KR101479664B1 - Primer set for diagnosing Andean potato mottle virus and uses thereof - Google Patents

Primer set for diagnosing Andean potato mottle virus and uses thereof Download PDF

Info

Publication number
KR101479664B1
KR101479664B1 KR1020130076801A KR20130076801A KR101479664B1 KR 101479664 B1 KR101479664 B1 KR 101479664B1 KR 1020130076801 A KR1020130076801 A KR 1020130076801A KR 20130076801 A KR20130076801 A KR 20130076801A KR 101479664 B1 KR101479664 B1 KR 101479664B1
Authority
KR
South Korea
Prior art keywords
apmov
primer set
primer
seq
oligonucleotide primer
Prior art date
Application number
KR1020130076801A
Other languages
Korean (ko)
Inventor
신용길
허노열
김상목
이시원
강은하
김유정
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020130076801A priority Critical patent/KR101479664B1/en
Application granted granted Critical
Publication of KR101479664B1 publication Critical patent/KR101479664B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a primer set for diagnosing Andean potato mottle virus (APMoV) and uses thereof. A method for diagnosing the APMoV through RT-PCR using the oligonucleotide primer set for diagnosing the APMoV according to the present invention: can 1000 times more accurately and rapidly check if a patient is infected by the APMoV than a diagnostic method using antiserum; and can detect all kinds of APMoV from plants of solanaceae, thereby can be usefully used at quarantine sites.

Description

≪ Desc / Clms Page number 1 > Primer set for diagnosing Andean potato spot viruses and uses thereof.

The present invention relates to a primer set for the diagnosis of Andes potato spot virus and its use, and more particularly to an oligonucleotide primer set of SEQ ID NOs: 4 and 17 and APMoV ( Andean potato mottle virus diagnostic oligonucleotide primer set, an oligonucleotide primer set for the oligonucleotide primer set, a reagent for performing the amplification reaction, and a method for diagnosing APMoV using the oligonucleotide primer set.

Most of the agronomically important crops are harvested and quality degraded by plant viruses or viroid infections, resulting in serious economic losses. Unlike diseases caused by fungi or bacteria, diseases caused by plant viruses can not be prevented or treated by spraying pesticides. Therefore, precise and rapid diagnosis of viral infection of plants and seeds is a prerequisite for virus disease management in advance, and prevention of damage caused by viral infection of cultivated crops.

Andean potato spot virus (Andean potato mottle virus, APMoV) is a taxonomic virus group IV (+) sense ssRNA virus,Secoviridae) Comoxvirus genus (Comovirus), And the particles of APMoV have a square shape with a diameter of about 28 nm. APMoV is a phytopathogenic virus. Infected plants exhibit dwarfing as a whole, and discoloration and anomalies appear in the leaves. The virus is known to be transmitted by beetles and easily transmitted by contact with plants, but seed transmission in plants other than potatoes has not been found yet. APMoV is mainly infected with branches and crops, and the main ones are bell pepper, red pepper, habanero pepper, chili, eggplant and potato, and also infect white poplar, Peruvian apple and wild cigarette. APMoV requires a diagnostic method to detect it from various plants imported as a quarantine target pathogen in Korea.

In the past, electron microscopy and serological methods were mainly used for virus diagnosis. Electron microscopy can detect the presence of the virus, but it is impossible to diagnose it as a morphological feature. Among the serologic methods, ELISA is about 1,000 times lower in sensitivity than the most commonly used diagnostic method or PCR, and often fails to diagnose due to nonspecific reaction between antibody and test sample. In case of APMoV, ELISA is mainly used for the diagnosis of virus. However, OM is frequently diagnosed due to nonspecific reaction between plant extract and antiserum. If APMoV infection rate is low in test sample, diagnosis is likely to fail. In addition, since the diagnosis of various pathogens must be performed on a single test sample at the quarantine site, many laboratories and inspection costs are required when using various diagnostic methods.

Currently, RT-PCR methods with high detection sensitivity and convenience are most commonly used to diagnose RNA viruses. When the virus is diagnosed using the PCR method, it is necessary to provide an inspection system against discrimination of the infection due to a low specific strength of the reaction or against nonspecific reaction with other nucleic acids. In addition, the use of isolate-specific primers can lead to failure of diagnosis, and development of species-specific primers capable of detecting all the isolates present in the virus species is required.

Accordingly, the present invention provides an optimal primer for APMoV diagnosis and a nested primer corresponding thereto, and a species specific primer bank and a positive control that can support the same. The APMoV diagnostic primer of the present invention was developed to be able to respond to all known APMoV strains and includes tools for verifying positive and negative responses.

Korean Patent Publication No. 2012-0103775 discloses a primer set for amplifying a target sequence of a pathogenic bacterium and a pathogenic virus in a branch and a plant, and a method for detecting a pathogen using the primer set. In Korean Patent No. 0846174, A primer set for simultaneous diagnosis of four kinds of viruses to be generated, and a diagnostic method using the same. However, as in the present invention, the primer set for the Andes potato spot virus diagnosis and its use has not been disclosed.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned needs, and it is an object of the present invention to provide a strain of Andean potato spot virus ( Andean potato mottle The present invention has been accomplished by developing a plasmid containing an optimal primer set, a nested PCR primer set, and a DNA fragment that can be used as a positive control in a PCR reaction, which can specifically detect virus , APMoV.

