, USA), 3 μl of M-MuLV (SEQ ID NO: 1.6 역 of reverse transcriptase (Roche, Switzerland) and 6.7 탈 of deionized distilled water were added to make a total volume of 20.. Then, 1 μl of the synthesized cDNA was used as a template, and 1 μl of 25 pmol forward and reverse primers were added to 10 μl of Fast PCR PreMixture (Plutos, Korea), and the PCR reaction was performed according to a total volume of 20 μl. One-step RT-PCR was performed using the RT-PCR PreMixture (Plutos, Korea) and the PCR was carried out at 42 ° C for 60 minutes after the reverse transcription. After the denaturation at 95 ° C for 10 minutes, the PCR reaction was repeated 35 times at 95 ° C for 45 seconds, at 55 ° C for 1 minute and at 72 ° C for 1 minute, and finally at 72 ° C for 5 minutes. All the PCR products were electrophoresed for 80 minutes in 150 μl of 1.2% agarose gel, and 4 μl of TopRed nucleic acid gel stain (Biopure, UK) was added and specific bands formed under UV were confirmed.

Example  2. Optimal for WClMV diagnosis primer  Set selection and diagnosis primer  Bank construction

Selection of primer sets for 1st to 3rd was carried out using 18 primer combinations designed for selection of optimal primer set for diagnosis of WClMV.

The primary selection of diagnostic primers was confirmed by PCR or RT-PCR using the primer set combinations shown in Table 3 to confirm that they were specific for WClMV. Secondary selection was performed using the primer sets selected through the first selection process Viral strains (viruses susceptible to nucleotide sequence-like viruses and common infection hosts, see Table 1) were selected by PCR or RT-PCR to identify non-specific results. The selected primers should be nonspecific for host genomic DNA since they were used for the extraction of total RNA from the host. Therefore, the tertiary selection was confirmed by PCR using the primer set selected in the secondary selection, which is nonspecific to the host genomic DNA. In addition, 10 μl of Fast PCR PreMixture, 1 μl of template DNA as a PCR product, and 1 μl each of forward and reverse primers were added to a mixture of nested PCR for assay, and the total volume was adjusted to 20 μl using deionized distilled water Respectively. At this time, when the band of the RT-PCR product was strongly formed, it was diluted to 1/100 and when it was weakly formed, it was diluted to 1/10. When the band was not formed, the reaction was performed using the crude solution of the RT- Respectively. The PCR conditions for the assay were the same except for the reverse transcription step of 42 ° C for 60 minutes under the above-described conditions of RT-PCR.

White clover mosaic virus (WCLMV, White clover mosaic The results were compared with those of plasmids constructed with 18 PCR primer sets selected for the analysis of viruses . As a result of analysis to confirm formation of a specific band, a band of 78 to 723 bp was formed in all of the 18 primer sets applied (Fig. 2). Four combinations (9, 10, 13, and 14) that formed a specific band considering the amplification position in the results of 18 combinations were selected as the first selection target and then the second selection process was performed.

In order to confirm the positive control and specificity of WClMV, four primary primer sets were applied to reference viruses of PVX, TSV, AMV, ArMV, SLRSV, BBWV, TSWV, TNV and WMV. And 13 did not form bands for the reference viruses, whereas primer sets 9 and 14 did not form bands for the reference viruses, confirming the specificity of the primers for WClMV, and primer sets 9 and 14 were suitable for analyzing WClMV Were selected as primers (Fig. 3).

On the other hand, as for the detection of WClMV, the possibility of WClMV generation in spinach, pea and clover was raised, and the specificity of the genomic DNA of the plant was re-analyzed as a template. As a result of performing reanalysis by applying primer sets 9 and 14, no nonspecific bands were formed. Therefore, primer sets 9 and 14 were selected as final compatible primers and sensitivity analysis was performed (FIG. 4).

Example  3. For WClMV diagnosis primer  For set sensitivity measurement and calibration Nested primer  making

The prepared 1 ng / μl plasmid was subjected to 10-step dilution to 10 ^-10 and analyzed by applying primer sets 9 and 14 selected in the specificity analysis. As a result, primer set 9 was found to have a specific band of 10 ^-8 , 14 showed that a specific band was formed up to 10 ^-7 (Fig. 5A).

From the final RT-PCR primer set, a nested PCR primer for nested PCR analysis was selected again to select the final analysis primer. A total of 3 sets of nested PCR primers (WClMV_F2 / R2; F2 / R3; F3 / R4) for primer set 9 were selected and one set (WClMV_F5 / R4) of nested PCR primers for primer set 14 was selected Evaluation was carried out. For primer set 9, all three sets of nested primers had specific bands, but when considering the RT-PCR product and amplification size, there was no problem when sequencing was performed, and the 425 bp product that produced the most distinct and bright band was amplified WClMV_F3 / R4 was found to be most suitable. In primer set 14, WClMV_F5 / R4, which amplifies 327 bp, forms a specific band and its suitability is confirmed (Fig. 5B).