In order to solve the above problems, the present invention is SEQ ID NO: 4 and 17 and a set of oligonucleotide primers SEQ ID NO: 7 and APMoV (Andean up to 13 including one or more oligonucleotides selected from the group consisting of oligonucleotide primers oligonucleotide primers potato mottle virus < / RTI > diagnostic oligonucleotide primer set.

The present invention also provides an APMoV diagnostic kit comprising the oligonucleotide primer set and a reagent for performing an amplification reaction.

The present invention also provides a method for diagnosing APMoV using the oligonucleotide primer set.

Using the APMoV diagnostic oligonucleotide primer set, the APMoV diagnostic kit, and the APMoV diagnostic method using RT-PCR of the present invention, the infection rate of APMoV of all strains known to date in the branches and crops is 1000 times or more Accurate, and fast, so it can be useful in the quarantine field.

Figure 1 is a photograph of a plant showing symptoms of Andean Potato Spot Virus (APMoV) infection.
Figure 2 shows a primer map designed for APMoV diagnosis. The location of the primers was based on GenBank registration number L16239.
Figure 3 shows the results of RT-PCR performed using the APMoV diagnostic primer combination (see Table 3) (primary selection: combinations 2, 4, 9, 10, 20, 21, 36 and 37 selection).
Figure 4 shows the result of second round of selection of the APMoV diagnostic primer by performing RT-PCR on the other selected viruses (see Table 4) that are mutually related with the first selected APMoV diagnostic primer combination (combinations 2, 4, 9 , 10, 20 and 37 starters). The viruses selected for each lane are as follows. Lanes 1, 5, 9, 13, 17, 21, 25, 29: APMoV; Lanes 2, 6, 10, 14, 18, 22, 26, 30: BPMV; Lanes 3, 7, 11, 15, 19, 23, 27, 31: CPMV; Lanes 4, 8, 12, 16, 20, 24, 28, 32: SqMV.
FIG. 5 shows the result of third-round selection of APMoV diagnostic primers by performing RT-PCR on the host-associated virus (see Table 4) with the second selected APMoV diagnostic primer combination (combination 9, 10, 20 and 37 ). The viruses selected for each lane are as follows. Lanes 1, 17, 33, 49, 65, 81: APMoV; Lanes 2, 18, 34, 40, 66, 82: AMV, lanes 3, 19, 35, 41, 67, 83: AVB; Lanes 4, 20, 36, 42, 68, 84: CMV; Lanes 5, 21, 37, 43, 69, 85: PSTVd; Lanes 6, 22, 38, 44, 70, 86: PVT; Lane 7, 23, 39, 45, 71, 87: PVA; Lanes 8, 24, 40, 46, 72, 88: PVS; Lanes 9, 25, 41, 47, 73, 89: PVX; Lanes 10, 26, 42, 48, 74, 90: PVY; Lane 11, 27, 43, 49, 75, 91: TMV; Lanes 12, 28, 44, 50, 76, 92: TNV; Lanes 13, 29, 45, 51, 77, 93: TRV; Lane 14, 30, 46, 52, 78, 94: TSV; Lanes 15, 31, 47, 53, 79, 95: ToMV; Lanes 16, 32, 48, 54, 80, 96: TSWV.
FIG. 6 shows the result of selecting APMoV diagnostic primer combination by RT-PCR for potato, dill leafhopper and tomato, which is the third and the third selected APMoV diagnostic primer combination (combination 20 and 37 selection). The selection of each lane is as follows. Lanes 1, 5, 9, 13: positive control; Lanes 2, 6, 10, 14: Potatoes, Lanes 3, 7, 11, 15: Tomatoes, Lanes 4, 8, 12, 16: Tomatoes.
Figure 7 shows end-point PCR results of the finally selected APMoV diagnostic primer combination. The dilution factor for each lane is as follows. Lanes 1 to 8: APMoV stock solution to 10 -7 dilution in order; Lane 9: negative control; Lanes 10 to 17: APMoV stock solution to 10 -7 dilution in order; Lane 18: negative control.
FIG. 8 shows the result of RT-PCR using the finally selected APMoV diagnostic primer combination and test nested primer combination.
Figure 9 shows the 315 bp APMoV base sequence amplified by the APMoV diagnostic primer combination 20 (APMoV-N40 and APMoV-C70 primers). The primer binding site is indicated by [_].
Figure 10 shows the 732 bp APMoV base sequence amplified by the APMoV diagnostic primer combination 37 (APMoV-N70 and APMoV-C30 primers). The primer binding site is indicated by [_].
FIG. 11 shows RT-PCR results using a DNA fragment (positive control) containing both APMoV-N40 and APMoV-C70 primer positions and APMoV-N70 and APMoV-C30 primer positions, APMoV diagnostic primer combination 20 and combination 37. FIG.
12 shows the nucleotide sequence (1,408 bp) of the positive control containing both APMoV-N40 and APMoV-C70 primer positions and APMoV-N70 and APMoV-C30 primer positions. The binding positions of the APMoV-N40 and APMoV-C30 primers were indicated by [_].
Fig. 13 shows the nucleotide sequence of the mutation-positive control (738 bp) containing the APMoV-N70 and APMoV-C30 primer sites and inserted with the nonspecific base sequence. The binding positions of APMoV-N70 and APMoV-C30 primers are indicated by [], the binding positions of APMoV-N75 and APMoV-C40 primers of nested primers are indicated by <_>, and nucleotide sequence insertion positions are indicated by {_}.

In order to accomplish the object of the present invention, the present invention provides an oligonucleotide primer set comprising an oligonucleotide primer set of SEQ ID NOS: 4 and 17 and an oligonucleotide primer set of SEQ ID NOs: 7 and 13, wherein the oligonucleotide primer set comprises at least one oligonucleotide primer set selected from the group consisting of APMoV Andean potato mottle virus ) diagnostic oligonucleotide primer set.

In one embodiment of the invention, the APMoV diagnostic oligonucleotide primer set of the present invention preferably comprises a set of oligonucleotide primers (combination 20) of SEQ ID NOS: 4 and 17 and an oligonucleotide primer set of SEQ ID NOS: 7 and 13 ), More preferably an oligonucleotide primer set of SEQ ID NOS: 4 and 17 and an oligonucleotide primer set of SEQ ID NOS: 7 and 13 are added to the oligonucleotide primer set of SEQ ID NOs: 22 and 18 primer set 1) and an oligonucleotide primer set of SEQ ID NOs: 23 and 14 (nested primer set 2), and most preferably, the oligonucleotide primer set of SEQ ID NO: 4 and 17 oligonucleotides &lt; RTI ID = 0.0 &gt; The oligonucleotide primer set (nested primer set 1) of SEQ ID NOS: 22 and 18 and the oligonucleotide primer set of SEQ ID NOS: 23 and 14 were set in the primer set (combination 20) and the oligonucleotide primer set of SEQ ID NOS: 7 and 13 (Nested primer set 2), but is not limited thereto.

That is, the APMoV diagnostic primer set of the present invention comprises a nested primer set (APMoV-N40; SEQ ID NO: 4 and APMoV-C70; SEQ ID NO: 17) (SEQ ID NO: 22 and APMoV-C80; SEQ ID NO: 18) and the APMoV diagnostic primer combination 37 (APMoV-N70; SEQ ID NO: 7 and APMoV-C30; SEQ ID NO: 13) Primer set (APMoV-N75; SEQ ID NO: 23 and APMoV-C40; SEQ ID NO: 14). PCR assays are performed using a nested primer for this primer combination to determine if the results of the first RT-PCR test are required, ie, whether the RT-PCR product is derived from APMoV. At this time, if the RT-PCR result is derived from APMoV, it will be positive in PCR for assay (see FIG. 8).

The oligonucleotide primer may comprise at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 20, at least 20, at least 20, at least 21, Lt; RTI ID = 0.0 &gt; oligonucleotides &lt; / RTI &gt; consisting of fragments of more than two consecutive nucleotides. For example, a primer (22 oligonucleotides) of SEQ ID NO: 4 is a fragment of 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, or 21 or more consecutive nucleotides in the sequence of SEQ ID NO: And the primer (19 oligonucleotides) of SEQ ID NO: 7 may comprise oligonucleotides consisting of fragments of 16 or more, 17 or more, 18 or more consecutive nucleotides in the sequence of SEQ ID NO: 7 have.

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, the oligonucleotide used as a primer also includes a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid Or may include an intercalating agent.

The present invention also provides an APMoV diagnostic kit comprising the oligonucleotide primer set and a reagent for carrying out an amplification reaction.

In one embodiment of the present invention, the kit may further comprise one or more DNA fragments selected from the group consisting of DNA fragments having the nucleotide sequences of SEQ ID NOs: 24 and 25, preferably SEQ ID NOs: 24 and 25 But is not limited to, a DNA fragment having a nucleotide sequence of SEQ ID NO. The DNA fragment having the nucleotide sequence of SEQ ID NO: 24 or 25 can be used as a plasmid having the function of a positive control for RT-PCR or PCR reaction using the APMoV diagnostic oligonucleotide primer set (see FIGS. 12 and 13).

In one embodiment of the present invention, the reagent for performing the amplification reaction may include a DNA polymerase, dNTPs, and a buffer, and may further include a ribonuclease inhibitor, a thermostable polymerase, and the like But is not limited thereto. The DNA polymerase may be a reverse transcriptase such as RNA dependent DNA polymerase and may be a reverse transcriptase from various sources such as avian myeloblastosis virus- derived virus reverse transcriptase (AMV RTase), murine leukemia virus-derived virus reverse transcriptase (MuLV RTase), and Rouse-associated virus 2 reverse transcriptase (RAV-2 RTase , But is not limited thereto. In addition, the buffer may include both a reverse transcription buffer and a PCR buffer, and the thermostable polymerase may be an EF Taq polymerase.