Based on the above results, RT-PCR primer combination for analyzing WClMV was finally selected as primer set 9 (PCR product size 592 bp) and 14 (PCR product size 387 bp), and the amplification product of each test nested PCR Were 425bp and 327bp, respectively (Table 4).

The final RT-PCR of WClMV and the combination of primers for nested PCR diagnosis and the size of the product primer Base sequence SEQ ID NO: primer
Length (bp) Amplification product
Length (bp) set PCR type name
9

RT WClMV_F2 CAACTCCCATTGACCGAT 2 18 592 WClMV_R4 GTCTTTGTATTCACCTCCGA 10 20 Nested WClMV_F3 CAGCCTTGTCACCAAAGATA 3 20 425 WClMV_R4 GTCTTTGTATTCACCTCCGA 10 20
14

RT WClMV_F4 CCTATTTGGTTGACCCAGTT 4 20 387 WClMV_R4 GTCTTTGTATTCACCTCCGA 10 20 Nested WClMV_F5 TTTGCCTACACCAAGCCTC 5 19 327 WClMV_R4 GTCTTTGTATTCACCTCCGA 10 20

Example  4. Genetic modification for WClMV diagnosis Positive control  making

The PCR product containing the selected primer set region was amplified and cloned into the pGEM-T easy vector (Promega, USA) as an insert DNA. Five clones were sequenced and one clone with matching primer set attachment sites was selected. The selected clones were subjected to a site-directed mutagenesis kit (Enzynomics, Korea) using 6 nucleotides, which is a nucleotide sequence capable of reacting with restriction enzymes, inside the nested primer set amplification site Respectively. The EZchange ^TM site-directed mutagenesis kit marketed in Korea is a mutagenized primer. The plasmid DNA is used as a template to amplify a linear plasmid having a new mutation by the PCR method. Then, the original plasmid is removed, and terminal kination and ligation restriction enzyme sites of Xho I (CTCGAG) were inserted by performing ligation at the same time and using a three-step reaction for performing transformation.

As a result of the nested PCR analysis for the assay, all 6 nucleotide sequences were confirmed (Fig. 6). As a result, when the plasmid prepared above was used as a positive control for the WClMV test, The possibility of cross - contamination which can appear in the analysis can be detected and judged by the sequencing analysis, so it was considered to be applicable to the analysis of seed samples.

<110> REPUBLIC OF KOREA (Ministry of Agriculture, Food and Rural Affairs, Animal and Plant Quarantine Agency) <120> Primer set for diagnosing White clover mosaic virus and uses          the <130> PN13422 <160> 13 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 cgacatctta gacgaatacg 20 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 caactcccat tgaccgat 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cagccttgtc accaaagata 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cctatttggt tgacccagtt 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 tttgcctaca ccaagcctc 19 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 acacaatctc ccattcgg 18 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gagattgtca gttggtgct 19 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gttatctttg gtgacaaggc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ggttgaaagg caaggatagt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gtctttgtat tcacctccga 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 caatcaagcc taagatgagc 20 <210> 12 <211> 431 <212> DNA <213> Artificial Sequence <220> <223> WClMV positive control <400> 12 cagccttgtc accaaagata acatttcatt tggttcaccc tatttggttg acccagttgg 60 tactatcctt gcctttcaac cagacaccta ccttatcctt tgcctacacc aagcctcttt 120 cttcaaagtc tcagacgtga ttggttacca gtggcccacc gtaacgttat acctagcttg 180 caaaatttct gaaattcctg ctcgagaaga agaacgtcat ctccttttca ttggtctcac 240 tagacacact gaatctctcc tcattttagg gccagatgcc tttgactcct ccccctaatc 300 ctcagaaaac ttaccaaata gccatacttg cattaggatt agtacttctc gcctttgttc 360 tcatttctga ccattcccca aaagttggtg atcatttaca caatctccca ttcggaggtg 420 aatacaaaga c 431 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 nnnnnnnnnnn nnnnnnnnnn nnnnn 25

Claims (9)

delete delete delete An oligonucleotide primer set of SEQ ID NOs: 2 and 10, an oligonucleotide primer set of SEQ ID NOs: 4 and 10, an oligonucleotide primer set of SEQ ID NOs: 3 and 10, an oligonucleotide primer of SEQ ID NOs: 5 and 10 set, SEQ ID NO: 12 containing the reagents for performing an amplification reaction, and DNA fragments consisting of the nucleotide sequence, white clover mosaic virus (WClMV, white clover mosaic virus) specific diagnostic kit. delete 5. The WClMV-specific diagnostic kit according to claim 4, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs and a buffer. delete delete delete

Images