In one embodiment of the present invention, the kit may further include a user guide describing optimal reaction performance conditions. The guide is printed to describe how to use the kit, for example, how to prepare reverse transcription buffer and PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In addition,

Isolating total RNA from the plant sample;

Amplifying the target sequence by performing RT-PCR using the separated total RNA as a template and using the oligonucleotide primer set; And

And detecting the amplification product. &Lt; Desc / Clms Page number 2 &gt;

The method of the present invention comprises separating total RNA from a plant sample. Any method known in the art may be used as a method for separating the total RNA from the sample. For example, a phenol extraction method may be used. The target sequence can be amplified by performing RT-PCR using the separated total RNA as a template and using one or more oligonucleotide primer sets according to one embodiment of the present invention as primers. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method according to one embodiment of the present invention, the plant may be a Solanaceae plant including bell pepper, red pepper, chili, chili, eggplant, potato, white poplar, peruvian apple and wild tobacco, But not limited thereto, plants that can be infected with APMoV can be included within the scope of the present invention.

In one embodiment of the invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance may be a fluorescent, phosphorescent or radioactive substance, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as 32 P or 35 S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. One or more oligonucleotide primer combinations used to amplify the target sequence are as described above.

In one embodiment of the present invention, the method for diagnosing APMoV comprises detecting the amplification product, wherein the detection of the amplification product is performed using a DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, But it is not limited thereto. As one method of detecting the amplification product, capillary electrophoresis can be performed. Capillary electrophoresis, for example, can use the ABi Sequencer. In addition, gel electrophoresis can be performed, and gel electrophoresis can utilize agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as 32 P or 35 S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  1. Andean potato spot virus ( APMoV ) Diagnostic Primer  Design and combination

Plants infected with APMoV exhibit dwarfing and leaf discoloration and malformation as a whole (Fig. 1). In order to prevent deterioration of the productivity and deterioration of the quality of plants due to the degradation, the present invention provides an APMoV diagnostic primer using a gene related to coat protein and virus migration of APMoV.

To design the primer for diagnosis of APMoV, three sequences of APMoV and a sequence of three species of Secoviridae similar to APMoV were taxonomically downloaded from the National Center for Biotechnology Information (NCBI) (Table 1).

Virus information used for species-specific sequence searches Virus name (system or Separator ) acronym GeneBank  Registration number (length, bp ) Andean potato mottle virus APMoV L16239 (3,671) Andean potato mottle virus (VP22 gene) APMoV M81775 (1,096) Andean potato mottle virus (VP42 gene) APMoV M83536 (1,161) Bean pod mottle virus BPMV M62738 (3,662) Cow parsnip mosaic virus CPMV X00729 (3,481) Cowpea severe mosaic virus CPSMV M83309 (3,732)

The six sequences were sorted in the FASTA format and multiple alignments were performed using the DNAMAN package, a sequence alignment program (Lynnon Biosoft). Then, a species-specific sequence of APMoV was searched and a diagnostic primer was designed for 680 to 3,605 bp of the sequence of about 3.6 Kb (FIG. 2).

The designed primers were composed of 10 kinds of forward primers (upstream) and 11 kinds of reverse primers (total of 21) (Table 2), and 45 combinations amplifiable by PCR were selected. Each RT-PCR product The expected size is shown in Table 3.

Information on diagnostic primers designed from APMoV species common sequence primer  designation order SEQ ID NO: Length ( bp ) location* Forward APMoV-N10  GCAGTTCCAATAATGCCAG One 19 680-699 APMoV-N20  GCTTTGTTTGTTACCCAGC 2 19 890-909 APMoV-N30  CAGAAATGAGTTCAAGCCAG 3 20 1,183-1,203 APMoV-N40  GGATGATACCAAGAGTCTCAAG 4 22 1,462-1,484 APMoV-N50  CACATCTGATAAACACCTGACC 5 22 1,717-1,739 APMoV-N60  AACTGACTGTGCTGTCGCA 6 19 1,915-1,934 APMoV-N70  GCAGCAATGTGGAACTACC 7 19 2,138-2,157 APMoV-N80  ACATCTTTGTTGGCGTGG 8 18 2,570-2,588 APMoV-N90  ATGTGAGAAGAGCACCTGG 9 19 2,877-2,896 APMoV-N100  GCAGGAAATAGGATGGTTC 10 19 3,113-3,132 Reverse APMoV-C10  GCTCAGAAACGCAAGAACT 11 19 3,587-3,605 APMoV-C20  CAACATTTGCCATCCAAGAC 12 20 3,025-3,044 APMoV-C30  GCTTGTGCTACTCCATTCAG 13 20 2,850-2,869 APMoV-C40  CTACAACAAGTCCAGGATTG 14 20 2,512-2,531 APMoV-C50  TCCTGAAACCTGAGTGGAC 15 19 2,359-2,377 APMoV-C60  ATCATCTCCCACTGCTGCT 16 19 2,086-2,104 APMoV-C70  CACACAACGCTTTCTTCAG 17 19 1,758-1,776 APMoV-C80  GTGCCAATAAGTGATGCC 18 18 1,576-1,593 APMoV-C90  GCACCTAATGTCTCACTAACC 19 21 1,363-1,383 APMoV-C100  TTGCTCTCTCCTTCCTTGC 20 19 1,121-1,139 APMoV-C110  CAACCTGAGTATCTGGGAA 21 19 941-959

* Based on CenBank registration number L16239

Estimated size of APMoV diagnostic primer combination and RT-PCR product Combination Upstream Downstream PCR product size (bp) One APMoV-N10 APMoV-C110 280 2 APMoV-N10 APMoV-C100 460 3 APMoV-N10 APMoV-C90 704 4 APMoV-N10 APMoV-C80 914 5 APMoV-N10 APMoV-C70 1,097 6 APMoV-N10 APMoV-C60 1,425 7 APMoV-N20 APMoV-C100 250 8 APMoV-N20 APMoV-C90 494 9 APMoV-N20 APMoV-C80 704 10 APMoV-N20 APMoV-C70 887 11 APMoV-N20 APMoV-C60 1,215 12 APMoV-N20 APMoV-C50 1,479 13 APMoV-N30 APMoV-C90 201 14 APMoV-N30 APMoV-C80 411 15 APMoV-N30 APMoV-C70 594 16 APMoV-N30 APMoV-C60 922 17 APMoV-N30 APMoV-C50 1,195 18 APMoV-N30 APMoV-C40 1,349 19 APMoV-N40 APMoV-C80 132 20 APMoV-N40 APMoV-C70 315 21 APMoV-N40 APMoV-C60 643 22 APMoV-N40 APMoV-C50 916 23 APMoV-N40 APMoV-C40 1,070 24 APMoV-N40 APMoV-C30 1,408 25 APMoV-N50 APMoV-C60 388 26 APMoV-N50 APMoV-C50 661 27 APMoV-N50 APMoV-C40 815 28 APMoV-N50 APMoV-C30 1,153 29 APMoV-N50 APMoV-C20 1,328 30 APMoV-N60 APMoV-C60 190 31 APMoV-N60 APMoV-C50 463 32 APMoV-N60 APMoV-C40 617 33 APMoV-N60 APMoV-C30 955 34 APMoV-N60 APMoV-C20 1,130 35 APMoV-N70 APMoV-C50 240 36 APMoV-N70 APMoV-C40 394 37 APMoV-N70 APMoV-C30 732 38 APMoV-N70 APMoV-C20 907 39 APMoV-N70 APMoV-C10 1,468 40 APMoV-N80 APMoV-C30 300 41 APMoV-N80 APMoV-C20 475 42 APMoV-N80 APMoV-C10 1,036 43 APMoV-N90 APMoV-C20 168 44 APMoV-N90 APMoV-C10 729 45 APMoV-N100 APMoV-C10 493

Example  2. APMoV  Optimal for diagnosis primer  Set selection and diagnosis primer  Bank construction

Selection of APMoV was carried out with 45 primer combinations designed for the selection of optimal primer sets for diagnosis.

In the first selection, eight combinations out of 45 combinations (combinations 2, 4, 9, 10, 20, 21, 36 and 37 in Table 3) were selected (FIG. Table 4 shows the list of the candidates for the second selection, the flexible virus, the third selection, the host-related virus, and the fourth selection target. In the second selection, six of the eight combinations (Table 2, 4, 9, 10, 20 and 37) were selected (Figure 4) 3 combinations 9, 10, 20 and 37) were selected (Fig. 5). Two combinations (combinations 20 and 37 of Table 3) were selected (Figure 6), except for the two combinations in which nonspecific reactions occurred in the final quaternary selection of branches and crops.

APMoV Diagnostic Primer Second and Third Selection Target Viruses and Quadrant Selection List of Hosts division Scientific name acronym Secondary selection target
(4 species) Andean potato mottle virus APMoV Bean pod mottle virus BPMV Cow parsnip mosaic virus CPMV Squash mosaic virus SqMV 3rd selection target
(15 species) Alfalfa mosaic virus AMV Arracacha  B virus AVB Cucumber mosaic virus CMV Potato spindle tuber viroid PSTVd Potato  T potyvirus PVT Potato virus A PVA Potato virus S PVS Potato virus X PVX Potato virus Y PVY Tobacco mosaic virus TMV Tobacco necrosis virus TNV Tobacco rattle virus TRV Tobacco streak virus TSV Tomato mosaic virus ToMV Tomato spotted wilt virus TSWV 4th selection
(Three kinds) potato - Poleman - tomato -

As a result of the 1st to 4th selection, finally two combinations (combination 20 and 37) were selected, and the selected APMoV virus detection primer combinations showed sensitivity of 10 -3 in end-point PCR (dilution limit experiment).

For selected combinations, a nested primer combination was designed (Table 5), in which RT-PCR products used as templates were diluted 1/100 each. As a result of the nested PCR, bands were confirmed in all combinations (FIG. 8). The nested primer, which is a primer for screening, was finally selected considering the difference in brightness and thickness of the band, the presence or absence of nonspecific bands, the size, and the size of the PCR primer combination product selected.

Combination of test nested primers for selected combinations primer  Combination number Forward Reverse Length ( bp ) Combination 20 APMoV-N45 APMoV-C80 128 Combination 37 APMoV-N75 APMoV-C40 391

As a result, combination 20 (APMoV-N40 and APMoV-C70) and combination 37 (APMoV-N70 and APMoV-C30) were selected as the optimal primer set for APMoV diagnosis and two sets of nesting primers (APMoV-N45 and APMoV-C80, APMoV-N75 and APMoV-C40) were selected. The sizes of the diagnostic primer set, the nested primer set and the positive control finally selected for testing APMoV are summarized in Table 6, and the primer information is shown in Table 7.

Optimum primer set for APMoV diagnosis and nested primer set for assay set Final selection primer Nested primer positivity Control
( bp ) Forward Reverse Length ( bp ) Forward Reverse Length ( bp ) One APMoV-N40 APMoV-C70 315 APMoV-N45 APMoV-C80 128 1,408 2 APMoV-N70 APMoV-C30 732 APMoV-N75 APMoV-C40 391

The base sequence of the final selection primer primer Base sequence SEQ ID NO: primer  Length
( bp ) Amplification Product Length
( bp ) Set 1
(Combination 20) APMoV-N40 GGATGATACCAAGAGTCTCAAG 4 22 315 APMoV-C70 CACACAACGCTTTCTTCAG 17 19 Set 2
(Combination 37) APMoV-N70 GCAGCAATGTGGAACTACC 7 19 732 APMoV-C30 GCTTGTGCTACTCCATTCAG 13 20 Set 1
(nested) APMoV-N45 GATACCAAGAGTCTCAAGTTGC 22 22 128 APMoV-C80 GTGCCAATAAGTGATGCC 18 18 Set 2
(nested) APMoV-N75 GCAATGTGGAACTACCAGA 23 19 391 APMoV-C40 CTACAACAAGTCCAGGATTG 14 20

Example  3. APMoV Diagnosis and examination

For the diagnosis of APMoV from plants in the field of virus screening, one-step or two-step PCR using primer set 20 (APMoV-N40 and APMoV-C70) and primer set 37 (APMoV-N70 and APMoV- When two-step RT-PCR is performed, the primer binds at the positions shown in Fig. 9 (APMoV-N40 and APMoV-C70; 315 bp) and Fig. 10 (APMoV-N70 and APMoV- To form a band. At this time, a plasmid (SEQ ID NO: 24) was prepared (Fig. 11 and 12) so as to include the entire region where the diagnostic primer set was designed so that it could be used as a positive control.

In addition, a mutation positive control (SEQ ID NO: 25) in which a part of the plasmid sequence was modified was prepared (Fig. 13) in case of false positive reaction due to contamination of positive control at diagnosis. When using a mutation-positive control, primer sets (APMoV-N70 and APMoV-C30) and nested primer sets (APMoV-N75 and APMoV-C40) of combination 37 should be used. Using a mutant-positive control as a positive control, when analyzing the base sequence of a sample that showed a positive reaction after the test, it can be judged whether it is a genuine virus-infected sample or contaminated from a positive control. That is, the bands from the genuine virus-infected samples would not have the artificially inserted 6 bp sequence of FIG. 13 (GTCGAC), but the bands from the contaminated samples from the positive control were artificially inserted into the 6 bp sequence of FIG. 13 (GTCGAC). Therefore, it is possible to accurately diagnose the viral infection or contamination through the result of this sequence analysis. Because there are various strains in the APMoV virus species, some of the base sequences may be substituted, resulting in differences in the size of the product when the sequence is identified.

<110> REPUBLIC OF KOREA (Ministry of Agriculture, Food and Rural Affairs, Animal and Plant Quarantine Agency) <120> Primer set for diagnosing Andean potato mottle virus and uses          the <130> PN13155 <160> 25 <170> Kopatentin 2.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 1 gcagttccaa taatgccag 19 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 2 gctttgtttg ttacccagc 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 3 cagaaatgag ttcaagccag 20 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 4 ggatgatacc aagagtctca ag 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 5 cacatctgat aaacacctga cc 22 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 6 aactgactgt gctgtcgca 19 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 7 gcagcaatgt ggaactacc 19 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 8 acatctttgt tggcgtgg 18 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 9 atgtgagaag agcacctgg 19 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 10 gcaggaaata ggatggttc 19 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 11 gctcagaaac gcaagaact 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 12 caacatttgc catccaagac 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 13 gcttgtgcta ctccattcag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 14 ctacaacaag tccaggattg 20 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 15 tcctgaaacc tgagtggac 19 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 16 atcatctccc actgctgct 19 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 17 cacacaacgc tttcttcag 19 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 18 gtgccaataa gtgatgcc 18 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 19 gcacctaatg tctcactaac c 21 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 20 ttgctctctc cttccttgc 19 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 21 caacctgagt atctgggaa 19 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 22 gataccaaga gtctcaagtt gc 22 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 23 gcaatgtgga actaccaga 19 <210> 24 <211> 1408 <212> DNA <213> Artificial Sequence <220> <223> APMoV positive control <400> 24 ggatgatacc aagagtctca agttgcaaag tctgttgaat agcagaattg cagcaggtag 60 attttcaata cccatgaccg cagtcaaagg tactgttgtt ttcgatggtt tgttggcatc 120 acttattggc acaaccttga ggggagcacc tatgtttagg catacttaca ggcagagcac 180 aaagctgcgt tttattttta ccataaatgt tccaatatca actggtatag gacttatggt 240 agggtacaac agtgtcacat ctgataaaca cctgaccaac gagtatacaa tctcatctga 300 agaaagcgtt gtgtggaatc ctgcctgtca gggagtgctc gagttttcag tcagtcctaa 360 tccatgtggg atgtactggt catatgatta ttttaggcaa acaggatcac gcctttccat 420 ttgtgtaatt tcaccatgga gtgcaacacc cacaactgac tgtgctgtcg catggcaaat 480 ccatgtggat gatgagcaga tgactatgtc aatttttaat ccaacgcaag ctccagcagt 540 tttgcctgtg aaaagatgga tgggtaatct tatttttaaa cagggagcac aggagcaagt 600 ctttggcaa aatgcccaat tctttggcag caatgtggaa ctaccagatt ggtacattta attttgaatt 720 tacaaaattg agtagtccct tcatcaaagg aacgcttttg gcttttatag caatggatca 780 ggacgtgtct tatagtttgg aagagttgca aaattttcca aacaagattg tgcaatttga 840 tgaaaaagat ggaagggcat atgtatcttt tggtgaagag cactttgcac aagcatggtc 900 cactcaggtt tcaggagctg taacatcagc caaaaggggt tgtccttatt tgtatgttgt 960 tagtaaagat tgcatagctt ctaccatttg tggtgatttt caagtgggag ttaagttgct 1020 atctatagaa aattattcac catgtggtta caatcctgga cttgttgtag cttctacaat 1080 agtgcagaat actgcaggtt caaactctac atctttgttg gcgtggcctc agttttgtag 1140 tccatgtata aatgtttgga gtgagttttg tgcattagat attcctgttg tggacacaac 1200 taaggttaat tttgcccaat attctctgga tcttgtgaat ccaacagttt ctgcaaatgc 1260 ctctgggcgt aattggaggt ttgttcttat accttctccc atggtgtatt tacttcaaac 1320 ttcagactgg aaaagaggaa agttgcattt taagcttaaa atactgggga aatccaatgt 1380 taaacgatct gaatggagta gcacaagc 1408 <210> 25 <211> 738 <212> DNA <213> Artificial Sequence <220> <223> APMoV mutation positive control <400> 25 gcagcaatgt ggaactacca gattggtaca tttaattttg aatttacaaa attgagtagt 60 cccttcatca aaggaacgct tttggctttt atagcaatgg atcaggacgt gtcttatagt 120 ttggaagagt tgcaaaattt tccaaacaag attgtgcaat ttgatgaaaa agatggaagg 180 gcatatgtat cttttggtga agagcacttt gcacaagcat ggtccactca ggtttcagga 240 gctgtaacat cagtcgacgc caaaaggggt tgtccttatt tgtatgttgt tagtaaagat 300 tgcatagctt ctaccatttg tggtgatttt caagtgggag ttaagttgct atctatagaa 360 aattattcac catgtggtta caatcctgga cttgttgtag cttctacaat agtgcagaat 420 actgcaggtt caaactctac atctttgttg gcgtggcctc agttttgtag tccatgtata 480 aatgtttcca gtgagttttg tgcattagat attcctgttg tggacacaac taaggttaat 540 tttgcccaat attctctgga tcttgtgaat ccaacagttt ctgcaaatgc ctctgggcgt 600 aattggaggt ttgttcttat accttctccc atggtgtatt tacttcaaac ttcagactgg 660 aaaagaggaa agttgcattt taagcttaaa atactgggga aatccaatgt taaacgatct 720 gaatggagta gcacaagc 738

Claims (9)

SEQ ID NO: 4 and 17 and a set of oligonucleotide primers SEQ ID NO: 7 and APMoV (Andean comprising the nucleotide primer set up at least one group selected from the group consisting of nucleotide primer sets of 13 oligonucleotides of potato mottle virus ) diagnostic oligonucleotide primer set. The set of APMoV diagnostic oligonucleotide primers according to claim 1, which comprises an oligonucleotide primer set of SEQ ID NOs: 4 and 17 and an oligonucleotide primer set of SEQ ID NOs: 7 and 13. The oligonucleotide primer set of claim 1, further comprising at least one oligonucleotide primer set selected from the group consisting of the oligonucleotide primer set of SEQ ID NOs: 22 and 18 and the oligonucleotide primer set of SEQ ID NOs: 23 and 14. Oligonucleotide primer set. An APMoV diagnostic kit comprising an oligonucleotide primer set of any one of claims 1 to 3 and a reagent for carrying out an amplification reaction. The APMoV diagnostic kit according to claim 4, further comprising one or more DNA fragments selected from the group consisting of DNA fragments having the nucleotide sequences of SEQ ID NOS: 24 and 25. 5. The APMoV diagnostic kit according to claim 4, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs and a buffer. Isolating total RNA from the plant sample;
Performing the RT-PCR using the separated total RNA as a template and using the oligonucleotide primer set of any one of claims 1 to 3 to amplify the target sequence; And
And detecting the amplification product. The method of claim 7, wherein the plant is a method of diagnosing a APMoV characterized in that the Solanaceae (Solanaceae) plants. 8. The method of claim 7, wherein the detection of the amplification product is performed by DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.
KR1020130076801A 2013-07-02 2013-07-02 Primer set for diagnosing Andean potato mottle virus and uses thereof KR101479664B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130076801A KR101479664B1 (en) 2013-07-02 2013-07-02 Primer set for diagnosing Andean potato mottle virus and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130076801A KR101479664B1 (en) 2013-07-02 2013-07-02 Primer set for diagnosing Andean potato mottle virus and uses thereof

Publications (1)

Publication Number Publication Date
KR101479664B1 true KR101479664B1 (en) 2015-01-12

Family

ID=52588466

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130076801A KR101479664B1 (en) 2013-07-02 2013-07-02 Primer set for diagnosing Andean potato mottle virus and uses thereof

Country Status (1)

Country Link
KR (1) KR101479664B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150085677A (en) * 2014-01-16 2015-07-24 대한민국(관리부서 : 농림축산식품부 농림축산검역본부) Primer set for diagnosing Andean potato latent virus and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130054484A (en) * 2011-11-11 2013-05-27 한국생명공학연구원 Probe set for diagnosing or detecting virus of genus carmovirus and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130054484A (en) * 2011-11-11 2013-05-27 한국생명공학연구원 Probe set for diagnosing or detecting virus of genus carmovirus and uses thereof

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150085677A (en) * 2014-01-16 2015-07-24 대한민국(관리부서 : 농림축산식품부 농림축산검역본부) Primer set for diagnosing Andean potato latent virus and uses thereof
KR101651813B1 (en) 2014-01-16 2016-08-29 대한민국 Primer set for diagnosing Andean potato latent virus and uses thereof

Similar Documents

Publication Publication Date Title
KR101174708B1 (en) Primer combination for diagnosing Raspberry ringspot virus and uses thereof
Kogovšek et al. Single-step RT real-time PCR for sensitive detection and discrimination of Potato virus Y isolates
KR101491810B1 (en) Primer set for diagnosing Bean commom mosaic necrosis virus and uses thereof
KR20190050134A (en) Specific primer set for detecting blackberry chlorotic ringspot virus, quarantine plant virus and uses thereof
KR101479664B1 (en) Primer set for diagnosing Andean potato mottle virus and uses thereof
KR101678851B1 (en) Primer set for diagnosing or detecting Plantain mottle virus and uses thereof
KR101457980B1 (en) Primer set for diagnosing Carnation ringspot virus and uses thereof
KR101491789B1 (en) Primer set for diagnosing Bean pod mottle virus and uses thereof
KR101651815B1 (en) Primer set for diagnosing White clover mosaic virus and uses thereof
Hu et al. Diagnostic molecular markers for identification of different races and a pathotype of Columbia root knot nematode
KR101457979B1 (en) Primer set for diagnosing Carnation necrotic fleck virus and uses thereof
KR102096632B1 (en) Specific primer set for detecting Banana bunchy top virus, quarantine plant virus and uses thereof
KR101174695B1 (en) Primer combination for diagnosing Squash mosaic virus and uses thereof
KR102096633B1 (en) Specific primer set for detecting banana bract mosaic virus, quarantine plant virus and uses thereof
KR101093024B1 (en) Primer combination for diagnosing Arabis mosaic virus and uses thereof
KR101174815B1 (en) Primer combination for diagnosing Tobacco rattle virus and uses thereof
KR102096636B1 (en) Specific primer set for detecting Avocado sunblotch viroid, quarantine plant virus and uses thereof
KR101124602B1 (en) Primer combination for diagnosing Tomato bushy stunt virus and uses thereof
KR101651812B1 (en) Primer set for diagnosing Pelargonium zonate spot virus and uses thereof
Chiodi et al. Quantification of rhizomania virus by automated RNA isolation and PCR based methods in sugar beet
KR102279791B1 (en) Specific primer set for detecting TEV and uses thereof
KR101651813B1 (en) Primer set for diagnosing Andean potato latent virus and uses thereof
KR101093238B1 (en) Specific primers for detection of Onion yellow dwarf virus, and uses thereof
KR102279794B1 (en) Specific primer set for detecting Potato aucuba mosaic virus and uses thereof
KR102003916B1 (en) Specific primer set for detecting Phyllosticta capitalensis and uses thereof

Legal Events

Date Code Title Description
GRNT Written decision to grant